RNAi-gemedieerde controle van Aflatoxines in Peanut: Methode om Mycotoxine Productie en transgenexpressie Analyseer de Peanut /

Environment
 

Summary

We tonen een werkwijze voor de analyse van aflatoxinen en transgenexpressie in pindazaden dat RNA-stoorsignalen bevatten voor silencing aflatoxine-synthese genen in de schimmel Aspergillus flavus. RNAi-gemedieerde regulering van mycotoxinen in planten is niet eerder gerapporteerd.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Arias, R. S., Dang, P. M., Sobolev, V. S. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem. J. Vis. Exp. (106), e53398, doi:10.3791/53398 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De Voedsel- en Landbouworganisatie van de Verenigde Naties schat dat 25% van de voedselgewassen in de wereld zijn besmet met aflatoxinen. Dat vertegenwoordigt 100 miljoen ton voedsel wordt vernietigd of omgeleid naar niet-menselijke consumptie per jaar. Aflatoxinen zijn krachtige carcinogenen normaal opgebouwd door de schimmel Aspergillus flavus en A. parasiticus in granen, noten, wortelgewassen en andere landbouwproducten. Silencing van vijf aflatoxine-synthese genen door RNA interferentie (RNAi) in pinda planten werd gebruikt voor aflatoxine accumulatie na inenting met A. controle flavus. Voorheen bestond er geen methode om de effectiviteit van RNAi in individuele pinda transgene gebeurtenissen te analyseren, omdat deze meestal bij weinig zaden en traditionele grote veldexperimenten onder aflatoxine-bevorderlijk omstandigheden werden geen optie. In het veld, de waarschijnlijkheid om natuurlijk besmette zaden vaak 1/100 tot 1/1,000. Bovendien wordt aflatoxinebesmetting niet uniform verdeeld. Onze werkwijze gebruikt weinig zaden per transgene gebeurtenis met stukjes verwerkt voor real-time PCR (RT-PCR) of kleine RNA-sequencing en voor de analyse van aflatoxine accumulatie van ultra-vloeistofchromatografie (UPLC). RNAi-expressie pinda lijnen 288-72 en 288-74, kwamen tot 100% reductie (p≤0.01) in aflatoxine B 1 en B2 ten opzichte van de controle die tot opgelopen tot 14.000 ng. G -1 van aflatoxine B 1 bij geïnoculeerd met A. aflatoxigenic flavus. Als referentie, de maximale totaal van aflatoxines toegestane voor menselijke consumptie in de Verenigde Staten is 20 ng. G -1. Dit protocol beschrijft de toepassing van RNAi-gemedieerde controle van aflatoxines in transgene pinda zaden en methoden voor de evaluatie. Wij zijn van mening dat de toepassing ervan in de fokkerij van de pinda en andere gewassen snelle vooruitgang zal brengen op dit belangrijke gebied van de wetenschap, Medicijnen en menselijke voeding, en zal een belangrijke bijdrage leveren aan de internationale inspanningen om aflatoxines, en mogelijk andere mycotoxinen te controleren in grote voedselgewassen.

Introduction

Ongeveer 4,5 miljard mensen chronisch blootgesteld aan aflatoxines 1, de meest krachtige kankerverwekkende stoffen in de natuur 2 bekend. Deze verontreinigen mycotoxinen 25% van de voedselgewassen van de wereld 3, zoals maïs, cassave, rijst, noten, granen en kruiden. 4. Aflatoxines oorzaak dwerggroei bij kinderen van 5, aantasting van het immuunsysteem 6, aanwezig in 58% van hepatocellulaire carcinomen-zijn in de menselijke biopsies 7,8, en honderden mensen te doden tijdens de periodieke uitbarstingen van aflatoxicose 9,10. Aflatoxinen zijn polyketide afgeleid mycotoxinen normaal geproduceerd door Aspergillus flavus en A. parasiticus; aflatoxinen B 1 en B2 worden geproduceerd door A. flavus, terwijl A. parasiticus produceert G 1 en G2. De chemische structuur van deze verbindingen en een chromatogram dat de scheiding door UPLC zijn weergegeven in figuur 1.

Figuur 1
Figuur 1. aflatoxinen en RNAi invoegen Top. Chemische structuur (links) en voorbeeld chromatogram (rechts) van de vier meest voorkomende polyketide afgeleid aflatoxinen: B 1, B 2, G 1 en G2, geproduceerd door Aspergillus parasiticus, A . flavus produceert B 1 en B 2 Bodem: Schema van genfragmenten in de RNAi construct p5XCAPD gebruikt voor pinda transformatie, getallen onder pijlen zijn gen-fragment toetreding nummers in de Aspergillus flavus genoom;. PIV2: aardappel intron; bp: basenparen; RT_5X_1 en RT_5X_2. Real-Time PCR-primer locaties Klik hier om een grotere versie van deze figuur te bekijken.

Economische verliezen in de export als gevolg van aflatoxines in pinda alleen meer dan $ 450.000.000 $ indien berekend op basis van de 4 ng. G -1 limiet van aflatoxine toegestaan ​​voor menselijke consumptie in de Europese Unie 11. Aflatoxinen zijn bekend voor 60 jaar 12; Echter, hoewel veel landbouwpraktijken werden ontwikkeld om hun effect, met inbegrip van de toepassing van andere schimmelstammen 13,14 te beperken, geen consistente methode zeggenschap bestaat, en resistente plantenrassen zijn niet beschikbaar. Testfabriek kiemplasma voor resistentie tegen aflatoxines is bijzonder moeilijk, omdat zelfs onder omstandigheden bevorderlijk voor pathogeen invasie, mycotoxine accumulatie is onvoorspelbaar en volgt niet een normale verdeling. Zo experimenten vereisen gewoonlijk grote aanplant gebieden, honderden zaden en meerdere monsters van 100-1,700 g tot variabiliteit van de gegevens 15,16 verminderen.

RNA interferentie wasontdekt in 1998 17; en de voordelen van 'silencing' worden momenteel onderzocht in een aantal nieuwe toepassingen, bijv., in humane therapieën tegen uitgezaaide borstkanker 18, 19 leverkanker, myeloïde leukemie 20 en in bestrijdingsmiddelen tegen insecten en nematoden 22 21. In planten, kunnen RNA interferentie signalen cel reizen naar cel, met kleine interfererende RNA (siRNA) en een hoog moleculair gewicht RNA die verantwoordelijk is voor de systemische posttranscriptionele gene silencing 23,24, zelfs binnen schimmels die in nauw contact met waardplant 25. De effectiviteit van RNAi op plant- silencing van fungale pathogenen genen is beschreven in enkele installatie pathosystems, deze, visueel onderzoek symptomen in de bovengrondse delen van de planten (blad) toegestaan ​​ziekte kwantificering, dwz oomyceet Bremia in sla 26 , Puccinia in tarwe Fusarium in bananen 28. Veel moeilijker is om RNAi effectiviteit mycotoxinen in planten, met name aflatoxinen in grondnoten controle evalueren bladeren vertonen geen symptomen van infectie, de organen binnengedrongen (zaden) onder enkele centimeters van de bodem, het voorkomen van infectie is onvoorspelbaar, en slechts chemische analyse kan de aanwezigheid van aflatoxine te bepalen. Bovendien heeft elke transgene gebeurtenis in pinda normaal produceert weinig zaden (4-6 per plant); Daarom traditionele testen voor een no-aflatoxine accumulatie eigenschap in grote proefvelden, duurzame hele bijsnijden seizoenen, en het gebruik van honderden zaden is niet haalbaar. Een werkwijze wordt beschreven om te analyseren in minder dan een week, RNAi pindazaden aanwezigheid van transgene en een no-aflatoxine accumulatie eigenschap, met slechts weinig zaden.

Protocol

1. Moleculaire Construct en Peanut Transformation

  1. Combineer DNA fragmenten van vijf A. flavus genen, AFL2G_07223 (Afl of aflJ), AFL2G_07224 (AFLR), AFL2G_07228 (AFLC / pksA / pksL1), AFL2G_07731 (pes1) en AFL2G_05027 (aflatoxine effluxpomp, aflep). Gebruik hiervoor de volgende primers en ultramers: DIR-1, Korte-map1-R, DIR-2-omgekeerde, Korte-map2-R, DirAll-Nco-Rv en DirAll-BamEco-Fw, Tabel 1.
    1. Voeg DIR-1 dubbelstrengs door 5 PCR-cycli (25 gl reactiemengsel, 95 ° C 2 min, gevolgd door 5 cycli van 94 ° C 45 sec, 55 ° C 30 sec, 68 ° C 15 sec) met behulp van DNA polymerase volgens de fabrikant instructies en primer korte map1-R naar een 3 'overhang CCCGT vertrekken. Herhaal deze stappen om DIR-2-omgekeerde dubbele streng te maken met behulp van primer Korte map2-R naar een 3 'overhang ACGGG complementair aan DIR-1 te verlaten.
    2. Afbinden van de twee 199 bp Fragmegen met T4 DNA Ligase volgens instructies van de fabrikant. PCR amplificeren van het resulterende 393 bp fragment zoals in 1.1.1 gebruikmaking van primers DirAll-CACC-Fw en DirAll-Nco-Rv (tabel 1) en het product klonen onder toepassing van standaardtechnieken in pENTR1A plasmide p2 + 4ENTR maken.
    3. Recombineren p2 + 4ENTR in pCAPD 29 (NCBI Toetreding: KC176455.1) met behulp van LR clonase II enzym mix volgens de instructies van de fabrikant om plasmide p5XCAPD te maken, en omzetten in Escherichia coli DH5a met behulp van standaard technieken gevolgd door een gedeeltelijke sequencing. Opmerking: De complete RNAi inzetstuk is weergegeven in tabel 1.
  2. Transformatie Agrobacterium stam C58C1 30 met plasmide p5XCAPD zoals eerder gerapporteerd 30 en gebruikt de verkregen bacterie pindaplanten transformeren als volgt:
    1. Groeien bij 30 ° C de Agrobacterium p5XCAPD Gebruik hiervoor 50 ml LB-bouillon aangevuld met 500ug ml -1 streptomycine, 25 ug ml -1 gentamicine, 10 ug ml-1 kanamycine, en schud de cultuur bij 250 rpm tot het bereiken van 1 OD 260.
    2. Oogst de Agrobacterium-cellen door centrifugeren (6000 x g) gedurende 10 min, resuspendeer in 50 ml AB minimaal medium 31 met 100 pM acetosyringoon gedurende 1 uur, en plaats in de bacteriesuspensie de explantaten 10-14 dagen oude zaailingen Exp27-1516, agent -type pinda fokkerij lijn. Blot droog de ​​explantaten op 3MM vloeipapier na 30 min, en leg ze op shoot-inductie medium (SIM) [MS zout 32, 3% sucrose, 20 uM benzylaminopurine (BAP), 10 M thidiazuron (TDZ), pH 5,8, 0,3 % gellangom] zonder antibiotica in het donker gedurende drie dagen.
    3. Doe weefsel selectie en regeneratie zoals gemeld vóór 33. Verplaats weefsels (500 uM cefotaxime en 100 uM kanamycine) SIM voor de vorming shoot, met tweewekelijkse transfers voor 2 maanden. Dan plaatshet uitbreiden van scheuten op shoot-rek medium (SEM) [5 uM BAP, 1 uM gibberellinezuur (GA 3)], tweewekelijks voor enkele maanden.
    4. Plaats individuele scheuten, 2 cm in grootte, in de root-inductie medium (RIM) [1/2 MS, 1,5% sucrose, 5 uM α-naftaleen-azijnzuur (NAA), 2,5 uM indol-boterzuur (IBA)] dan acclimatiseren de zaailingen en overbrengen naar de kas.

2. Identificatie van Peanut Planten herbergen RNAi naar Silence Aflatoxine Synthese Genes

  1. Gebruik plantaardige mini kit in een robot werkstation met 200 ul elutie volgens de instructies van de fabrikant om DNA te extraheren uit jonge bladeren van pindaplanten die aan het transformatieproces was (zoals eerder beschreven) met RNAi construct p5XCAPD (figuur 1), die als backbone heeft plasmide pCAPD 29 voor gen-silencing.
  2. Het scherm van de DNA-monsters van single-tube geneste PCR (STN-PCR), zoals beschreven PreviDUREND 34 tot de selecteerbare marker NPTII detecteren en de RNAi invoegen van p5XCAPD. Klonaal propageren van bezuinigingen (3-4 knopen) PCR-positieve planten voldoende zaden voor het testen van de productie in deze eerste generatie.
    1. Gebruik vier 2-voudige verdunningen van DNA (50-100 ng gl -1 vóór verdunning) in alle STN-PCR reacties. Voor NPTII, gebruik maken van externe primers PCAPD 5714F: 5'-AGGCTATTCGGCTATGACTG-3 'en PCAPD 6446R: 5'-CGTCAAGAAGGCGATAGAAG-3', en interne primers PCAPD 5730F: 5'-ACTGGGCACAACAGACAATC-3 'en PCAPD 6249R: 5'-ATATTCGGCAAGCAGGCATC- 3 '.
    2. Voor detectie van RNAi voegen in STN-PCR-reacties gebruik maken van externe primers 35S-PDSFw: 5'-CCTAACAGAACTCGCCGTAA-3 'en DirAll-Nco-Rv: 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3', en interne primers Probe_5027_Fw: 5'-gtatttgtgaccatgtttctg-3 en Probe_7228_Rv: 5'-GGACGGATAGTAAACTGCGG-3 '.
  3. Oogst pinda peulen van STN-PCR positieve planten en de con trol planten gekweekt onder dezelfde omstandigheden. Kritische stap: Zorg ervoor dat de controle planten worden geteeld in dezelfde voorwaarden en hetzelfde seizoen als RNAi planten. Ontploffing van het water van de peulen met een hogedrukreiniger op lage intensiteit of schrapen met de hand om zaadomhulsel verwijderen, bepalen de kleur van de mesocarp door het plaatsen van de peulen op een looptijd boord en aparte peulen in groepen (geel, oranje, bruin en zwart) 35 (Figuur 2).

Figuur 2
Figuur 2. Voorbereiding van de pinda pods voor analyse. Links: Verschillende pinda maten gevonden bij de oogst zoals pinda is onbepaalde plantengroei; Center: het plaatsen van pinda's in metalen mand voor waterdruk verwijdering van zaadomhulsel; Rechts: looptijd groepen door mesocarp kleur op een pinda profiel board (geel, oranje, bruin en zwart).98fig2large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

3. Experimentele Setup

  1. Verwijder de rompen, proces geel en bruin zaden afzonderlijk. Bereken het aantal zaden te gebruiken in het experiment volgens tabel 2. Merk op dat een minimum van drie zaad stukken (1 zaad stuk = halve cotyledon) per pinda lijn en bemonstering datum is vereist om statistische analyses uit te voeren en de standaard fouten te verminderen.
Naam Sequentie
DIR-1 5'-
GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTCGTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAATCCCCTGCATCTACGCGCACGCATC
ACTTGGGGTACCCGT-3 '
Korte dir1-R 5'-Phos-TACCCCAAGTGATGCGTGCGCG-3 '
DIR-2-geïnverteerde 5'GGTTATTGGGTGCAGAATGGTAAACCACCCAACAGTACGCGAAATG
TCAATTCCAGAGTCCCAAACCTCCCTACCGTGGCCTGGACGGATAG
TAAACTGCGGAGCTTGGGAACAAAATCCGCTGTCTGATCGCCGAAG
AGAAAGAGTTGCCTTGATTGAGCCGCATCGAGGACAGGTTGTGTTG
CTGTTGATAGACGGG-3 '
Korte map2-R 5'-Phos-CTATCAACAGCAACACAACC-3 '
DirAll-CACC-Fw 5'-CACCGCCAGCTCAAAAGTGCGATGC-3 '
DirAll-Nco-Rv 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3 '
DirAll-BamEco-Fw 5'-ATGGGATCCGAATTCGCCAGCTCAAAAGTGCGATGC-3 '
Compleet RNAi insert 5'GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTC / GTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAAT / CCCCTGCATCTACGCGCACGCAT
CACTTGGGGTACCCGTCTATCAACAGCAACACAACCTGTCCTCGAT
GCG / GCTCAATCAAGGCAACTCTTTCTCTTCGGCGATCAGACAGCG
GATTTTGTTCCCAAGCTCCGCAGTTTACTATCCGTCCA / GGCCACGG
TAGGGAGGTTTGGGACTCTGGAATTGACATTTCGCGTACTGTTGGG
TGGTTTACCATTCTGCACCCAATAACC-3 '

. Tabel 1. Oligonucleotiden en ultramers gebruikt om de RNAi construct p5XCAPD Phos bouwen: gefosforyleerd 5'-uiteinde; "/" Scheidt de vijf genfragmenten gebruikt; Compleet RNAi insert: sequentie die wordt gebruikt als 2 omgekeerde herhalingen te p5XCAPD vormen.

  1. Plaats gehele pindazaden in een enkele laag, zodat deze betrekking hebben op de bodem van een steriele beker. Voeg 75% ethanol / water (v / v) oplossing om de zaden te bedekken en voeg een gelijk volume van dezelfde oplossing. Incubeer bij kamertemperatuur gedurende 30 sec en daarna spoelen met steriel gedeïoniseerd water (SDW).
  2. Voeg 2% hypochloriet het bekerglas met ethanol behandelde zaden als volgt: voeg dan 2% hypochloriet oplossing behoort het zaad, dan een gelijk volume van dezelfde oplossing en incubeer gedurende 5 min. Kritische stap: Spoel grondig driemaal met een volume SDW gelijk aan 5 maal de hoeveelheid hypochloriet gebruikt (figuur 3).

Figuur 3
Figuur 3. Experimentele setup. Top: Oppervlakte sterilisatie van pinda zaden voor en na hypochloriet, verwijdering van zaadhuiden (testa); Midden: het verwijderen van embryo en dichtbij bekijken van embryo, snijd cotyledon in de helft slotte: half zaadlobben in steriel gedistilleerd water, blotting op steriel absorberend papier, deuken op het water agar, en het plaatsen van de helft zaadlobben (gesneden kant naar boven) op de agar oppervlak. Klik hier om een grotere versie van deze figuur te bekijken.

  1. Laat het oppervlak gesteriliseerde zaden indrinken ondergedompeld in SDW gedurende 2 uur. Leg de zaden op een steriele petrischaal, verwijder het zaad jassen met een tang, scheiden de zaadlobben, en met een scalpel verwijdert de embryo's. Let op:Embryo's kunnen worden weggegooid of gebruikt om nieuwe planten te regenereren.
  2. Snijd elke cotyledon in de helft met een scalpel. Om uitdroging te voorkomen, houden de snede zaad stukken in steriel water totdat alle zaden worden verwerkt.
  3. Bereid platen met steriel water agar (1,5% agar / water; w / v), een voor elk zaadje drie stukken. Maak kleine deukjes in de agar behulp van een tang, kort dep het overtollige water van het zaad stukken op steriele papieren handdoeken, en plaats dan het zaad stukken (snijvlak naar boven) op het water / agarplaten.
  4. Uit verse cultuur van Aspergillus flavus aflatoxigenic NRRL 3357 in de Czapek agar medium gekweekt bij 25 ° C gedurende 10 dagen, bereidt een suspensie van 50.000 sporen per pl SDW, geteld met een hemocytometer.
  5. Plaats 2 ul van de sporensuspensie op de snijvlakken van elke halve cotyledon stuk vermijden afvoer aan de zijkanten, om ervoor te zorgen dat de sporen worden blootgesteld aan het zaad weefsel dat RNAi (figuur 4) herbergt.

    Figuur 4
    Figuur 4. Inoculatie en incubatie voor aflatoxine analyse. Top: Half cotyledon, inenting met sporensuspensie, en Aspergillus flavus myceliumgroei op de helft cotyledon na 24 uur incubatie Bottom: links:. Incubatie van 48 uur op 1,5% agar; center: incubatie gedurende 72 uur op 1,5% agar; rechts:. voorbeeld van onjuiste experimentele opstelling, incubatie gedurende 72 uur op 0,5% agar Klik hier om een grotere versie van deze figuur te bekijken.

    1. Incubeer de platen met geënt en niet-geënte zaadlobben halve bij 30 ° C in het donker tot bemonstering.

    4. De bemonstering voor aflatoxine Analyse en Gene Expression

    1. Verzamelen monstersdrievoud bij 24, 48 en 72 uur (96 uur optioneel) incubatie, zowel RT-PCR en voor analyse van aflatoxinen, elk repliceren als een stuk (half cotyledon). Pick willekeurig monsters van verschillende platen op elke bemonstering datum. Met behulp van een weefsel, zacht agar en overtollige schimmelsporen te verwijderen alvorens zaad stukken in flesjes of reageerbuizen.
    2. Voor de analyse van aflatoxinen, plaats elke herhaling (een stuk) in een 4 ml glazen schroefdop flesje en bewaar bij -80 ° C. Opmerking: Gezien de chemische stabiliteit van aflatoxinen, kunnen monsters worden in deze toestand gedurende enkele maanden (in de huidige experimenten gewoonlijk 1-2 maanden).
    3. Voor RT-PCR plaats elke herhaling (een stuk) in al voorbereid 2 ml malen buisjes met twee roestvrijstalen kralen (2,5 mm diameter) en drie zirkonium kralen (2 mm diameter).
    4. Onmiddellijk invriezen (bij voorkeur in vloeibare stikstof) alle monsters en bewaar ze bij -80 ° C tot bewerking.

    5. Aflatoxine analyse van individuele Half Cotyledon Pieces

    1. Gebruik de A. flavus geïnoculeerde monsters voor deze analyse. Breng monsters tot omgevingstemperatuur gedurende 30 minuten, voeg vier delen (gewoonlijk 2-3 ml; w / v) methanol (gegevens bewaren voor latere berekeningen), sluit de doppen en incubeer O / N (= 16 uur) in de donker zonder agitatie.
    2. Plaats een frit in een bijpassende 1,5 ml propyleen minikolom, voeg 200 mg elementaire Al 2 O 3 en dop met een andere frit zoals eerder 36 beschreven; Vervolgens plaatst u een Ultra-High Performance Liquid Chomatographer (UPLC) autosampler flesje onder de kolom dicht genoeg om mogelijke verdamping van het eluaat te voorkomen.
    3. In een wegwerpbare glazen reageerbuis (niet gebruikte kunststof) Plaats 0,5 ml van methanol extract verkregen in stap 4,1, voeg 0,5 ml acetonitril, meng met een pipet en breng 0,5 ml van het mengsel in de kolom bereid in stap 4,2. Sta elutie in de autosampler flesje door de zwaartekracht (niet van toepassing druk). Elutie duurt meestal 2-4 min, dicht the flacon onmiddellijk met een UPLC compatibele cap met septa. De injectieflacons bij omgevingstemperatuur en analyseren op dezelfde dag op een UPLC.
    4. Voor de scheiding van aflatoxine, plaats autosampler flacons met monster eluaten en autosampler flesjes met aflatoxine normen (B 1 en B 2 bij het ​​gebruik van A. flavus) in een UPLC instrument uitgerust met een bijpassende UPLC Kwartair Solvent Manager, UPLC Sample Manager, UPLC Fluorescent Detector, en een C 18 2,1 mm x 50 mm, 1,7 urn kolom.
      1. Gebruik een isocratische mobiele fase bestaande uit water / MeOH / CH3CN (64:23:13, v / v / v) mengsel met een stroomsnelheid van 0,30 ml min -1. Verkrijgen chromatogrammen verzekeren gestabiliseerde basislijnscheiding voor nauwkeurige berekening van aflatoxine concentratie, volgens de instructies van de fabrikant 37.
      2. Bevestig de identiteit van aflatoxine door het verkrijgen van hun massa-spectrale gegevens en deze te vergelijken met de gepubliceerde gegevens 38. Gebruik een ion trap massaspectrometer uitgerust met een ESI-interface en bijbehorende software volgens de instructies van de fabrikant.
    5. Bepaal concentraties aflatoxines hand van calibratie curves verkregen door het injecteren van verschillende hoeveelheden overeenkomstige geaccepteerde standaarden van aflatoxinen B 1, B 2, G 1 en G2 zoals door de fabrikant UPLC en waarbij de 37 software.
    6. Plaats zaad stukken al geëxtraheerd met methanol, in individuele glazen flessen voor O / N (~ 16 uur) vriesdrogen van hun droog gewicht te bepalen. Vervolgens berekenen aflatoxine concentratie in ng. G -1 drooggewicht van zaad stuk.
    7. Voor analyse van de gegevens omzetten aflatoxine resultaten log (ng. G -1 1), gevolgd door Tukey's test voor de gemiddelde vergelijkingen.

    6. Gene Expression, RT-PCR Verwerking van monsters

    1. Neem de 2 ml slijpen buizen bevattening monsters uit de -80 ° C vriezer en direct (zonder ontdooien) te malen in een parelmolen homogenisator bij 3100 rpm gedurende 40 seconden, vervolgens verder met RNA-extractie met behulp van Trizol volgens de instructies van de fabrikant.
    2. Bereid cDNA uit elk monster onder toepassing van 1 ug RNA en gelijke hoeveelheden oligo dT en willekeurige hexameren, maak een 1: 8 verdunning van het cDNA en gebruik 2 gl per reactie bij RT-PCR (zoals eerder beschreven 39).
      1. Voor de detectie van de expressie van RNAi insert gebruik primers: RT_5X_1_105F: 5'GGTGGCATTGGACCGTCTTG-3 ', RT_5X_1_232R: 5'-CGCATCGAGGACAGGTTGTG-3'; en RT_5X_2_95F: 5'-CCATGTTTCTGGTGGCATTG-3 ', RT_5X_2_229R: 5'-ATCGAGGACAGGTTGTGTTG-3'.
      2. Voor detectie van expressie van de selecteerbare merker NPTII, gebruik primers: RT_NPTII_1_6871F: 5'-CTCGCTCGATGCGATGTTTC-3 ', RT_NPTII_1_7004R: 5'-GCAGGATCTCCTGTCATCTC-3'. Gebruik de huishouding gen Actine voor standaardisatie, en primers: actine-Fw: CACATGCCATCCTTCGATTG; Actine-Rv: CCAAGGCAACATATGCAAGCT 40.
    3. Analyseer resultaten door Delta-delta C T-methode 41 gestandaardiseerd voor actine expressie. Vertegenwoordigen de resultaten als voudige toename ten opzichte van de controlegroep.

Representative Results

Plasmide p5XCAPD werd gemaakt als een afgeleide van pCAPD 29, en gebruikte het om pinda planten te transformeren; Deze vector draagt ​​omgekeerde herhalingen van vijf kleine fragmenten, 70-80 bp elk, aflatoxine-synthese genen van A. flavus gescheiden door een intron (Figuur 1). Fragmenten van AFL2G_07224 (AFLR), AFL2G_07223 (Afl of aflJ), AFL2G_05027 (aflatoxine efflux pomp aflep), AFL2G_07228 (AFLC / pksA / pksL1) en AFL2G_07731 (pes1) werden gebruikt voor het construct, getallen in figuur 1 overeen met A . flavus genoomannotatie in Broad Institute, Cambridge, MA, en de literatuur 42. Een totaal van 99 pinda lijnen werden geregenereerd na het doornemen van het transformatieproces, 50 waren PCR positief voor NPTII gedetecteerd door STN-PCR, en 33 lijnen waren PCR-positief en geproduceerd zaad. Slechts zeven PCR positieve lijnen werden klonaal gepropageerd en getest door de present Werkwijze voor aflatoxine accumulatie, zeven vertoonden tussen 60% en 100% minder aflatoxine accumulatie dan de controle. Hier laten we de resultaten van twee van die zeven lijnen. Als individuele transgene gebeurtenissen produceren meestal weinig zaden, werd er een methode ontwikkeld om een ​​minimum aantal zaden, terwijl nog steeds in staat om parametrische statistische analyse te doen gebruiken. Een stroomschema van de monstervoorbereiding en experimentele opstelling wordt getoond in figuur 5 en tabel 1. Hoewel de eerste generatie van transgene zaden is typisch hemizygoot, wordt verwacht dat de cel tot cel en systemische beweging van kleine interfererende RNA (siRNA) gegenereerde door middel van RNA interferentie moet aflatoxine-synthese silencing verlenen de hele plant.

Figuur 5
Figuur 5. Schematische stroomschema van de werkwijze om effectiviteit van RNAi analyseren silencing Aspergillus aflatoxine-synthese genen in pinda zaden. Grafische weergave van de workflow bij de verwerking van pinda-monsters voor genexpressie of aflatoxine analyse. Klik hier om een grotere versie van deze figuur te bekijken.

RNAi pinda lijnen 288-72 en 288-74 toonde aanwezigheid van de selecteerbare NPTII maker wanneer getest door STN-PCR, worden gel secties weergegeven in figuur 6 (boven), originele foto's zijn verkrijgbaar bij de auteurs op aanvraag. Plasmide pCAPD niet werd gebruikt als een controle transformatie aangezien codeert geïnverteerde herhalingen van twee genen Cmr (chloramfenicol resistentie) en CcdB (toxine) van onbekende effecten op planten. PCR negatieve pinda lijn 288-9 en anderen die ging door het regeneratieproces en werd gekweekt in dezelfde omstandigheden als RNAi-lijnen, werden gebruikt als negatieve control.

Figuur 6
. Figuur 6. Detectie van transgenen en Real Time expressie van RNAi insert Top: Single-buis, Geneste PCR detectie van transgene pinda lijnen RNAi-288-72 en RNAi-288-74, positieve planten. Controles: W (water), PP (positieve plant), MM (master mix), p (plasmide p5XCAPD); fracties 1/2 1/4 1/8 1/16 vertegenwoordigt 2-voudige verdunningen van DNA Bottom. Real-Time PCR detectie van expressie van RNAi voegen (primer sets: RT_5X_1, RT_5X_2, zoals in figuur 1, op onvolwassen ( geel) en volwassen (bruin) zaadlobben van transgene lijnen bij 24 en 48u incubatietijd; grijze lijn: C T = 1. Histogrammen vertegenwoordigen de middelen en de standaard error bars (T) van de drie biologische monstersdrie technische replicaten. De relatieve kwantificatie van RNAi insert was genormaliseerd met betrekking tot het huishouden gen Actine als een interne controle en vergelijkende voudige expressie van het transgen berekend zoals beschreven in 5.2.2 en 5.3. Klik hier om een grotere versie van deze figuur te bekijken.

Om de doeltreffendheid van plantaardige gastheer RNAi-gemedieerde controle hiervan aflatoxine accumulatie te testen werden vers geoogste conidia van Aspergillus flavus NRRL 3357 aangebracht op het snijvlak van half zaadlobben waaruit het embryo en de zaadhuid verwijderd waren (figuren 3, 4). A. flavus NRRL 3357, waarvan het genoom is gesequenced en was de basis voor het ontwerpen p5XCAPD, werd vriendelijk verschaft door Dr. Horn in USDA-ARS-NPRL. De resulterende schimmel invasie van half zaadlob na 24, 48 en 72 uur bij 30 ° C is toon n in figuur 4. De monsters van geïnoculeerde half cotyledonen werden verzameld op 24, 48, 72, 96 uur incubatie, en geanalyseerd op de vier belangrijkste aflatoxinen B 1, B 2, G 1 en G2 behulp UPLC en bevestigd door LC-MS ; resultaten worden in figuur 6. Aflatoxine werden bepaald onder toepassing van een gepubliceerde werkwijze met modificaties 36. Bij 96 uur incubatie, zaadlobben beginnen te desintegreren als gevolg van de schimmelinfectie. RNAi lijn 288-72 vertoonden aanzienlijk lagere niveaus van aflatoxines dan de controle op alle bemonstering data in onvolwassen zaadlobben en ten hoogste sampling data in de volwassen degenen. RNAi lijn 288-74 vertoonden aanzienlijk lagere niveaus van aflatoxinen hooguit sampling data. Het niveau van significantie van Tukey's test worden aangeduid met sterretjes in de grafiek van figuur 7.

g7.jpg "/>
. Figuur 7. Aflatoxine B 1 en B2 doormidden pinda zaadlobben na incubatie (24, 48, 72 en 96 uur) met Aspergillus flavus Controle: 288-9 zaden van niet-transgene lijn; RNAi: zaden van RNAi-288-72 en RNAi-288-74, transgeen voor RNAi p5XCAPD vijf aflatoxine-synthese genen tot zwijgen te brengen. (A) Aflatoxine B 1 in rijpe zaden (bruin); (B) Aflatoxine B 2 rijpe zaden; (C) Aflatoxine B 1 in onrijpe zaden (geel) en (D) Aflatoxine B 2 in onrijpe zaden. Gemiddelde waarden met de bijbehorende standaardfout bars (T) van duplo biologische monsters vertegenwoordigd. Statistisch significante verschillen Tukey's test *: p ≤ 0,05, **: p ≤ 0,01, ***: p ≤ 0,001.s: //www.jove.com/files/ftp_upload/53398/53398fig7large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Kortom, RNAi-288-72 toonde gedurende het experiment (24 tot 96 uur incubatie), een 94% -100% reductie van aflatoxine B 2, en een 90% -100% vermindering van aflatoxine B 1 in vergelijking met de controle. RNAi-288-74 vertoonde een 63% -100% reductie van aflatoxine B 2 en 60% -100% vermindering van aflatoxine B 1, figuur 7.

Primers voor real-time PCR detectie van expressie van RNAi insertie zijn getoond in figuur 1. Pinda-zaad zaadlobben werden geanalyseerd zonder embryo, hun natuurlijke afweer te verwijderen en kunnen het potentiële effect van RNAi detecteren op het gebied meest blootgesteld schimmels invasie, de zaadlobben. Uitdrukking van de RNAi insert gedetecteerd in onvolwassen zaadlobben (geel) van de lijn 288-74 door primer set RT_5X_1 was vier maal over de C T (figuur 1, 6). Expressie van RNAi insertie werd niet gedetecteerd in rijpe cotyledonen in 24 uur, of rijpe of onrijpe zaadlobben bij 48 uur incubatie, figuur 6 (onderaan).

Pinda Line De tijd van de bemonstering Monsters voor RT-PCR Monsters voor aflatoxine analyse (geënt) Nomber van zaden
(niet-geïnoculeerde)
Rep 1 Rep 2 Rep 3 Rep 1 Rep 2 Rep 3
RNAi (geel) 24 hr 1 1 1 1 1 1 4.5
48 hr 1 1 1 1 1
72 hr 1 1 1 1 1 1
Controle 24 hr 1 1 1 1 1 1 4.5
(geel) 48 hr 1 1 1 1 1 1
72 hr 1 1 1 1 1 1

Tabel 2. Voorbeeld van een kleine steekproef setup om genexpressie en aflatoxine accumulatie in RNAi pinda zaden analyseren. Volledige analyse van meningsuiting en aflatoxines voor een looptijd groep (bijv., Geel), met drie bemonstering (24, 48 en 72 uur) in drievoud zou 4,5 zaden nodig, elk nummer één in de tabel vertegenwoordigt half zaadlob.

Discussion

Plant-gastheer RNAi-gemedieerde silencing van genen in schimmels aangetoond 27,43, maar er zijn geen publicaties tonen de haalbaarheid van RNAi-gemedieerde regulering van mycotoxine accumulatie in planten. Een beperkende factor voor deze studies pinda was het ontbreken van een werkwijze om een ​​niet-aflatoxine accumulatie fenotype van individuele planten te evalueren, zoals bladeren vertonen geen symptomen van schimmelinfectie ondergrondse peulen. Bovendien zijn de niet-normaal accumulatie van aflatoxinen, en de noodzaak van grote monsters voor chemische analyse 15,16 de kwantificering van potentiële RNAi effect belemmerd op een enkele plant. De hier gepresenteerde methode omvat 72 uur experimenten met vijf zaden drie 24 h-interval bemonsteringen in drievoud (tabel 1, figuur 7) voeren. In vergelijking met de typische analyse van aflatoxinen dat niet minder dan 100 g zaad nodig, onze werkwijze is bijzonder geschikt voor individual transgene gebeurtenissen van pinda planten die aanvankelijk produceren niet meer dan twee of drie peulen.

RNA-gemedieerde silencing van aflatoxine synthese is aangetoond door genetische transformatie van Aspergillus flavus en A. parasiticus. Aangezien AFLR is een belangrijke regulator van aflatoxine productie in A. flavus en A. parasiticus 44,45, wordt het een interessant doelwit voor RNA-gemedieerde silencing bij planten. Echter, genetische variaties in AFLR aangetoond onder Aspergillus species 46 en die genetische varianten kon ontsnappen silencing indien er geen perfecte sequentie overeenkomen met RNAi signaal geproduceerd in de plantengastheer. Zo AFLR was een van de doelstellingen voor silencing in vector p5XCAPD, maar was niet de enige. Omgekeerde herhalingen van de AFLR gen ingebracht in A. flavus en A. parasiticus door transformatie resulteerde in zwijgen en minimale of geen production van aflatoxinen 47 (McDonald et al., 2005b). Ook silencing AFLD gen voorkomen aflatoxine productie met 98% in A. flavus en A. parasiticus in directe transformatie 48. Om de kans op succes in het systeem te verhogen, werd getransformeerd met pinda geïnverteerde repeat fragmenten van vijf genen betrokken bij aflatoxine productie A. flavus. Hier wordt aangetoond dat het gebruik van p5XCAPD dat doelstellingen voor silencing verschillende genen in het aflatoxine synthese route, 90% -100% lager gehalte aan aflatoxine B 1 en B 2 in lijn 288-72 werden bereikt, en 60-100% lagere niveaus opgebouwd in lijn 288-74 vergeleken met de controle, terwijl half zaadlobben werden geïnoculeerd met A. flavus, Figuren 4, 7. Het belangrijkste gedetecteerde deze werkwijze statistisch significante verschillen in aflatoxine accumulatie door lijnen 288-72, 288-74 vs. controle gedurende het experiment door toepassing van parametrische statistics, figuur 7. Gezien de kleine steekproef, is het belangrijk om de noodzaak benadrukken het gebruik van een krachtige methode voor aflatoxinen, deze experimenten werden geanalyseerd met UPLC met een hoge resolutie, vijf-voudige hogere prestaties en drie maal hogere gevoeligheid heeft dan detecteert HPLC 49.

Expressie van de RNAi insert in 288-74 werd pas ontdekt in onvolwassen zaadlobben (geel) bij 24 uur incubatie. De RNAi insert werd niet gedetecteerd door RT-PCR op rijpe zaadlobben van 288-74 op 24 uur, of op een looptijd groep op 48 uur, figuur 6. Ditzelfde fenomeen werd waargenomen in andere RNAi transgene pinda lijnen (Arias, RS, 2015 ongepubliceerd), waarbij gewoonlijk RNAi transcripten alleen werden gedetecteerd op onrijpe zaadlobben in 24 uur. RNA-monsters werden behandeld met DNAse voor cDNA-synthese, de gegevens werden genormaliseerd op het niveau van actine expressie en geen bewijs van DNA verontreiniging waargenomen. Indien DNA in de monsters aanwezig zijn, het moetzijn gedetecteerd in het 48 hr samples, maar dat was niet altijd het geval. Expressie onder controle van de 35S-promotor niet altijd uniform; het kan worden beïnvloed door omgevingsfactoren 50, type weefsel en het ontwikkelingsstadium 51,52. Op hetzelfde moment, in het pad van RNA-interferentie, de snelheid van mRNA verval en de snelheid van siRNA verval aanzienlijk 53 variëren. Het is mogelijk dat een snelle afbraak van het mRNA door het mechanisme van RNA interferentie mRNA-detectie kunnen voorkomen bij 48 uur incubatie. Of afwezigheid van expressie bij 48 uur was het gevolg van lage 35S-promoter gedreven transcriptie, of een snelle afbraak van dsRNA door Dicer nog worden beantwoord. Zo zou de detectie van kleine RNA's door high throughput sequencing een beter inzicht in de processen die plaatsvinden door middel van RNAi 54 geven in deze experimenten. Echter, omdat RNA-silencing verspreidt systemisch, voornamelijk via het floëem van photosynthaat bronnen putten sucrose (in casu pindazaden) 55, het zwijgen van aflatoxine-synthese kan plaatsvinden in zaden zonder lokale expressie van RNAi insert. Veel onderzoek moet nog worden gedaan om de drempelwaarde van kleine interfererende RNA's (siRNA's) die nodig zijn om aflatoxine accumulatie in zaden te voorkomen vast te stellen. Het is belangrijk te benadrukken dat zowel mRNA expressie van de RNAi construct (figuur 6), en accumulatie van aflatoxinen B 1 en B2 (figuur 7) vertoonde verschillende resultaten van onrijpe (geel) vs. volwassen (bruin) zaadlobben. Pinda planten onbepaalde groei, dat wil presenteren ze bij oogst verschillende looptijd pods, figuur 2. Bovendien zaden van verschillende rijpheid groepen verschillen in hun chemische samenstelling, bijv., 2,4% sucrose in onrijpe zaden, en 1,9% in rijpe zaden onder dezelfde veldomstandigheden 56,57. Dus, om de werkelijke efficienc begrijpeny van RNA-gemedieerde regulering van aflatoxine accumulatie, is het belangrijk om volwassenheid groepen afzonderlijk te onderzoeken.

Een natuurlijke afweer van pindazaden is de productie van fytoalexinen, die varieert in de verscheidenheid van verbindingen geproduceerd en hun relatieve hoeveelheden afhankelijk van de looptijd van de zaden en milieuomstandigheden 58-61, en ​​het is bijzonder hoger in vergelijking met embryo zaadlobben 62. Embryo's ook significant hogere concentraties van nucleïnezuren, zowel DNA als RNA dan de zaadlobben (RS Arias, ongepubliceerd). Zoals pinda zaden rijpen, veranderingen in hun fysiologie en chemische samenstelling optreden 63. Fenolische antioxidanten in pinda testa vorm gecondenseerde tannines met fungistatische activiteit 64; Dit blijkt ook uit de mesocarp kleur die volwassenheid fasen, geel tot zwart 35 weerspiegelt, zoals de inhoud van tannines en fenolen verhoogt met een looptijd van 65 jaar. Aldus aanwezigheid van tESTA of embryo's in het experiment, gezien hun antimicrobiële eigenschappen kunnen schimmelgroei beperkt en derhalve overschat het effect van RNAi derhalve werden zij verwijderd. Ook het verwijderen van testa en embryo helpt beperken de bronnen van variatie in de analyse, zoals helft zaadlob dat draagt ​​het embryo zal fytoalexinen meer RNA inhoud.

Naast de analyse naar looptijd groepen en verwijdering van testa en embryo deze experimenten, is het belangrijk te benadrukken enkele waarnemingen: a) hoewel de resultaten worden getoond voor maximaal 96 uur incubatie, is het raadzaam om niet meer dan 72 hr om consistente resultaten te verkrijgen, als zaden word afgebroken door 96 uur; en b) dat de helft zaadlobben van dezelfde zaad, hoewel steekproefsgewijs, niet volledig onafhankelijke steekproeven vormen, RT-PCR en aflatoxine accumulatie in transgene events toonden minimale verschillen tussen de zaden. Ook een nauwkeurige schimmelsporen mee volume inoculums van 2 pi, en toepassing van sporen op het snijvlak van de zaadlobben vermijden druipt aan de zijkanten belangrijk dat de gekiemde sporen worden blootgesteld aan het plantenweefsel. Het water / agar op de platen moet op 1,5% (w / v), zachte agar veroorzaakt afspoeling van sporen zoals op het laatste frame van Figuur 4 (onderste). Moet de beschikbaarheid zaad van een bepaalde transgene geval beperkt zijn, kan de bemonstering worden uitgevoerd in tweevoud in plaats van drievoudige verkrijgen van vergelijkbare resultaten (dat wil zeggen, figuur 7); zal echter drievoudige monsters helpen standaardfout verminderen. De enige beperking van deze werkwijze is dat het een uiterst gevoelig systeem (UPLC) aflatoxine detectie / kwantificering vereist, maar tevens teneinde de kans overschatten het effect van RNAi aflatoxinen mag niet worden gedetecteerd door minder gevoelige methoden.

Samenvattend biedt deze methode voor het eerst een betrouwbare benadering van de studieeffect van RNAi in de controle van aflatoxinen. Verminderen van de tijd voor een experiment van een hele teeltperiode tot minder dan een week, zal deze methode enorm versnellen van het onderzoek op RNAi-pinda / Aspergillus pathosystem naar de mitigatie en / of eliminatie van aflatoxines.

Materials

Name Company Catalog Number Comments
Primers, oligonucleotides DNA Technologies, Coralville, IA, USA n/a
Dneasy Plant Mini Kit Qiagen, Valencia, CA 69106
Czapek Dox agar medium Oxoid, by Thermo Fisher Scientific, Waltham, MA CM0095
Agar Thermo Fisher Scientific, Waltham, MA BP 1423
Freezer -80 °C n/a n/a
Aluminum Oxide, Al2O3 Fisher Scientific A941
SPE Reservoirs 1.5 ml Grace Davison Discovery Scientific 210011
Frits for 1.5 ml SPE reservoir Grace Davison Discovery Scientific 211401
Autosampler vials Waters Corporation, Milford, MA 186005221
Waters Acquity Ultra-Performance Liquid-Chromatography (UPLC) instrument; UPLC-H-Class Quaternary Solvent Manager; UPLC Sample Manager; UPLC Fluorescent detector (FLR); UPLC BEH C18 2.1 mm x 50 mm, 1.7 mm column Waters Corporation, Milford, MA
Finnigan LCQ Advantage MAX ion trap mass spectrometer, with Xcalibur version 1.4 software Thermo Electron Corp., San Jose, CA
Aflatoxin standards, B1, B2, G1 and G2 Sigma-Aldrich, St. Louis, MO A6636; A9887; A0138; A0263
Systat Software 12.2 SYSTAT Software Inc., Point Richmond, CA
Trizol reagent Invitrogen, CA 15596-018
SuperScript III First Strand Synthesis Super Mix Invitrogen, CA 11752-050
ABI 7500 Real-Time PCR Lifetechnologies, Grand Island, NY 4406984
Luria Broth-Miller Fisher Scientific R453642
pENTR1A Invitrogen, CA A10462
LR Clonase II enzyme mix Invitrogen, CA 11791-020
T4 DNA Ligase NEB Biolabs M0202L
Gelrite Sigma-Aldrich, St. Louis, MO G1919
Acetosyringone Sigma-Aldrich, St. Louis, MO D134406
QIAcube robot workstation Qiagen, Valencia, CA 9001292
Antibiotics: kanamycin, cefotaxime, gentamicin; streptomycin Goldbio, St. Louis, MO cef.: C-104-25; kan: K-120-5; gent.: G-400-1; strep.: S-150-50
Platinum Taq DNA Polymerase High Fidelity Invitrogen, CA 11304-029

DOWNLOAD MATERIALS LIST

References

  1. Williams, J. H., et al. Human aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions. The American Journal of Clinical Nutrition. 80, 1106-1122 (2004).
  2. American Association for Cancer Research: AACR. An evaluation of chemicals and industrial processes associated with cancer in humans based on human and animal data: IARC Monographs Volumes 1 to 20. Cancer Research. 40, 1-12 (1980).
  3. Turner, P. C. The molecular epidemiology of chronic aflatoxin driven impaired child growth. Scientifica. (2013).
  4. Rasooly, R., Hernlem, B., He, X., Friedman, M. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells. Toxins (Basel). 5, 1447-1461 (2013).
  5. Gong, Y. Y., et al. Determinants of aflatoxin exposure in young children from Benin and Togo, West Africa: the critical role of weaning. International Journal of Epidemiology. 32, 556-562 (2003).
  6. Eaton, D. L., Groopman, J. D. The toxicology of aflatoxins: human health, veterinary, and agricultural significance. Academic Press. (1994).
  7. Murugavel, K. G., et al. Prevalence of aflatoxin B1 in liver biopsies of proven hepatocellular carcinoma in India determined by an in-house immunoperoxidase test. Journal of Medical Microbiology. 56, 1455-1459 (2007).
  8. Wang, J. S., et al. Hepatocellular carcinoma and aflatoxin exposure in Zhuqing Village, Fusui County, People's Republic of China. Cancer Epidemiology, Biomarkers & Prevention. 10, American Association for Cancer Research. 143-146 (2001).
  9. Azziz-Baumgartner, E., et al. Case-control study of an acute aflatoxicosis outbreak, Kenya, 2004. Environmental Health Perspectives. 113, 1779-1783 (2005).
  10. Lye, M. S., Ghazali, A. A., Mohan, J., Alwin, N., Nair, R. C. An outbreak of acute hepatic encephalopathy due to severe aflatoxicosis in Malaysia. American Journal of Tropical Medicine and Hygiene. 53, 68-72 (1995).
  11. Villers, P. Aflatoxins and safe storage. Frontiers in Microbiology. 5, 158 (2014).
  12. Kensler, T. W., Roebuck, B. D., Wogan, G. N., Groopman, J. D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences. 120, S28-S48 (2011).
  13. Dorner, J. W., Cole, R. J., Wicklow, D. T. Aflatoxin reduction in corn through field application of competitive fungi. Journal of Food Protection. 62, 650-656 (1999).
  14. Cotty, P. J., Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic-pathway enzymes. Applied and Environmental Microbiology. 60, 2248-2251 (1994).
  15. Whitaker, T. B. Standardisation of mycotoxin sampling procedures: an urgent necessity. Food Control. 14, 233-237 (2003).
  16. Whitaker, T. B., Dorner, J. W., Giesbrecht, F. G., Slate, A. B. Variability among aflatoxin test results on runner peanuts harvested from small field plots. Peanut Science. 31, 59-63 (2004).
  17. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  18. Rafael, D., et al. EMT blockage strategies: Targeting Akt dependent mechanisms for breast cancer metastatic behaviour modulation. Current Gene Therapy. (2015).
  19. Li, G., Chang, H., Zhai, Y. P., Xu, W. Targeted silencing of inhibitors of apoptosis proteins with siRNAs: a potential anti-cancer strategy for hepatocellular carcinoma. Asian Pacific. Journal of Cancer Prevention: APJCP. 14, 4943-4952 (2013).
  20. Koldehoff, M. Targeting bcr-abl transcripts with siRNAs in an imatinib-resistant chronic myeloid leukemia patient: challenges and future directions. Methods in Molecular Biology. 1218, 277-292 (2015).
  21. Zhang, J., et al. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science. 347, 991-994 (2015).
  22. Ajjappala, H., Chung, H. Y., Sim, J. S., Choi, I., Hahn, B. S. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta. 241, 773-787 (2015).
  23. Jose, A. M., Hunter, C. P. Transport of sequence-specific RNA interference information between cells. Annual Review of Genetics. 41, 305-330 (2007).
  24. Vazquez, F., Hohn, T. Biogenesis and biological activity of secondary siRNAs in plants. Scientifica. Hindawi Publishing Corporation. (2013).
  25. Tinoco, M. L. P., Dias, B. B. A., Dall'Astta, R. C., Pamphile, J. A., Aragao, F. J. L. In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biology. 8, (2010).
  26. Govindarajulu, M., Epstein, L., Wroblewski, T., Michelmore, R. W. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce. Plant Biotechnology Journal. (2014).
  27. Yin, C., Jurgenson, J. E., Hulbert, S. H. Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Molecular Plant-Microbe Interactions. 24, 554-561 (2011).
  28. Ghag, S. B., Shekhawat, U. K., Ganapathi, T. R. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium. wilt in banana. Plant Biotechnology Journal. 12, 541-553 (2014).
  29. Filichkin, S. A., et al. Efficiency of gene silencing repeats vs. transitive RNAi in Arabidopsis: direct inverted vectors. Plant Biotechnology Journal. 5, 615-626 (2007).
  30. Sciaky, D., Montoya, A. L., Chilton, M. D. Fingerprints of Agrobacterium Ti Plasmids. Plasmid. 1, 238-253 (1978).
  31. Clark, D. J., Maaloe, O. DNA Replication and Division Cycle in Escherichia coli. Journal of Molecular Biology. 23, 99-112 (1967).
  32. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum. 15, 473-497 (1962).
  33. Srinivasan, T., Kumar, K. R. R., Kirti, P. B. Establishment of efficient and rapid regeneration system for some diploid wild species of Arachis. Plant Cell Tissue and Organ Culture. 101, 303-309 (2010).
  34. Gomes, A. L. V., et al. Single-tube nested PCR using immobilized internal primers for the identification of dengue virus serotypes. Journal of Virology Methods. 145, 76-79 (2007).
  35. Williams, E. J., Drexler, J. S. A non-destructive method for determining peanut pod maturity. Peanut Science. 8, 134-141 (1981).
  36. Sobolev, V. S., Dorner, J. W. Cleanup procedure for determination of aflatoxins in major agricultural commodities by liquid chromatography. Journal of AOAC International. 85, 642-645 (2002).
  37. Empower Software, Getting Started Guide. Waters Corporation. Milford, MA. Available from: http://sites.chem.colostate.edu/diverdi/C431/experiments/high%20pressure%20liquid%20chromatography/references/Empower%20getting%20started%2071500031203rA.pdf (2002).
  38. Biselli, S., Hartig, L., Wegner, H., Hummert, C. Analysis of Fusarium. toxins using LC-MS-MS: Application to various food and feed matrices. LC GC North America. 23, 404-413 (2005).
  39. Arias, R. S., Sobolev, V. S., Orner, V. A., Dang, P. M., Lamb, M. C. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential. Plant Pathology. 63, 353-363 (2014).
  40. Dang, P. M., Chen, C. Y., Holbrook, C. C. Evaluation of five peanut (Arachis hypogaea) genotypes to identify drought responsive mechanisms utilising candidate-gene approach. Functional Plant Biology. 40, 1323-1333 (2013).
  41. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative C-T method. Nature Protocols. 3, 1101-1108 (2008).
  42. Amaike, S., Keller, N. P. Aspergillus flavus. Annual Review of Phytopathology. 49, 107-133 (2011).
  43. Nowara, D., et al. HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell. 22, 3130-3141 (2010).
  44. Woloshuk, C. P., et al. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Applied and Environmental Microbiology. 60, 2408-2414 (1994).
  45. Price, M. S., et al. The aflatoxin pathway regulator AflR induces gene transcription inside and outside of the aflatoxin biosynthetic cluster. FEMS Microbiology Letters. 255, 275-279 (2006).
  46. Ehrlich, K. C., Montalbano, B. G., Cotty, P. J. Sequence comparison of aflR from different Aspergillus. species provides evidence for variability in regulation of aflatoxin production. Fungal Genetics and Biology. 38, 63-74 (2003).
  47. McDonald, T., Brown, D., Keller, N. P., Hammond, T. M. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Molecular Plant Microbe Interactions. 18, 539-545 (2005).
  48. Abdel-Hadi, A. M., Caley, D. P., Carter, D. R., Magan, N. Control of aflatoxin production of Aspergillus flavus. and Aspergillus parasiticus. using RNA silencing technology by targeting aflD. (nor-1) gene. Toxins (Basel). 3, 647-659 (2011).
  49. Swartz, M. E. Ultra performance liquid chromatography (UPLC): An introduction: Separation Science Redefined. LCGC North America. Suppl ement 8. 8-14 (2005).
  50. Maghuly, F., Khan, M. A., Fernandez, E. B., Druart, P., Watillon, B., Laimer, M. Stress regulated expression of the GUS-marker gene (uidA) under the control of plant calmodulin and viral 35S promoters in a model fruit tree rootstock: Prunus incisa x serrula. Journal of Biotechnology. 135, 105-116 (2008).
  51. de Mesa, M. C., Santiago-Doménech, N., Pliego-Alfaro, F., Quesada, M. A., Mercado, J. A. The CaMV 35S promoter is highly active on floral organs and pollen of transgenic strawberry plants. Plant Cell Reports. 23, 32-38 (2004).
  52. Sunilkumar, G., Mohr, L., Lopata-Finch, E., Emani, C., Rathore, K. S. Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Molecular Biology. 50, 463-474 (2002).
  53. Groenenboom, M. A. C., Maree, A. F. M., Hogeweg, P. The RNA silencing pathway: The bits and pieces that matter. PLoS Computational Biology. 1, 155-165 (2005).
  54. Zhao, D., Song, G. Q. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants. Plant Science: an International Journal of Experimental Plant Biology. 228, 39-47 (2014).
  55. Kamthan, A., Chauduri, A., Kamthan, M., Datta, A. Small RNAs in plants: recent development and application for crop improvement. Frontiers in Plant Science. 6, 208 (2015).
  56. Manda, A., Bodapati, P. N., Rachaputi, N. C., Wright, G., Fukai, S. Aflatoxins and their relationship with sugars in peanut (Arachis hypogaea L). 4th International Crop Science Congress, 2004, Available from: http://www.cropscience.org.au/icsc2004/poster/5/1/3/625_manda.htm (2004).
  57. Uppala, S. S. Factors affecting pre-harvest aflatoxin contamination of peanut (Arachis hypogaea L). Auburn University. (2011).
  58. Sobolev, V. S. Localized production of phytoalexins by peanut (Arachis hypogaea) kernels in response to invasion by Aspergillus species. Journal of Agricultural and Food Chemistry. 56, 1949-1954 (2008).
  59. Sobolev, V. S., Guo, B. Z., Holbrook, C. C., Lynch, R. E. Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes. Journal of Agricultural and Food Chemistry. 55, 2195-2200 (2007).
  60. Sobolev, V. S., Neff, S. A., Gloer, J. B. New stilbenoids from peanut (Arachis hypogaea) seeds challenged by an Aspergillus caelatus strain. Journal of Agricultural and Food Chemistry. 57, 62-68 (2009).
  61. Dorner, J. W., Cole, R. J., Sanders, T. H., Blankenship, P. D. Interrelationship of kernel water activity, soil temperature, maturity, and phytoalexin production in preharvest aflatoxin contamination of drought-stressed peanuts. Mycopathologia. 105, 117-128 (1989).
  62. Sobolev, V. S. Production of phytoalexins in peanut (Arachis hypogaea) seed elicited by selected microorganisms. Journal of Agricultural and Food Chemistry. 61, 1850-1858 (2013).
  63. Basha, S. M. M., Cherry, J. P., Young, C. T. Changes in free amino acids, carbohydrates, and proteins of maturing seeds from various peanut (Arachis hypogaea L.) cultivars. Cereal Chemistry. 53, 586-596 (1976).
  64. Lansden, J. A. Aflatoxin inhibition and fungistasis by peanut tannins. Peanut Science. 9, 17-20 (1982).
  65. Yen, G. C., Duh, P. D., Tsai, C. L. Relationships between antioxidant activity and maturity of peanut hulls. Journal of Agricultural and Food Chemistry. 41, 67-70 (1993).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics