Yerfıstığı aflatoksin RNAi aracılı Kontrol: Yöntem Yerfıstığı Mikotoksin Üretim ve Transgen Anlatım Analiz /

Environment
 

Summary

Bu fungus, Aspergillus flavus aflatoksin sentezi genleri sessizleşme RNA-parazit sinyalleri içeren yerfıstığı tohumlarda aflatoksin ve transgen ekspresyonunun analizi için bir yöntem ortaya koymaktadır. Bitkilerde mikotoksin RNAi aracılı kontrolü önceden bildirilmemiştir.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Arias, R. S., Dang, P. M., Sobolev, V. S. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem. J. Vis. Exp. (106), e53398, doi:10.3791/53398 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Birleşmiş Milletler Gıda ve Tarım Örgütü, dünyada gıda ürünlerinin% 25'i aflatoksin ile kontamine olduğunu tahmin ediyor. Bu gıda 100 milyon ton imha veya her yıl insan olmayan tüketimine yönlendiriliyor temsil eder. Aflatoksin normalde tahıllar, fındık, kök bitkiler ve diğer tarım ürünleri mantar Aspergillus flavus ve A. Parasiticus birikmiş güçlü kanserojen vardır. Yer fıstığı bitkilerinde RNA interferans (RNAi) ile beş aflatoksin sentezi genlerinin susturma A ile inokülasyondan sonra aflatoksin birikimini kontrol etmek için kullanılmıştır flavus. Bu genellikle aflatoksin-elverişli koşullarda birkaç tohum ve büyük saha deneyleri geleneksel yöntemleri üretmek daha önce, hiçbir yöntem, bireysel fıstık transgenik olaylarda RNAi etkinliğini analiz etmek için bir seçenek değil var. Alanında, doğal kontamine tohum bulma olasılığı, 1/1 çoğunlukla 1/100 olduğunuBuna ek olarak 000, aflatoksin kontaminasyonu düzgün yayılı değildir. Önerilen yöntem, gerçek zamanlı PCR (RT-PCR) için işlemden küçük parçalar ya da küçük RNA dizilemesi, transjenik olay başına birkaç tohum kullanır ve ultra performanslı sıvı kromatografisi (UPLC) ile aflatoksin birikimi analizi için. RNAi-ifade fıstık hatları 288-72 ve 288-74, 14000 ng kadar birikmiş kontrole kıyasla aflatoksin B 1% 100 azalma (p≤0.01) ve B 2 için geldi. G -1 aflatoksin B 1 aflatoxigenic A ile aşılanmış flavus. Referans olarak, Amerika Birleşik Devletleri'nde insan tüketimine izin verilen aflatoksin maksimum toplam 20 ng olduğunu. G -1. Bu protokol transgenik tohumların fıstık ve değerlendirilmesi için yöntemler aflatoksin RNAi aracılı kontrol uygulanmasını açıklar. Biz fıstık ve diğer ürünlerin yetiştiriciliğinde uygulama bilimin bu önemli alanda hızlı ilerleme getireceğine inanıyorum, Tıp ve insan beslenmesi ve anlamlı büyük gıda bitkileri aflatoksin ve potansiyel olarak diğer mikotoksinler kontrol etmek uluslararası çabalara katkıda bulunacaktır.

Introduction

Yaklaşık 4,5 milyar insan kronik aflatoksin 1, doğada 2 bilinen en güçlü kanserojen maruz kalmaktadır. Bu mikotoksinler mısır, manyok, pirinç, fındık, tahıllar ve baharat dahil olmak üzere dünyanın 3., gıda ürünlerinin% 25 kontamine. 4.. Çocuklarda 5 bodurluk neden Aflatoksin, bağışıklık sistemini bozan 6 insan biyopsi 7,8 hepatoselüler-karsinom% 58'inde mevcuttur ve aflatoksikozis 9,10 periyodik salgınları sırasında yüzlerce kişiyi öldür. Aflatoksin normalde Aspergillus flavus ve A. tarafından üretilen poliketit türetilen mikotoksinler vardır parasiticus; Aflatoksin B 1 ve B 2 A tarafından üretilen f tavus, A., oysa parasiticus, G 1 ve G2 üretir. Bu bileşikler ve UPLC kendi ayrılmasını gösteren bir kromatogram kimyasal yapısı, Şekil 1 'de gösterilmektedir.

figür 1
Şekil 1. Aflatoksin ve RNAi takın Üst:. Dört en yaygın poliketit kaynaklı aflatoksin kimyasal yapısı (solda) ve (sağda) kromatogramın örnek: B 1, B 2, G 1 ve G 2, Aspergillus parasiticus, A tarafından üretilen .. flavus B 1 ve B2 Alt üretir: RNAi gen fragmanlarının şematik oklar altında numaraları Aspergillus flavus genomu içinde gen fragmanı erişim numaraları vardır p5XCAPD fıstık transformasyonu için kullanılan yapı; PIV2: Patates intronu; bp: baz çifti; RT_5X_1 ve RT_5X_2. Real-Time PCR primer siteleri bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Hesaplanan 4 dayalı takdirde vadesi fıstık aflatoksin ihracatın Ekonomik kayıplar yalnız $ 450,000,000 ABD doları aşması ng. G -1 Avrupa Birliği'nde 11 insan tüketimi için izin verilen aflatoksin limiti. Aflatoksin 60 yıldır 12 beri bilinmektedir; Birçok tarımsal uygulamalar diğer mantar suşları 13,14 uygulanması da dahil etkisini hafifletmek için geliştirilen olsa ancak, kontrol hiçbir tutarlı bir yöntem var ve dirençli bitki çeşitleri mevcut değildir. Hatta patojen istilası için elverişli koşullar altında, mikotoksin birikimi önceden tahmin edilemez ve normal bir dağılım takip etmez, çünkü aflatoksinler direnç için test bitkisi tohum genetik materyalinin, özellikle zordur. Böylece, deneyler genellikle tohum ve 100-1,700 g çoklu örneklerinin yüzlerce veri 15,16 değişkenliği azaltmak için, geniş dikim alanları gerektirir.

RNA enterferans oldu1998 yılında keşfedilen 17; ve "susturma" faydaları halen yeni uygulamalar bir dizi, örn araştırılmaktadır., metastatik meme kanserinde 18, karaciğer kanseri 19, miyeloid lösemi 20 ve böcekler 21 ve nematod 22 karşı bitki koruma karşı insan terapilerde. Bitkilerde, RNA interferans sinyali da bitki konakçıya 25 ile yakın temas halinde olan mantar patojenlere içinde 23,24 susturulması sistemik transkripsiyon sonrası gen için sorumlu olan küçük müdahale RNA (siRNA) ve yüksek moleküler ağırlıklı RNA ile, hücreden hücreye seyahat olabilir. Fungal patojen genlerin bitki aracılı susturma ilgili RNAi etkinliği bu için, birkaç bitki pathosystems tarif edilmiştir, bitkiler (yaprak) havadan bölgelerinde arazlarının görsel incelenmesi marul 26 hastalık miktar, örneğin, Bremia izin oomiset buğday, Puccinia 28 p> 27 ve Fusarium. Çok daha zor yapraklar, (tohumlar) işgal organlar toprağın birkaç santim altında enfeksiyon belirtileri gösterdiği gibi fıstık bitkilerde mikotoksin, özellikle aflatoksin kontrol RNAi etkinliğini değerlendirmektir, enfeksiyon oluşumu öngörülemeyen ve sadece kimyasal Analiz aflatoksin varlığı belirleyebilirsiniz. Ayrıca, fıstık her transgenik olay normalde birkaç tohum (bitki başına 4-6) üretir; Bu nedenle, geniş bir alan parsellerde no-aflatoksin birikimi özelliği, tüm kırpma mevsim süren ve tohum yüzlerce kullanarak geleneksel test mümkün değildir. Bir yöntem olup en az bir hafta içinde analiz etmek için burada açıklanan, sadece az sayıda tohum kullanılarak transgenin varlığı ve no-aflatoksin birikimi özelliği için RNAi fıstığı tohumları.

Protocol

1. Moleküler Construct ve Fıstık Dönüşüm

  1. Beş A. DNA parçalarını birleştirmek f tavus genleri AFL2G_07223 (aflS veya aflJ), AFL2G_07224 (aflR), AFL2G_07228 (aflC / pksA / pksL1), AFL2G_07731 (pes1) ve AFL2G_05027 (aflatoksin akış pompası, aflep). Bunun için, aşağıdaki primerler ve ultramers kullanımı: DIR-1, Kısa Dir1-R, DIR-2-ters, Kısa Dir2-R, DirAll-Nco-Rv ve DirAll-BamEco-Fw, Tablo 1.
    1. Üreticinin uygun DNA polimeraz kullanılarak, (94 ° C, 45 saniye 5 döngü, 55 ° C 30 sn, 68 ° C 15 sn, ardından 95 ° C 2 dakika 25 ul reaksiyon) 5 PCR döngü DIR-1 çift iplikli sağlayın talimatlar ve primer Kısa Dir1-R 3 'çıkıntısı CCCGT bırakmak. Bu adımları yineleyin DIR-1 tamamlayıcısı 3 'çıkıntısı ACGGG bırakmak primer Kısa Dir2-R kullanılarak DIR-2-ters çift iplikli yapmak.
    2. İki 199 bp fragme Arterüreticinin talimatlarına göre T4 DNA Ligase ile NTS. PCR 1.1.1 primerler kullanılarak DirAll-OAKK-Fw ve DirAll-Nco-Rv (Tablo 1) 'de gösterildiği gibi elde edilen 393 bp fragmanını amplifiye ve plazmid p2 + 4ENTR yapmak pENTR1A içine, standart teknikler kullanarak ürünü klonlanması.
    3. PCAPD 29 içine p2 + 4ENTR rekombine plazmid p5XCAPD yapmak için, üreticinin talimatlarına uygun olarak LR klonaz II enzim karışımı kullanılarak (NCBI Erişim KC176455.1) ve kısmen sekanslama ile standart teknikler kullanılarak E. coli DH5α dönüştürmek. Not: Tüm RNAi insert Tablo 1'de gösterilmiştir.
  2. Daha önce rapor edildiği gibi 30 plazmid p5XCAPD Agrobacterium C58C1 30 Dönüşümü ve aşağıdaki gibi yer fıstığı bitkileri transforme etmek için elde edilen bakteri kullanımı:
    1. 50 ml LB-Broth 500 ile takviye edilmiş, 30 ° C p5XCAPD barındıran Agrobacterium de büyümek için bu kullanımıug ml -1 streptomisin, 25 ug ml -1 gentamisin, 10 ug ml -1 kanamisin ve 1 OD 260 ulaşana kadar 250 rpm'de kültürü sallayın.
    2. Bakteriyel süspansiyon 100 mcM 1 saat asetosiringon, ve yeri ile 50 ml AB minimal ortamda 31 10 dakika, tekrar süspansiyon santrifüj (6000 xg) Agrobacterium hücreleri hasat 10-14 gün eski fideler Exp27-1516, koşucu gelen eksplantlar tipi fıstık yetiştiriciliği hattı. Blot 3MM 30 dakika sonra kurutma kağıdı üzerinde eksplantların kuru ve filiz başlatma ortamına (SIM) [MS tuzu 32,% 3 sukroz, 20 uM benzilaminopurin (BAP), 10 uM tidiazuron (TDZ), pH 5.8, 0.3 koyun Üç gün boyunca karanlıkta antibiyotikler olmadan% gellan zamkı].
    3. 33 öncesi rapor doku seçimi ve yenilenme yapın. 2 ay boyunca iki haftada transferleri ile, sürgün oluşumu için (500 mcM sefotaksim ve 100 uM kanamisin) SIM dokuları taşıyın. Sonra bir yerdeshoot-uzama ortamına (SEM) üzerine sürgünler genişleyen [5 mcM BAP, 1 uM gibberellik asit (GA 3)], birkaç ay iki haftalık.
    4. Tek tek filizlerin, 2 cm boyutunda, kök endüksiyon ortamı içinde (RIM) koyun [1/2 MS,% 1.5 sükroz, 5 uM α-naftalen-asetik asit (NAA), 2,5 uM indol-butirik asit (IBA)], Daha sonra fidan ACCLIMATE ve sera aktarabilirsiniz.

Sessizlik Aflatoksin Sentez Genler için RNAi barındıran Fıstık Bitkiler 2. Kimlik

  1. RNAi (daha önce tarif edildiği gibi) 200 ul yıkama dönüşüm sürecine tabi tutulmuştur fıstığı bitkilerinin genç yapraklarından DNA elde etmek için, üreticinin talimatlarına uygun olarak olan bir robot iş istasyonu kullanımı Bitki Mini Kit omurga sahip p5XCAPD (Şekil 1) inşa gen susturma plazmid pCAPD 29.
  2. Tarif Kümelenme Strateji PCR (STN-PCR) iç içe geçmiş tek tüp ile DNA örnekleri Ekransöndükten 34 seçilebilir marker NPTII algılamak ve RNAi p5XCAPD dan yerleştirin. Klonal bu ilk nesil test için yeterli tohum üretmek için kesim (3-4 düğümleri) PCR pozitif bitkilerden yaymak.
    1. DNA dört 2-kat seyreltim kullanarak (50-100 ng ul -1 seyreltme önce), tüm STN-PCR reaksiyonlarında. 5'-AGGCTATTCGGCTATGACTG-3 've PCAPD 6446R: 5'-CGTCAAGAAGGCGATAGAAG-3', ve iç primerler PCAPD 5730F: 5'-ACTGGGCACAACAGACAATC-3 've PCAPD 6249R: 5'-ATATTCGGCAAGCAGGCATC- kanamisin için harici primerler PCAPD 5714F kullanımı 3 '.
    2. 5'-CCTAACAGAACTCGCCGTAA-3 've DirAll-Nco-Rv: 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3', ve iç primerler Probe_5027_Fw: 5'-gtatttgtgaccatgtttctg-3 STN-PCR reaksiyonlarında yerleştirin RNAi tespiti için harici primerler 35S-PDSFw kullanımı 've Probe_7228_Rv: 5'-GGACGGATAGTAAACTGCGG-3'.
  3. STN-PCR pozitif bitkilerden ve aleyhte Hasat fıstık bakla kumanda bitkiler aynı koşullarda büyütülür. KRİTİK ADIM: bitkiler RNAi bitkiler aynı koşullarda ve aynı sezonda yetiştirilen emin kontrolünü sağlayın. Su patlama basınçlı yıkayıcı ile bakla, düşük yoğunlukta veya 35 (Şekil (kahverengi ve siyah, sarı, turuncu,) gruplarında vade kurulu ve ayrı bakla bakla üzerine koyarak mezokarbını rengini, exocarp kaldırmak belirlemek için el ile kazımak 2).

Şekil 2,
Analiz için fıstık bakla 2. hazırlanması Şekil. Sol: fıstık belirsiz bir büyüme bitki olarak hasat bulunan değişik fıstık boyutları; Merkez: exocarp su basıncı kaldırılması için metal sepet içinde fıstık yerleştirmek; Sağ: bir fıstık profil kurulu (sarı, turuncu, kahverengi ve siyah) hakkında mezokarbını renk ile vade grupları.98fig2large.jpg "target =" _ blank "> bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

3. Deneysel Kurulum

  1. Sarı kabuklar, süreç çıkarın ve ayrı kahverengi tohumlar. . Tablo 2'ye göre deneyde kullanılacak tohumların sayısını hesaplayın fıstık hattı ve örnekleme tarihine başına üç tohum parçaları (1 tohum adet = yarım kotiledon) minimum istatistiksel analiz ve standart hata azaltmak için gerekli olduğunu unutmayın.
Isim Sekans
DIR-1 5'-
GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTCGTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAATCCCCTGCATCTACGCGCACGCATC
ACTTGGGGTACCCGT-3 '
Kısa Dir1-R 5'-Phos-TACCCCAAGTGATGCGTGCGCG-3 '
DIR-2-ters 5'-GGTTATTGGGTGCAGAATGGTAAACCACCCAACAGTACGCGAAATG
TCAATTCCAGAGTCCCAAACCTCCCTACCGTGGCCTGGACGGATAG
TAAACTGCGGAGCTTGGGAACAAAATCCGCTGTCTGATCGCCGAAG
AGAAAGAGTTGCCTTGATTGAGCCGCATCGAGGACAGGTTGTGTTG
CTGTTGATAGACGGG-3 '
Kısa Dir2-R 5'-Phos-CTATCAACAGCAACACAACC-3 '
DirAll-OAKK-Fw 5'-CACCGCCAGCTCAAAAGTGCGATGC-3 '
DirAll-Nco-Rv 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3 '
DirAll-BamEco-Fw 5'-ATGGGATCCGAATTCGCCAGCTCAAAAGTGCGATGC-3 '
Komple RNAi insert 5'-GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTC / GTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAAT / CCCCTGCATCTACGCGCACGCAT
CACTTGGGGTACCCGTCTATCAACAGCAACACAACCTGTCCTCGAT
GCG / GCTCAATCAAGGCAACTCTTTCTCTTCGGCGATCAGACAGCG
GATTTTGTTCCCAAGCTCCGCAGTTTACTATCCGTCCA / GGCCACGG
TAGGGAGGTTTGGGACTCTGGAATTGACATTTCGCGTACTGTTGGG
TGGTTTACCATTCTGCACCCAATAACC-3 '

. Tablo RNAi p5XCAPD inşa PHOS oluşturmak için kullanılan 1. Oligonucleotides ve ultramers: 5 'ucunu fosforile; "/" Beş gen fragmanları kullanılan ayırır; Komple RNAi insert: p5XCAPD oluşturmak için 2 ters tekrarlar olarak kullanılan dizisi.

  1. Onlar steril beher dibini örtecek şekilde tek bir katmanda tüm fıstık tohumları yerleştirin. Tohum kapak ve sonra aynı solüsyon eşit hacimde eklemek için% 75 etanol / su (h / h) çözeltisi ekleyin. 30 saniye süre ile çevre sıcaklığında inkübe ve daha sonra steril deiyonize su (SDW) ile durulayın.
  2. Şöyle etanol muamele edilmiş tohum içeren bekere% 2 hipoklorit ekleyin: daha sonra, tohum kapak aynı çözeltinin eşit hacimde ilave et ve 5 dakika boyunca inkübasyona kadar% 2 hipoklorit çözeltisi ilave edilir. KRİTİK ADIM: için SDW eşdeğer bir hacmi ile iyice üç kez durulayın kullanılan hipoklorit hacmi (Şekil 3 5 kat).

Şekil 3,
3. Deneysel kurulumu Şekil. En: öncesi ve hipoklorit sonra fıstık tohumu yüzey sterilizasyonu, tohum kat (testa) kaldırılması; Orta: embriyo ve embriyonun yakın bakış çıkarılması, ardından yarısı kotiledon kesti; Bottom: yarım kotiledonlar steril distile su içinde, steril emici üzerine lekeleme kağıt, su agar ve agar yüzeyine yarım kotiledonlarının yerleştirilmesi (kesme tarafı yukarı) üzerine ezik. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

  1. İzin yüzeyi sterilize tohumlar 2 saat SDW batmış imbibe. Steril Petri kabı tohumları yerleştirin forseps ile tohum kat kaldırmak kotiledonlar ayırmak ve bir neşter ile embriyolar kaldırmak. Not:Embriyolar atılır ve yeni bitkilerin oluşturulması için de kullanılabilir.
  2. Bir neşter kullanılarak yarısında her kotiledon kesin. Dehidratasyonu önlemek için, tüm tohumlar işlenir kadar steril su kesme tohum parçalarını tutun.
  3. Steril su agar içeren Petri kapları hazırladık (% 1.5 agar / su; w / v), her biri üç tane parçaları için. Forseps kullanarak agar küçük ezikler olun, su / agar plaklarına (yukarı kesme yüzü) kısaca steril kağıt havlu üzerinde tohum parçaları aşırı su kurulayın ve ardından tohum parçalarını yerleştirin.
  4. 10 gün boyunca 25 ° C'de büyütüldü Czapek en agar ortamında aflatoxigenic Aspergillus flavus NRRL 3357 taze kültüründen, bir haemositometre ile sayıldı ul SDW başına 50.000 sporların bir süspansiyon hazırlamak.
  5. Sporların RNAi (Şekil 4) barındıran tohum dokusunun maruz olsun emin olmak için, iki tarafta akış kaçınarak her yarım kotiledon parçasının kesilen yüzeyler üzerinde spor süspansiyon 2 ul yerleştirin.

    Şekil 4,
    Aflatoksin analizi için Şekil 4. Aşılama ve inkübasyon. En: Yarım kotiledon, spor süspansiyonu ile aşılama ve Aspergillus 24 saat inkübasyondan sonra yarım kotiledonda misel gelişimini flavus Alt: left:. 48 saatlik inkübasyon% 1.5 agar üzerine; merkezi:% 1.5 agar üzerine 72 saat boyunca inkübasyon; Sağ:. Yanlış deney düzeneği örnek,% 0.5 agar üzerinde 72 saat süreyle inkübasyon bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

    1. Örnekleme kadar karanlıkta 30 ° C'de aşılanır ve non-aşılanmış yarısı kotiledonlar içeren Petri kapları inkübe edin.

    Aflatoksin Analizi ve Gen İfadesi 4. Örnekleme

    1. Örnekleri toplayınHer bir parça (yarım kotiledon) olan çoğaltma, RT-PCR ve aflatoksin analizi için hem de inkübasyon 24, 48 ve 72 saat (isteğe 96 saat), üç kopya halinde. Her örnekleme tarihinde farklı plakalar rastgele örnekler seçin. Bir dokuyu kullanarak, yumuşak şişe veya test tüplerinde tohum parçaları yerleştirmeden önce agar ve aşırı mantar sporları kaldırın.
    2. Aflatoksin analizi için, -80 ° C de 4 ml bir cam vidalı kapaklı şişe ve mağaza her deney (tek parça) yerleştirin. Not: aflatoksin kimyasal kararlılığı göz önüne alındığında, numuneler (bu deneylerde, genellikle 1-2 ay), birkaç ay boyunca bu durumda saklanabilir.
    3. RT-PCR yer için zaten her çoğaltmak (tek parça) iki paslanmaz çelik boncuk (2.5 mm çap) ve üç zirkonyum boncuk (2 mm çap) içeren tüpler taşlama 2 ml hazırladı.
    4. Hemen tüm örnekler (tercihen sıvı azot içinde) dondurma ve işlenene kadar -80 ° C'de muhafaza edin.

    Bireysel Yarım C 5. Aflatoksin Analiziotyledon Adet

    1. A. kullanın flavus Bu analiz için örnekler aşılanmış. Yaklaşık 30 dakika boyunca oda sıcaklığına kadar örnekleri getirmek ekleyin dört hacim (genellikle 2-3 mi, ağırlık / hacim) metanol, (daha sonra hesaplamalar için kayıt tutmak) kapakları kapatmak ve O inkübe bölgesinin / N (~ 16 saat) ajitasyon olmadan karanlık.
    2. Bir eşleşen 1.5 ml propilen minicolumn bir cam hamuru yerleştirin Al 2 O 3 temel, 200 mg eklemek ve daha önce açıklandığı gibi 36 başka frit ile kap; daha sonra, çıkan olası buharlaşmayı önlemek için yeterince yakın sütununda bir Ultra-Yüksek Performanslı Sıvı Chomatographer (UPLC) bir otomatik numune şişesine koyun.
    3. Tek kullanımlık bir cam test tüpü (plastik kullanmayın) içinde, aşama 4.1'de elde edilen metanol özü, 0.5 ml, 0.5 ml asetonitril yer ekleyin pipetle karıştırılır ve aşama 4.2'de hazırlanan sütuna 0.5 ml uygulanır. (Baskı uygulamayın) yerçekimi tarafından otomatik numune şişenin içine elüsyon izin verin. Elüsyon genellikle 2-4 dk yakın th alıre flakon hemen septa ile UPLC uyumlu kapak kullanarak. Ortam sıcaklığında şişeleri tutun ve bir UPLC aynı gün bunları analiz.
    4. Aflatoksin ayrılması için bir eşleştirme UPLC Kuvaterner Solvent Müdürü, UPLC Numune Yöneticisi, UPLC Floresan Dedektörü ile donatılmış bir UPLC enstrüman (A. flavus kullanırken B 1 ve B 2) aflatoksin standartları ile örnek eluatları ve autosampler şişeleri içeren yer otomatik numune şişeleri, ve Cı 18 2.1 mm x 50 mm, 1.7 um kolonu.
      1. 0,30 mi dak akış hızında, su / MeOH / CH3CN (64:23:13, hac / hac / hac) karışımı oluşan izokratik mobil faz kullanarak -1. Üreticinin talimatlarına göre 37, aflatoksin konsantrasyonu doğru hesaplanması için bir stabilize temel ayrımı temin kromatogramlar edinin.
      2. Kitlesel-spektral verileri elde etmek ve yayımlanmış verilere 38 ile karşılaştırarak aflatoksin kimliğini onaylayın. Bir i kullanıntuzağı kütle spektrometresi üzerinde ESI arayüzü ve üreticinin talimatlarına uygun olarak, karşılık gelen yazılım ile donatılmış.
    5. Aflatoksin B 1, B 2 ticari standartlarına karşılık gelen farklı miktarlarda enjekte edilmesiyle elde edilen kalibrasyon eğrilerine atıfta bulunarak aflatoksin konsantrasyonlarını belirlemek, G 1 ve G2 UPLC üretici tarafından önerilen ve yazılım 37 ile belirlendiği gibi.
    6. Tohum parçaları zaten kuru ağırlığının belirlenmesi için O / N (~ 16 saat), liyofilizasyon için tek tek cam şişelere, metanol ile ekstre edildi. Ardından, içinde ng. Tohum parçasının kuru ağırlığının g -1 aflatoksin konsantrasyonu hesaplayın.
    7. Verilerin analizi için, oturum açmak için aflatoksin sonuçları dönüştürmek (ng. G -1 +1), ortalama karşılaştırmalar için Tukey testi ile izledi.

    6. Gen İfadesi, Örneklerin RT-PCR İşleme

    1. Tüpler içerirler taşlama 2 ml alın40 sn için 3100 rpm'de bir bilyalı değirmen homojenleştirici bunları öğütmek (eritilmeden) hemen -80 ° C dondurucu örnekleri ing ve daha sonra üreticinin talimatlarına uygun olarak Trizol kullanılarak RNA ekstraksiyonu geçin.
    2. 1 yapmak 1 ug RNA ve oligo dT ve rastgele heksamerlerin eşit miktarda kullanarak her numuneden cDNA hazırlayın: cDNA 8 seyreltme ve (daha önce tarif edildiği gibi 39) RT-PCR reaksiyonu için 2 ul kullanın.
      1. RNAi uç kullanımı primerlerin sentezlenmesi saptanması için: RT_5X_1_105F: 5'GGTGGCATTGGACCGTCTTG-3 ', RT_5X_1_232R: 5'-CGCATCGAGGACAGGTTGTG-3'; ve RT_5X_2_95F: 5'-CCATGTTTCTGGTGGCATTG-3 ', RT_5X_2_229R: 5'-ATCGAGGACAGGTTGTGTTG-3'.
      2. Seçilebilir marker, kanamisin ifadesinin saptanması için, kullanım primerler: RT_NPTII_1_6871F: 5'-CTCGCTCGATGCGATGTTTC-3 ', RT_NPTII_1_7004R: 5'-GCAGGATCTCCTGTCATCTC-3'. Aktin-Fw: temizlik geni Actin standardizasyon ve primerler kullan CACATGCCATCCTTCGATTG; Aktin-Rv: CCAAGGCAACATATGCAAGCT 40.
    3. Aktin ifade standardize Delta-delta T C yöntemiyle 41 ile sonuçlarını analiz. Kontrolü üzerinde kat artış gibi sonuçları temsil eder.

Representative Results

Plazmid p5XCAPD pCAPD 29 bir türevi gibi hazırlandı ve yer fıstığı bitkileri transforme için kullanılmıştır; bu vektör, A. aflatoksin sentezi genlerinin beş küçük parçalarının ters çevrilmiş tekrarlar, 70-80 bp, her taşır bir intron (Şekil 1) ile ayrılmış flavus. AFL2G_07224 (aflR), AFL2G_07223 (aflS veya aflJ), AFL2G_05027 (aflatoksin akış pompası, aflep), AFL2G_07228 (aflC / pksA / pksL1) ve AFL2G_07731 (pes1) fragmanları A Şekil 1 tekabül sayılar, yapı için kullanılan . GENİŞ Enstitüsü, Cambridge, MA, ve edebiyat 42 flavus genom açıklama. 99 fıstık hatlarının toplam dönüşüm sürecinden geçmekte sonra yeniden edildi 50 PCR STN-PCR ile tespit kanamisin için pozitifti ve 33 satır PCR pozitif ve üretilen tohumlar vardı. Sadece yedi PCR pozitif hatları klonal yayılır ve presen tarafından test edildiaflatoksin birikimi t yöntem olup, yedi 60 ve% kontrole göre% 100 daha küçüktür aflatoksin birikim arasındaki gösterdi. Burada bu yedi hat iki sonuçlarını göstermektedir. Bireysel transgenik olaylar genellikle birkaç tohum üretmek gibi bir yöntemi hala parametrik istatistiksel analiz yapmak mümkün olurken tohum az sayıda kullanmak için geliştirilmiştir. Numune hazırlama ve deneysel kurulum bir akış şeması, Şekil 5 ve Tablo 1 'de gösterilmiştir. Transjenik tohumların ilk nesil, tipik olarak hemizigot olmasına rağmen, hücre-hücre ve küçük müdahale edici RNA sistemik hareketi (siRNA) oluşturulur beklenmektedir RNA müdahalesi yoluyla bitki boyunca aflatoksin-sentez susturulması görüşmek gerekir.

Şekil 5,
Yöntemin Şekil 5. şematik akış şeması susturulmasında RNAi etkinliğini analiz etmek yerfıstığı tohumlarda Aspergillus aflatoksin sentez genleri bulunmaktadır. Iş akışının grafik gösterimi gen ifadesinin veya aflatoksin analizi için fıstık numunelerini işleme. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

STN-PCR ile test edildiğinde RNAi fıstık hatları 288-72 ve 288-74 NPTII seçilebilir yapımcısı varlığını gösterdi, jel bölümleri Şekil 6 (üstte) gösterilir, orijinal görüntüler istek üzerine yazarlarda mevcuttur. Bu iki gen CMR (kloramfenikol dirençli) ve bitkiler üzerindeki etkisi bilinmeyen bir CcdB (toksin) arasında ters çevrilmiş tekrarlar kodlayan yana Plazmid pCAPD bir dönüşüm kontrol olarak kullanılmamıştır. PCR negatif fıstık hat 288-9 ve yenilenme sürecinden geçti ve RNAi hatları gibi aynı koşullarda yetiştirilen diğerleri negatif con olarak kullanıldıtrol.

Şekil 6,
. Şekil transgenikleri 6. tespiti ve RNAi Gerçek Zamanlı ifadesi eklemek Üst: Tek tüp, transgenik fıstık hatları RNAi-288-72 ve 288-74 RNAi-pozitif bitkiler iç içe PCR tespiti. Kontroller: W (su), PP (pozitif bitki), MM (ana mix), p (plazmid p5XCAPD); . kesirler / 2 1/4 1/8 1/16 1 DNA Bottom 2 kat dilüsyonları temsil: Real-Time PCR RNAi ifade tespiti yerleştirin (primer setleri: RT_5X_1, RT_5X_2, Şekil 1'de olduğu gibi, olgunlaşmamış üzerinde ( sarı) ve 24 ve 48 saatten inkübasyon de transgenik hatları (kahverengi) kotiledonlar olgun; gri çizgi: C T = 1 Histogramlar üç biyolojik örneklerin ortalama ve standart hata çubukları (T) temsilÜç teknik tekrarlamalı. RNAi ekin göreceli ölçümü bir iç kontrol ve 5.2.2 ve 5.3 açıklandığı gibi hesaplanan transgen karşılaştırmalı kat ifadesi olarak temizlik geni Aktin göre normalize oldu. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Aflatoksin birikimi bitki ev sahibi RNAi aracılı potansiyeli kontrol etkinliğini test etmek için, Aspergillus flavus NRRL 3357 arasında yeni hasat edilmiş conidia embriyo ve testa kaldırılmış olan yarım kotiledon kesik yüzey üzerinde tatbik edilmiştir (Şekil 3, 4). genom dizisi ve p5XCAPD tasarımı için temel oldu edildiği A. flavus NRRL 3357, nazik USDA-ARS-nprVe Dr. Horn tarafından sağlandı. 30 ° C'de 24, 48 ve 72 saat sonra yarım kotiledonun sonuçlanan mantar istilası gösterisi n Şekil 4'te. aşılanmış yarısı kotiledon numuneleri, 72, 48, 24, toplandı kuluçkalamadan 96 saat, ve LC-MS ile dört ana aflatoksin B 1, B 2, G1 ve G 2 UPLC ile analiz ve teyit ; Sonuçlar Şekil 6'da gösterilmektedir. Aflatoksin konsantrasyonları bazı değişiklikler 36 ile geçme yöntemi kullanılarak belirlenmiştir. 96 saat inkübasyon anda, kotiledonları nedeniyle mantar enfeksiyonu çözülmeye başlar. RNAi hat 288-72 olgunlaşmamış kotiledonlarında ve olgun olanları en örnekleme tarihlerde tüm örnekleme tarihlerde kontrole göre aflatoksin anlamlı derecede düşük seviyelere sergiledi. RNAi hattı 288-74 en örnekleme tarihlerde aflatoksin önemli ölçüde daha düşük seviyelerde gösterdi. Tukey testi belirginlik seviyesi, Şekil 7'nin grafiğinde, yıldız işareti ile gösterilir.

g7.jpg "/>
. Şekil 7. Aflatoksin Aspergillus flavus ile kuluçkadan (24, 48, 72 ve 96 saat), sonra yarım fıstık kotiledonlarında B 1 ve B2 Kontrol: 288-9 transgenik olmayan soyunun tohumu; RNAi: RNAi-288-72 ve 288-74 RNAi-, RNAi p5XCAPD için transgenik tohumlar beş aflatoksin-sentez genleri susturmak için. (A), olgun tohumlarda Aflatoksin B 1 (kahverengi); (B) Aflatoksin B 2 olgun tohumlar; Olgunlaşmamış tohumlarda (sarı) ve olgunlaşmamış tohumlarda (D) Aflatoksin B 2 (C) Aflatoksin B 1. Yinelenen biyolojik numunelerin karşılık gelen standart hata çubukları (T) ile ortalama değerleri temsil edilmektedir. Istatistiksel olarak anlamlı fark Tukey testi *: p ≤ 0.05, **: p ≤ 0.01, ***: p ≤ 0.001.s: //www.jove.com/files/ftp_upload/53398/53398fig7large.jpg "target =" _ blank "> bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Genel olarak, RNAi 288-72 deneyi (24-96 saat kuluçka), aflatoksin B 2 bir% 94 -100% azaltılması ve kontrol ile karşılaştırıldığında aflatoksin B 1 'de% 90 -100% azalma boyunca gösterdi. RNAi 288-74 aflatoksin B 1, Şekil 7'de aflatoksin B 2 ve% 60-% 100 azalma% 63 -100% azalma göstermiştir.

RNAi ucun ifade Real-Time PCR tespiti için kullanılan primerler Şekil 1'de gösterilmiştir. Fıstık-tohum kotiledonları kendi doğal savunma mekanizmasını ortadan kaldırmak ve en maruz kalan alanda RNAi potansiyel etkisini tespit edebilmek için, embriyoların olmadan analiz edildi mantar istilası, kotiledonları. C T üzerinden dört kat RNAi ifadesi eklemek RT_5X_1 set primer ile hat 288-74 olgunlaşmamış kotiledon (sarı) tespit oldu (Şekil 1, 6). RNAi ucun ifadesi 24 saat sonra ya da 48 saat inkübasyondan, Şekil 6 (alt) olgun veya olmamış kotiledonlannda olgun kotiledonlarında tespit edilmemiştir.

Fıstık Hattı Örnekleme zamanı RT-PCR için örnekler Aflatoksin analizi için numuneler, (aşılandı) Ntohum, toprak rengi
(non aşılanmış)
Rep 1 Rep 2 Rep 3 Rep 1 Rep 2 Rep 3
RNAi (sarı) 24 saat 1 1 1 1 1 1 4,5
48 saat 1 1 1 1 1
72 saat 1 1 1 1 1 1
Kontrol 24 saat 1 1 1 1 1 1 4,5
(sarı) 48 saat 1 1 1 1 1 1
72 saat 1 1 1 1 1 1

Tablo 2. Küçük örnek kurulum örneği RNAi fıstık tohumları gen ifadesini ve aflatoksin birikimi analiz etmek. Komple ifade analizi ve bir vade grubu için aflatoksin (yani., Sarı), üç örnekleme zamanları (24, 48 ve 72 saat) ile , üç nüsha olarak, 4.5 tohum gerektirir, tablodaki her bir numara yarım kotiledon temsil eder.

Discussion

Bitki konakçı bitkiler mikotoksin birikim RNAi aracılı kontrol fizibilitesini gösteren herhangi bir yayın vardır mantar patojenlere gen susması, ancak 27,43 gösterilmiştir RNAi aracılı. Yaprakları yeraltı bakla mantar enfeksiyonu üzerine hiçbir belirti göstermez olarak fıstık bu çalışmalar için biri sınırlayıcı faktör, bireysel bitkilerde no-aflatoksin birikimi fenotip değerlendirmek için bir yöntem eksikliği vardı. Buna ek olarak, aflatoksin değil-normal dağılıma birikimi ve kimyasal analizleri 15,16 için büyük örnekler için ihtiyaç tek bir bitki üzerinde potansiyel RNAi etkisi miktarının engellemiştir. Burada sunulan yöntem, üç kez üç 24 saat-aralığı demonstrasyonların (Tablo 1, Şekil 7) gerçekleştirmek için, beş tohum ile 72 saat deney oluşur. Tohumların en az 100 g sunulan klasik aflatoksin analizi ile karşılaştırıldığında, bir yöntem individua için özellikle uygundurBaşlangıçta iki veya üç bakla daha fazla üretmek fıstık bitkilerin l transgenik olayları.

Aflatoksin sentezi, RNA aracılı susturma genetik-Aspergillus flavus ve A. dönüştürerek gösterilmiştir parasiticus. AflR A. aflatoksin üretim ana düzenleyicisi olduğu flavus ve A. parasiticus 44,45, bu bitkilerde RNA aracılı susturma-ilginç bir hedef haline gelir. Ancak, aflR genetik varyasyonlar Aspergillus türleri 46 arasında gösterilmiştir ve bitki konak üretilen RNAi sinyali ile eşleşen mükemmel dizisi yoksa o genetik varyantlar susturmak kaçabilir. Böylece, aflR vektör p5XCAPD içinde susturmak için hedeflerinden biri, ama tek değildi. A. içine aflR geninin ters çevrilmiş tekrarlar flavus ve A. dönüşüm ile parasiticus az veya hiç ürün ve susturma sonuçlandıaflatoksin 47 iyon (McDonald ve ark., 2005b). Ayrıca, susturulması Afld gen A'da kadar% 98 oranında aflatoksin üretimini engelledi flavus ve A. Doğrudan dönüşüm 48 parasiticus. Sistemimizde başarı olasılığını arttırmak için, fıstık A aflatoksin üretiminde yer alan beş genin ters tekrar fragmanları ile transforme edilmiş flavus. Burada aflatoksin sentez yolağındaki birçok gen susturma için hedef p5XCAPD,% 90, aflatoksin B 1 ve B 2 -100% alt seviyeleri kullanılarak hat 288-72 elde olduğu gösterilmiştir ve% 60-100 daha düşük seviyelerde birikmektedir Yarım kotiledonları A ile aşılanmıştır kontrolü kıyasla hat 288-74 flavus, 7 4 Şekil. En önemlisi, bu yöntem parametrik Statis uygulayarak 288-74 kontrol vs deney boyunca çizgiler 288-72 ile aflatoksin birikimi anlamlı farklılık tespittikler, Şekil 7. küçük örneklem büyüklüğü göz önüne alındığında, bu deneyler yüksek çözünürlüklü, yüksek performans ve üç kat daha yüksek hassasiyet beş kat vardır UPLC ile analiz edilmiştir aflatoksin tespit etmek için güçlü bir yöntem kullanılarak ihtiyacını vurgulamak için önemlidir HPLC 49.

RNAi ifadesi uç 288-74 sadece 24 saatlik inkübasyon olgunlaşmamış kotiledonlar (sarı) tespit edilmiştir. RNAi insert 24 saat sonra 288-74 olgun kotiledonlannda RT-PCR ile tespit edilmedi, ya da 48 saat, Şekil 6 herhangi vade grubunda. Bu, aynı fenomen diğer RNAi transgenik fıstık hatlarında gözlendi (Arias, RS, 2015 yayınlanmamış), genellikle RNAi transkript sadece 24 saat sonra olgunlaşmamış kotiledonlannda saptandı nerede. RNA örnekleri cDNA sentezi daha önce DNAaz ile muamele edilmiş, veriler Aktin, ekspresyon düzeyinin artması ve gözlenen DNA kirlenme kanıt normalize edildi. DNA örnekleri mevcut olmuştur Should, olması gerektiğiyanı sıra 48 saat örneklerinde tespit, ama sürekli bu durumda değildi oylandı. 35S promoterinin kontrolü altında ekspresyonu, her zaman eşit değildir; çevre şartlarına 50, doku ve gelişim aşamasında 51,52 tipine göre etkilenebilir. Aynı zamanda, RNA girişim yolunda, mRNA çürüme hızı ve siRNA çürüme oranı önemli ölçüde 53 değişebilir. Bu RNA müdahale mekanizması ile mRNA'nın hızlı yıkımı 48 saat inkübasyon de mRNA tespit engel olabilir mümkündür. 48 saatte ifade yokluğu düşük 35S-organizatörü tahrik transkripsiyon nedeniyle olsun, ya da Dicer tarafından dsRNA'nın hızlı bozulmaya cevaplanması gereken kalır. Böylece, yüksek verimlilik sıralaması ile küçük RNA'ların tespiti RNAi 54 üzerinden gerçekleşen süreçlere daha iyi bir fikir verecek Bu deneylerde. Bununla birlikte, esas olarak RNA susturulması Photosynt gelen floem içinden sistemik olarak yayılır yana55 (bu durumda fıstık tohumlarda) lavabolar sükroza, aflatoksin-sentez susturulması insert RNAi yerel ifadesi olmadan tohumlarda oluşabilir kaynaklar nefret ediyorum. Pek çok araştırma tohumlarında aflatoksin birikimini önlemek için gerekli küçük müdahale RNA'lar (siRNA) eşik düzeyini belirlemek için yapılması gereken kalır. Bu RNAi hem mRNA ifadesi (Şekil 6) inşa gerçeğini vurgulamak önemlidir ve aflatoksin B 1 ve B 2 (Şekil 7) birikimi vs olgunlaşmamış (sarı) farklı sonuçlar ortaya koydu. Olgun (kahverengi) kotiledonlar. Fıstık bitkiler yani onlar hasat olgunluk bakla bir dizi, Şekil 2'de sunmak belirsiz bir büyüme var. Ayrıca, farklı vade gruplarından tohumlar, kimyasal bileşiminde farklılık örneğin.,% 2.4 olgunlaşmamış tohumlarda sakaroz ve% 1.9 olarak Aynı alan şartlar altında 56,57 olgun tohumları. Bu durumda, fiili efficienc anlamakAflatoksin birikim RNA aracılı kontrol y ayrı vade gruplarının analiz etmek önemlidir.

Yerfıstığı tohumlarının bir doğal savunma üretilen bileşikler ve tohumlar ve çevre koşullarına 58-61 süresine bağlı olarak göreceli miktarlarda çeşitliliğinde değişir fitoaleksinlerin üretim, ve kotiledonlar 62 göre embriyolar, özellikle yüksektir. Embriyolar, aynı zamanda (yayınlanmamış Arias RS) nükleik asitler, kotiledon göre hem DNA ve RNA önemli ölçüde daha yüksek konsantrasyonlarda bulunur. Fıstık tohumu olgunlaştıkça, onların fizyolojisi ve kimyasal bileşimi değişiklikleri 63 meydana gelir. Fungistatik etkinliği 64 ile fıstık testa formu yoğunlaştırılmış tanenler fenolik antioksidanlar; tanen ve fenolik bileşiklerin içeriği vadesi 65 ile arttıkça, bu, aynı zamanda 35 siyah sarı vade aşamalarını yansıtan mezokarbını rengi belirgindir. T Böylece varlığıantimikrobiyal özellikler verilen esta veya deney embriyolar, mantar gelişimini sınırlı ve dolayısıyla bu nedenle de uzaklaştırılmış, RNAi susturma etkisi fazla tahmin olabilir. Ayrıca, testa ve embriyoların kaldırılması embriyo daha fitoaleksinlerin ve daha RNA içeriğine sahip olacak taşıyan yarım kotiledon olarak analiz varyasyon kaynakları sınırlamak yardımcı olur.

Vade grupları ve bu deneylerde testa ve embriyonun ayrılmasıyla analizlerine ek olarak, birkaç gözlemler işaret etmek önemlidir: a) sonuçları kadar 96 saat inkübasyon için gösterilmiştir olsa da, en fazla 72 den kullanılması tavsiye edilir Tohumlar 96 saat ile bozulmuş almak gibi saat, tutarlı sonuçlar elde etmek için; ve b) aynı tohum yarım kotiledon, rastgele örneklenmiş olsa da, mükemmel bağımsız örnekler teşkil etmemektedir, oysa RT-PCR ve transjenik olaylar içinde aflatoksin birikimi tohumlar arasındaki minimum değişim göstermiştir. Ayrıca, doğru bir mantar spor, aşı hacmi saymak2 ul s ve yüzüne damlayan kaçınarak kotiledonlarının kesim yüzeyinde sporlarının uygulaması çimlenmiş sporlar bitki dokusuna maruz emin olmak için önemlidir. Tabakalarına su / agar Şekil 4 (alt) son çerçeveye gösterildiği gibi (a / h), daha yumuşak agar sporlarının akış neden olur% 1.5 olmalıdır. ; Bir transgenik olaydan sınırlı durumunu tohum halinde, numune alma yerine, üç kopya elde benzer sonuçlar (yani, Şekil 7), iki kopya halinde yapılabilir Ancak, üç nüsha örnekleri standart hata azaltmaya yardımcı olacaktır. Bu yöntemin tek sınırlama, aflatoksin tespiti ve / veya ölçümü için son derece duyarlı bir sistem (UPLC) gerektirir, fakat aynı zamanda bu daha az hassas olan yöntemlerle aflatoksinler tespit olmamalıdır RNAi etkisini olduğundan fazla tahmin edilmesi ihtimalini azaltır.

Sonuç olarak, bu yöntem, ilk kez için çalışma güvenilir yaklaşım sunaraflatoksin denetiminde RNAi etkisi. Az bir hafta tüm kırpma sezonu bir deney için zamanı azaltarak, bu yöntem son derece azaltılması ve / veya aflatoksin ortadan kaldırılmasına yönelik RNAi-fıstık / Aspergillus pathosystem üzerine araştırma hızlandıracaktır.

Materials

Name Company Catalog Number Comments
Primers, oligonucleotides DNA Technologies, Coralville, IA, USA n/a
Dneasy Plant Mini Kit Qiagen, Valencia, CA 69106
Czapek Dox agar medium Oxoid, by Thermo Fisher Scientific, Waltham, MA CM0095
Agar Thermo Fisher Scientific, Waltham, MA BP 1423
Freezer -80 °C n/a n/a
Aluminum Oxide, Al2O3 Fisher Scientific A941
SPE Reservoirs 1.5 ml Grace Davison Discovery Scientific 210011
Frits for 1.5 ml SPE reservoir Grace Davison Discovery Scientific 211401
Autosampler vials Waters Corporation, Milford, MA 186005221
Waters Acquity Ultra-Performance Liquid-Chromatography (UPLC) instrument; UPLC-H-Class Quaternary Solvent Manager; UPLC Sample Manager; UPLC Fluorescent detector (FLR); UPLC BEH C18 2.1 mm x 50 mm, 1.7 mm column Waters Corporation, Milford, MA
Finnigan LCQ Advantage MAX ion trap mass spectrometer, with Xcalibur version 1.4 software Thermo Electron Corp., San Jose, CA
Aflatoxin standards, B1, B2, G1 and G2 Sigma-Aldrich, St. Louis, MO A6636; A9887; A0138; A0263
Systat Software 12.2 SYSTAT Software Inc., Point Richmond, CA
Trizol reagent Invitrogen, CA 15596-018
SuperScript III First Strand Synthesis Super Mix Invitrogen, CA 11752-050
ABI 7500 Real-Time PCR Lifetechnologies, Grand Island, NY 4406984
Luria Broth-Miller Fisher Scientific R453642
pENTR1A Invitrogen, CA A10462
LR Clonase II enzyme mix Invitrogen, CA 11791-020
T4 DNA Ligase NEB Biolabs M0202L
Gelrite Sigma-Aldrich, St. Louis, MO G1919
Acetosyringone Sigma-Aldrich, St. Louis, MO D134406
QIAcube robot workstation Qiagen, Valencia, CA 9001292
Antibiotics: kanamycin, cefotaxime, gentamicin; streptomycin Goldbio, St. Louis, MO cef.: C-104-25; kan: K-120-5; gent.: G-400-1; strep.: S-150-50
Platinum Taq DNA Polymerase High Fidelity Invitrogen, CA 11304-029

DOWNLOAD MATERIALS LIST

References

  1. Williams, J. H., et al. Human aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions. The American Journal of Clinical Nutrition. 80, 1106-1122 (2004).
  2. American Association for Cancer Research: AACR. An evaluation of chemicals and industrial processes associated with cancer in humans based on human and animal data: IARC Monographs Volumes 1 to 20. Cancer Research. 40, 1-12 (1980).
  3. Turner, P. C. The molecular epidemiology of chronic aflatoxin driven impaired child growth. Scientifica. (2013).
  4. Rasooly, R., Hernlem, B., He, X., Friedman, M. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells. Toxins (Basel). 5, 1447-1461 (2013).
  5. Gong, Y. Y., et al. Determinants of aflatoxin exposure in young children from Benin and Togo, West Africa: the critical role of weaning. International Journal of Epidemiology. 32, 556-562 (2003).
  6. Eaton, D. L., Groopman, J. D. The toxicology of aflatoxins: human health, veterinary, and agricultural significance. Academic Press. (1994).
  7. Murugavel, K. G., et al. Prevalence of aflatoxin B1 in liver biopsies of proven hepatocellular carcinoma in India determined by an in-house immunoperoxidase test. Journal of Medical Microbiology. 56, 1455-1459 (2007).
  8. Wang, J. S., et al. Hepatocellular carcinoma and aflatoxin exposure in Zhuqing Village, Fusui County, People's Republic of China. Cancer Epidemiology, Biomarkers & Prevention. 10, American Association for Cancer Research. 143-146 (2001).
  9. Azziz-Baumgartner, E., et al. Case-control study of an acute aflatoxicosis outbreak, Kenya, 2004. Environmental Health Perspectives. 113, 1779-1783 (2005).
  10. Lye, M. S., Ghazali, A. A., Mohan, J., Alwin, N., Nair, R. C. An outbreak of acute hepatic encephalopathy due to severe aflatoxicosis in Malaysia. American Journal of Tropical Medicine and Hygiene. 53, 68-72 (1995).
  11. Villers, P. Aflatoxins and safe storage. Frontiers in Microbiology. 5, 158 (2014).
  12. Kensler, T. W., Roebuck, B. D., Wogan, G. N., Groopman, J. D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences. 120, S28-S48 (2011).
  13. Dorner, J. W., Cole, R. J., Wicklow, D. T. Aflatoxin reduction in corn through field application of competitive fungi. Journal of Food Protection. 62, 650-656 (1999).
  14. Cotty, P. J., Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic-pathway enzymes. Applied and Environmental Microbiology. 60, 2248-2251 (1994).
  15. Whitaker, T. B. Standardisation of mycotoxin sampling procedures: an urgent necessity. Food Control. 14, 233-237 (2003).
  16. Whitaker, T. B., Dorner, J. W., Giesbrecht, F. G., Slate, A. B. Variability among aflatoxin test results on runner peanuts harvested from small field plots. Peanut Science. 31, 59-63 (2004).
  17. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  18. Rafael, D., et al. EMT blockage strategies: Targeting Akt dependent mechanisms for breast cancer metastatic behaviour modulation. Current Gene Therapy. (2015).
  19. Li, G., Chang, H., Zhai, Y. P., Xu, W. Targeted silencing of inhibitors of apoptosis proteins with siRNAs: a potential anti-cancer strategy for hepatocellular carcinoma. Asian Pacific. Journal of Cancer Prevention: APJCP. 14, 4943-4952 (2013).
  20. Koldehoff, M. Targeting bcr-abl transcripts with siRNAs in an imatinib-resistant chronic myeloid leukemia patient: challenges and future directions. Methods in Molecular Biology. 1218, 277-292 (2015).
  21. Zhang, J., et al. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science. 347, 991-994 (2015).
  22. Ajjappala, H., Chung, H. Y., Sim, J. S., Choi, I., Hahn, B. S. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta. 241, 773-787 (2015).
  23. Jose, A. M., Hunter, C. P. Transport of sequence-specific RNA interference information between cells. Annual Review of Genetics. 41, 305-330 (2007).
  24. Vazquez, F., Hohn, T. Biogenesis and biological activity of secondary siRNAs in plants. Scientifica. Hindawi Publishing Corporation. (2013).
  25. Tinoco, M. L. P., Dias, B. B. A., Dall'Astta, R. C., Pamphile, J. A., Aragao, F. J. L. In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biology. 8, (2010).
  26. Govindarajulu, M., Epstein, L., Wroblewski, T., Michelmore, R. W. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce. Plant Biotechnology Journal. (2014).
  27. Yin, C., Jurgenson, J. E., Hulbert, S. H. Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Molecular Plant-Microbe Interactions. 24, 554-561 (2011).
  28. Ghag, S. B., Shekhawat, U. K., Ganapathi, T. R. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium. wilt in banana. Plant Biotechnology Journal. 12, 541-553 (2014).
  29. Filichkin, S. A., et al. Efficiency of gene silencing repeats vs. transitive RNAi in Arabidopsis: direct inverted vectors. Plant Biotechnology Journal. 5, 615-626 (2007).
  30. Sciaky, D., Montoya, A. L., Chilton, M. D. Fingerprints of Agrobacterium Ti Plasmids. Plasmid. 1, 238-253 (1978).
  31. Clark, D. J., Maaloe, O. DNA Replication and Division Cycle in Escherichia coli. Journal of Molecular Biology. 23, 99-112 (1967).
  32. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum. 15, 473-497 (1962).
  33. Srinivasan, T., Kumar, K. R. R., Kirti, P. B. Establishment of efficient and rapid regeneration system for some diploid wild species of Arachis. Plant Cell Tissue and Organ Culture. 101, 303-309 (2010).
  34. Gomes, A. L. V., et al. Single-tube nested PCR using immobilized internal primers for the identification of dengue virus serotypes. Journal of Virology Methods. 145, 76-79 (2007).
  35. Williams, E. J., Drexler, J. S. A non-destructive method for determining peanut pod maturity. Peanut Science. 8, 134-141 (1981).
  36. Sobolev, V. S., Dorner, J. W. Cleanup procedure for determination of aflatoxins in major agricultural commodities by liquid chromatography. Journal of AOAC International. 85, 642-645 (2002).
  37. Empower Software, Getting Started Guide. Waters Corporation. Milford, MA. Available from: http://sites.chem.colostate.edu/diverdi/C431/experiments/high%20pressure%20liquid%20chromatography/references/Empower%20getting%20started%2071500031203rA.pdf (2002).
  38. Biselli, S., Hartig, L., Wegner, H., Hummert, C. Analysis of Fusarium. toxins using LC-MS-MS: Application to various food and feed matrices. LC GC North America. 23, 404-413 (2005).
  39. Arias, R. S., Sobolev, V. S., Orner, V. A., Dang, P. M., Lamb, M. C. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential. Plant Pathology. 63, 353-363 (2014).
  40. Dang, P. M., Chen, C. Y., Holbrook, C. C. Evaluation of five peanut (Arachis hypogaea) genotypes to identify drought responsive mechanisms utilising candidate-gene approach. Functional Plant Biology. 40, 1323-1333 (2013).
  41. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative C-T method. Nature Protocols. 3, 1101-1108 (2008).
  42. Amaike, S., Keller, N. P. Aspergillus flavus. Annual Review of Phytopathology. 49, 107-133 (2011).
  43. Nowara, D., et al. HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell. 22, 3130-3141 (2010).
  44. Woloshuk, C. P., et al. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Applied and Environmental Microbiology. 60, 2408-2414 (1994).
  45. Price, M. S., et al. The aflatoxin pathway regulator AflR induces gene transcription inside and outside of the aflatoxin biosynthetic cluster. FEMS Microbiology Letters. 255, 275-279 (2006).
  46. Ehrlich, K. C., Montalbano, B. G., Cotty, P. J. Sequence comparison of aflR from different Aspergillus. species provides evidence for variability in regulation of aflatoxin production. Fungal Genetics and Biology. 38, 63-74 (2003).
  47. McDonald, T., Brown, D., Keller, N. P., Hammond, T. M. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Molecular Plant Microbe Interactions. 18, 539-545 (2005).
  48. Abdel-Hadi, A. M., Caley, D. P., Carter, D. R., Magan, N. Control of aflatoxin production of Aspergillus flavus. and Aspergillus parasiticus. using RNA silencing technology by targeting aflD. (nor-1) gene. Toxins (Basel). 3, 647-659 (2011).
  49. Swartz, M. E. Ultra performance liquid chromatography (UPLC): An introduction: Separation Science Redefined. LCGC North America. Suppl ement 8. 8-14 (2005).
  50. Maghuly, F., Khan, M. A., Fernandez, E. B., Druart, P., Watillon, B., Laimer, M. Stress regulated expression of the GUS-marker gene (uidA) under the control of plant calmodulin and viral 35S promoters in a model fruit tree rootstock: Prunus incisa x serrula. Journal of Biotechnology. 135, 105-116 (2008).
  51. de Mesa, M. C., Santiago-Doménech, N., Pliego-Alfaro, F., Quesada, M. A., Mercado, J. A. The CaMV 35S promoter is highly active on floral organs and pollen of transgenic strawberry plants. Plant Cell Reports. 23, 32-38 (2004).
  52. Sunilkumar, G., Mohr, L., Lopata-Finch, E., Emani, C., Rathore, K. S. Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Molecular Biology. 50, 463-474 (2002).
  53. Groenenboom, M. A. C., Maree, A. F. M., Hogeweg, P. The RNA silencing pathway: The bits and pieces that matter. PLoS Computational Biology. 1, 155-165 (2005).
  54. Zhao, D., Song, G. Q. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants. Plant Science: an International Journal of Experimental Plant Biology. 228, 39-47 (2014).
  55. Kamthan, A., Chauduri, A., Kamthan, M., Datta, A. Small RNAs in plants: recent development and application for crop improvement. Frontiers in Plant Science. 6, 208 (2015).
  56. Manda, A., Bodapati, P. N., Rachaputi, N. C., Wright, G., Fukai, S. Aflatoxins and their relationship with sugars in peanut (Arachis hypogaea L). 4th International Crop Science Congress, 2004, Available from: http://www.cropscience.org.au/icsc2004/poster/5/1/3/625_manda.htm (2004).
  57. Uppala, S. S. Factors affecting pre-harvest aflatoxin contamination of peanut (Arachis hypogaea L). Auburn University. (2011).
  58. Sobolev, V. S. Localized production of phytoalexins by peanut (Arachis hypogaea) kernels in response to invasion by Aspergillus species. Journal of Agricultural and Food Chemistry. 56, 1949-1954 (2008).
  59. Sobolev, V. S., Guo, B. Z., Holbrook, C. C., Lynch, R. E. Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes. Journal of Agricultural and Food Chemistry. 55, 2195-2200 (2007).
  60. Sobolev, V. S., Neff, S. A., Gloer, J. B. New stilbenoids from peanut (Arachis hypogaea) seeds challenged by an Aspergillus caelatus strain. Journal of Agricultural and Food Chemistry. 57, 62-68 (2009).
  61. Dorner, J. W., Cole, R. J., Sanders, T. H., Blankenship, P. D. Interrelationship of kernel water activity, soil temperature, maturity, and phytoalexin production in preharvest aflatoxin contamination of drought-stressed peanuts. Mycopathologia. 105, 117-128 (1989).
  62. Sobolev, V. S. Production of phytoalexins in peanut (Arachis hypogaea) seed elicited by selected microorganisms. Journal of Agricultural and Food Chemistry. 61, 1850-1858 (2013).
  63. Basha, S. M. M., Cherry, J. P., Young, C. T. Changes in free amino acids, carbohydrates, and proteins of maturing seeds from various peanut (Arachis hypogaea L.) cultivars. Cereal Chemistry. 53, 586-596 (1976).
  64. Lansden, J. A. Aflatoxin inhibition and fungistasis by peanut tannins. Peanut Science. 9, 17-20 (1982).
  65. Yen, G. C., Duh, P. D., Tsai, C. L. Relationships between antioxidant activity and maturity of peanut hulls. Journal of Agricultural and Food Chemistry. 41, 67-70 (1993).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics