उच्च घनत्व बारकोड एंटीबॉडी माइक्रोएरे का प्रवाह पैटर्न गाइडेड निर्माण

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस प्रोटोकॉल सेल संकेत अध्ययन और बायोमार्कर का पता लगाने में संभावित अनुप्रयोगों के साथ एक बड़े पैमाने पर निर्माण, मल्टिप्लेक्स दो आयामी डीएनए या एंटीबॉडी सरणी, रूपरेखा।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

एंटीबॉडी व्यापक रूप से प्रोटीन बायोमार्कर 1-3 सहित लक्षित प्रोटीन की मौजूदगी की जांच करने के लिए दशकों से प्रोटिओमिक अध्ययन में इस्तेमाल किया गया है। इस क्षेत्र वर्तमान में इस तरह मास स्पेक्ट्रोमेट्री (एमएस) के रूप में अन्य उच्च throughput प्रौद्योगिकियों से बड़ी चुनौतियों का सामना करना पड़ रहा है हालांकि, इन उपकरणों के अन्य assays के साथ सरल डेटा व्याख्या और आसान इंटरफेस बर्दाश्त मुख्य रूप से, क्योंकि अभी भी एंटीबॉडी की उपयोगिता के लिए कमरे के पास बहुत है। हाल के वर्षों में, माइक्रोचिप मचानों में प्रोटीन का एकीकरण एंटीबॉडी माइक्रोएरे 4-7 कामयाब करने के लिए एक नया अवसर प्रदान किया है। उदाहरण के लिए, एक एकल कोशिका माइक्रोचिप में एकीकृत बारकोड माइक्रोएरे सेल संचार अध्ययन 8,9 में इस्तेमाल किया गया है। यह तकनीक अन्य उपलब्ध माइक्रोएरे प्रौद्योगिकियों पर विशिष्ट फायदे हैं। यह पारंपरिक माइक्रोएरे elemen में इस्तेमाल ठेठ 150 माइक्रोन आकार की तुलना में बहुत छोटे 10-100 माइक्रोन, पर सरणी तत्वों की सुविधाटीएस। छोटे सरणी तत्वों का निर्माण व्यवस्थित प्रवाह patterning के दृष्टिकोण का उपयोग कर हासिल की है, और इस एकल कोशिका स्रावित प्रोटीन और intracellular प्रोटीन का पता लगा सकते हैं कि कॉम्पैक्ट प्रोटीन को जन्म देता है। एक और लाभ यह एक सरल, साधन-मुक्त सेटअप का उपयोग है। सबसे प्रयोगशालाओं और छोटी कंपनियों के माइक्रोएरे कोर सुविधाओं का उपयोग करने में सक्षम नहीं हो सकता है, क्योंकि यह विशेष रूप से महत्वपूर्ण है। बारकोड एंटीबॉडी परख थ्रूपुट बढ़ाया सुविधा और पारंपरिक सैंडविच एंजाइम से जुड़ी immunosorbent परख के साथ तुलना उच्च संवेदनशीलता और विशिष्टता (एलिसा 8) प्राप्त है, जबकि एकल कक्षों पर अत्यधिक मल्टिप्लेक्स assays के प्रदर्शन के लिए इस्तेमाल किया जा सकता है। यह तकनीक ट्यूमर कोशिकाओं को 13 ग्लियोब्लास्टोमा 9-11 से प्रोटीन, टी कोशिकाओं 12 का पता लगाने, और प्रचलन में कई आवेदन मिल गया है। वैकल्पिक रूप से, बारकोड डीएनए अकेले mimick के लिए न्यूरॉन्स और astrocytes की सटीक स्थिति में उपयोग किया गया हैमस्तिष्क के ऊतकों 14 के vivo विधानसभा हैैं।

इस प्रोटोकॉल केवल प्रयोगात्मक कदम और fluidic नमूनों में बायोमार्कर का पता लगाने में संभावित आवेदन किया है, जो दो-आयामी (2 डी) बारकोड एंटीबॉडी माइक्रोएरे का निर्माण हुआ ब्लॉकों पर और एकल कक्षों में केंद्रित है। प्रौद्योगिकी एक पता, एकल असहाय एक आयामी (1 डी) डीएनए माइक्रोएरे पर आधारित है गिलास substrates पर स्थानिक नमूनों हैं कि ओर्थोगोनल oligonucleotides के प्रयोग का निर्माण किया। समानांतर प्रवाह चैनलों प्रवाह patterning के चरण में इस्तेमाल किया जाता है, जब 1-डी पैटर्न का गठन किया है, और इस तरह के एक पैटर्न 1-डी यूनिवर्सल उत्पाद कोड (यूपीसी) बारकोड को नेत्रहीन समान असतत बैंड के रूप में प्रकट होता है। 2-डी (एन एक्स एम) एंटीबॉडी सरणी का निर्माण - एक 2-डी त्वरित प्रतिक्रिया (मूल्यांकन) मैट्रिक्स कोड की याद ताजा करती है - और अधिक जटिल patterning रणनीतियों की जरूरत है, लेकिन एक उच्च घनत्व 8,15 पर एंटीबॉडी के स्थिरीकरण के लिए अनुमति देता है। संरचनादूसरी सीधा करने के लिए पहले पैटर्न के साथ दो डीएनए patterning के कदम की आवश्यकता है। इन दो पैटर्न के चौराहे के अंक सरणी के एन एक्स एम तत्वों का गठन। रणनीतिक रूप से प्रवाह patterning में उपयोग एकल असहाय डीएनए (ssDNA) के दृश्यों का चयन करके, एक दिया सरणी में प्रत्येक तत्व एक विशिष्ट पते सौंपा है। यह स्थानिक संदर्भ माइक्रोएरे स्लाइड पर प्रतिदीप्ति संकेतों के बीच भेद करने में आवश्यक है। ssDNA सरणी (सौदा 16) डीएनए इनकोडिंग एंटीबॉडी पुस्तकालय नामक एक मंच के गठन, पूरक डीएनए एंटीबॉडी conjugates के समावेश के माध्यम से एक एंटीबॉडी सरणी में बदल जाती है।

इस वीडियो प्रोटोकॉल, दो झुकाव में तैयारी में शामिल हैं जो nxm एंटीबॉडी polydimethylsiloxane (PDMS) बारकोड नए नए साँचे, प्रवाह patterning ssDNA बनाने एंटीबॉडी oligonucleotide सौदा conjugates, तैयारी और एक 3 में 3 एक्स 3 डीएनए सरणी में परिवर्तित करने में महत्वपूर्ण कदम का वर्णनएक्स 3 एंटीबॉडी सरणी।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सावधानी: इस प्रोटोकॉल में इस्तेमाल कई रसायनों परेशानी है और त्वचा के संपर्क के मामले में खतरनाक हैं। सामग्री सुरक्षा डाटा शीट (एमएसडीएस) से परामर्श करें और इस प्रोटोकॉल के प्रदर्शन से पहले उचित व्यक्तिगत सुरक्षा उपकरण पहनने। चरण (1.1.1) में इस्तेमाल पिरान्हा समाधान उच्च संक्षारक है और आंदोलन के साथ एसिड के लिए धीरे-धीरे पेरोक्साइड जोड़कर तैयार किया जाना चाहिए। एक धूआं हुड में अत्यधिक सावधानी के साथ इस समाधान संभाल लेना। उचित नेत्र सुरक्षा और एसिड प्रतिरोधी दस्ताने का प्रयोग करें। Trimethylchlorosilane (TMCS) (1.1.6) के बाद एक वैकल्पिक कदम में इस्तेमाल एक संक्षारक, ज्वलनशील रसायन है। एक धूआं हुड में इस रसायन संभाल लेना।

नोट: बात कण से प्रदूषण को कम करने के लिए एक साफ कमरे में बारकोड स्लाइड निर्माण और महत्वपूर्ण प्रवाह patterning प्रक्रियाओं का प्रदर्शन। धूल के कणों बंदरगाहों और PDMS molds के microchannels ब्लॉक और प्रवाह के patterning के साथ हस्तक्षेप कर सकते हैं।

एक-dimensiona 1. निर्माणएल डीएनए बारकोड स्लाइड

  1. बारकोड प्रवाह पैटर्न के लिए SU-8 मास्टर की तैयारी
    नोट: सीधा प्रवाह पैटर्न के लिए चित्र (चित्रा 1 ए-बी) के एक कंप्यूटर एडेड डिजाइन (सीएडी) सॉफ्टवेयर का उपयोग कर बनाई गई हैं। इन नमूनों को एक क्रोम photomask पर गाया जाता है। नकाब के पारदर्शी क्षेत्रों SU-8 मास्टर की सुविधाओं के अनुरूप हैं।
    1. 96 डिग्री सेल्सियस तक गर्म 1 से 30% एच 22 (पिरान्हा समाधान): अच्छी तरह से 3 एच 2 अतः 4 का एक मिश्रण में एक सिलिकॉन वेफर (100 मिमी व्यास) साफ करें। विआयनीकृत पानी और isopropyl शराब के साथ वेफर धोने, एक नाइट्रोजन झटका बंदूक के साथ सुखाने के द्वारा पीछा किया।
    2. वेफर पर र -8 2025 photoresist की लगभग 4 मिलीलीटर डालो। समान रूप से 3,000 आरपीएम पर फिर 30 सेकंड, 500 rpm पर 10 सेकंड के लिए वेफर पर photoresist प्रसार करने के लिए एक प्रोग्राम स्पिन coater का प्रयोग करें। यह ~ 25 माइक्रोन की मोटाई के साथ एक photoresist परत बनाता है। धीरे-धीरे रोक से पहले धीमा करने के लिए कताई की अनुमति दें - इस माई हैवेफर की सतह पर एक भी कोटिंग ntain।
    3. उसके बाद 65 डिग्री सेल्सियस पर 1 मिनट के लिए एक hotplate पर लेपित वेफर, सेंकना 95 डिग्री सेल्सियस पर 5 मिनट के लिए। यह कदम कोटिंग जमना करने के लिए अनुमति देता है। 5 मिनट के लिए आरटी के लिए अच्छा है।
    4. Photoresist के कोट पर क्रोम मुखौटा (चित्रा 1 सी) रखें। 20 सेकंड के लिए पास-पराबैंगनी प्रकाश (350-400 एनएम, जोखिम ऊर्जा 150-160 MJ / 2 सेमी) करने के लिए मुखौटा सुविधाओं को बेनकाब।
      नोट: क्रोम मुखौटा पर डिजाइन 50 माइक्रोन पिच के साथ 20 माइक्रोन चौड़ा कर रहे हैं, जिनमें से प्रत्येक के 20 चैनलों, शामिल हैं। चैनलों के विपरीत अंत करने के लिए पैटर्न के एक छोर से घुमावदार हैं। कुल मिलाकर, 20 चैनल 40 मिमी ~ की लंबाई और ~ 20 मिमी की चौड़ाई के साथ एक आयताकार क्षेत्र को कवर किया। प्रत्येक चैनल एक इनलेट और एक दुकान के अनुरूप जो दो गोल सुविधाओं से घिरे हुए है। Inlets और दुकानों विनिमेय हैं।
    5. 95 डिग्री सेल्सियस पर 5 मिनट के लिए एक hotplate पर उजागर वेफर सेंकना। धीरे-धीरे आरटी के लिए अच्छा है।
    6. आंदोलन के साथ एसयू 8 डेवलपर में वेफर विसर्जित5 मिनट के लिए। Isopropyl शराब के बाद ताजा एसयू 8 डेवलपर के एक छोटे से हिस्से के साथ वेफर, धो लें। एक नाइट्रोजन झटका बंदूक का इस्तेमाल वेफर सूखी। हार्ड-सेंकना 30 मिनट के लिए एक 200 डिग्री सेल्सियस hotplate पर वेफर, और वेफर आरटी के लिए धीरे-धीरे शांत करने के लिए अनुमति देते हैं।
      नोट: एक सफेद फिल्म इस चरण में धोने के बाद मनाया जाता है, तो विकास एक लंबे समय के लिए बाहर किया जा सकता है।
      वैकल्पिक: 10 मिनट के लिए एक बंद पेट्री डिश में वाष्प trimethylchlorosilane करने के लिए इसे उजागर करके SU-8 मास्टर Silanize।
  2. PDMS बारकोड ढालना की तैयारी
    1. 4.0 ग्राम इलाज एजेंट के साथ 40.0 छ सिलिकॉन elastomer आधार जुडा है। 10 मिनट के लिए सख्ती prepolymer मिश्रण हिलाओ। वैक्यूम के अंतर्गत 20 मिनट के लिए देगास।
      नोट: 1 (आधार: इलाज एजेंट) जन अनुपात एक सामान्य नियम के रूप में, एक 10 का उपयोग करें।
    2. बारकोड पैटर्न की SU-8 मास्टर के साथ एक सिलिकॉन वेफर युक्त एक पेट्री डिश में prepolymer डालो। PDMS मिश्रण की ऊंचाई लगभग 7.5 मिमी या ऊपर होना चाहिए। पेट्र में मिश्रण देगासएक दूसरी बार तब PDMS इलाज करने के लिए अनुमति देने के लिए 75 डिग्री सेल्सियस पर 1 घंटे के लिए मिश्रण सेंकना, किसी भी शेष बुलबुले को दूर करने के लिए मैं पकवान।
      नोट: यह कदम में PDMS मोल्ड में छेद के माध्यम से पिन / ट्यूबिंग की प्रविष्टि पर PDMS-कांच बांड के लिए बहुत ज्यादा तनाव जोड़ने से बचने के लिए ऊपर ~ में 7.5 मिमी PDMS स्लैब की पर्याप्त मोटाई बनाए रखने या करने के लिए महत्वपूर्ण है (1.3.3.1)
    3. एक छुरी का प्रयोग, ध्यान बारकोड ढालना सुविधाओं में शामिल है और वेफर से स्लैब छील कि PDMS स्लैब के क्षेत्र के आसपास काटा।
    4. PDMS बारकोड मोल्ड के वांछित आकार पाने के लिए स्लैब के किनारों ट्रिम। सवार के साथ एक बायोप्सी पंच का उपयोग मोल्ड के माध्यम से 20 छेद (1.0 मिमी व्यास) पंच। छेद बारकोड पैटर्न के परिपत्र सुविधाओं के साथ गठबंधन कर रहे हैं कि सुनिश्चित करें। ये छेद inlets और दुकानों के रूप में काम करते हैं।
  3. पाली एल लाइसिन की एक-आयामी patterning (पीएलएल)
    1. एक नाइट्रोजन झटका बंदूक का उपयोग कर एक पाली एल Lysine लेपित गिलास स्लाइड की सतह पर किसी भी धूल निकालें। Attacज साफ कांच स्लाइड करने के लिए PDMS मोल्ड। मोल्ड और स्लाइड के किनारों से जुड़ रहे हैं कि सुनिश्चित करें।
    2. PDMS मोल्ड और पीएलएल लेपित स्लाइड के बीच बंधन को मजबूत करने के लिए 75 डिग्री सेल्सियस पर 1.5 घंटे के लिए सेंकना। इस बीच, (0.5 मिमी भीतरी व्यास और 1.5 मिमी बाहरी व्यास के साथ, 4-इंच के टुकड़े करने के लिए 3) लचीला पॉलीथीन टयूबिंग के 20 टुकड़े तैयार करते हैं।
      नोट: ट्यूबिंग के टुकड़े की संख्या PDMS बारकोड सांचे में inlets की संख्या से मेल खाती है। ट्यूबिंग जोड़े को एक दबाव नियामक से लैस एक नाइट्रोजन गैस की टंकी के लिए PDMS बारकोड मोल्ड पर चैनलों में कार्य करता है।
    3. ट्यूबिंग के एक टुकड़े के एक छोर से, एक स्टेनलेस स्टील खोखले पिन (1 मिमी व्यास) देते हैं। महाप्राण बाँझ फ़िल्टर ट्यूबिंग के कम से कम 1 सेमी समाधान से भर जाता है, जब तक पाली एल लाइसिन पिन के माध्यम से समाधान।
      1. PDMS बारकोड मोल्ड (चित्रा 1E) की inlets के लिए (समाधान से भरे ट्यूबिंग से जुड़े) पिन बांधें। नलियों के दूसरे छोर से संलग्नएक दबाव विनियमित नाइट्रोजन टैंक सेट अप। समाधान कम से कम 6 घंटे के लिए 0.5-1 साई के दबाव रेंज का उपयोग कर मोल्ड के माध्यम से प्रवाह करने की अनुमति।
        नोट: सभी प्रवाह patterning प्रक्रियाओं के लिए (1.3.3) चरण का संदर्भ लें।
  4. SsDNA 14 में से एक आयामी patterning
    नोट: बाद के चरणों में इस्तेमाल किया फॉस्फेट बफर खारा (पीबीएस) 137 मिमी NaCl, 10 मिमी ना 2 4 HPO, और 2 मिमी 2 के.एच. पीओ 4. बफर का पीएच 7.4 से तैयार किया जाता है।
    1. पीबीएस में 2 मिमी बीआईएस (sulfosuccinimidyl) suberate (BS3) समाधान तैयार है। पीबीएस या ultrapure पानी में ए, बी, और सी ssDNA (5'-एमाइन, 80 न्यूक्लियोटाइड संशोधित) के 300 माइक्रोन के समाधान तैयार करें।
      नोट: एन -hydroxysuccinimide एस्टर आसानी हाइड्रोलिसिस से होकर गुजरती है, क्योंकि तैयारी के बाद के बारे में 30 मिनट के भीतर BS3 समाधान का उपयोग करें।
    2. 2 मिमी बीआईएस के 2.5 μl (sulfosuccinim के साथ 300 माइक्रोन के ए, बी, सी या ssDNA के 2.5 μl जुडाहर चैनल। ए, बी, और सी डीएनए के लिए पीबीएस में सुखद जीवन) suberate क्रमशः, चैनल 1, 2 के लिए नामित, और 3 रहे हैं। यह आदेश भी 3 चैनलों (2A चित्रा) की शेष सेट करने के लिए लागू किया जाता है।
    3. प्रदर्शन करना कदम (1.3.3)। इस बार, स्टेनलेस स्टील पिन के माध्यम से और पॉलीथीन टयूबिंग में 5 μl BS3 / डीएनए समाधान महाप्राण, नाइट्रोजन के स्रोत के लिए तो कुछ PDMS मोल्ड। BS3 / डीएनए समाधान के बारे में 40 मिनट के लिए या चैनलों भर रहे हैं पर जब तक बारकोड मोल्ड के माध्यम से प्रवाह करने की अनुमति।
    4. एक बार सभी चैनलों भर रहे हैं प्रवाह बंद करो, तो 2 घंटे के लिए आरटी पर बारकोड में BS3 / डीएनए समाधान सेते हैं। समाधान सूख करने की अनुमति नहीं है। 75 डिग्री सेल्सियस पर 1 घंटे के लिए संलग्न बारकोड स्लाइड के साथ PDMS मोल्ड बनाओ।
      नोट: बाद में प्रवाह patterning के चरणों में संरेखण की सुविधा के लिए, बारकोड स्लाइड पर चैनल पैटर्न के किनारों को रेखांकित किया जा सकता है। यह ध्यान से एक हीरे scrib का उपयोग कर कांच की सतह scratching द्वारा किया जाता हैई गिलास स्लाइड के तल पर संरेखण मार्करों उत्पन्न करने के लिए। प्रोटोकॉल के बाद के चरणों में संरेखण एक खुर्दबीन के नीचे की जाँच की जा सकती है।
    5. बारकोड स्लाइड से PDMS मोल्ड निकालें। Ultrapure पानी के साथ एसडीएस एक बार और तीन बार 0.01% के साथ धीरे स्लाइड धो लें।
      1. एक खुर्दबीन स्लाइड स्पिनर का उपयोग कर बारकोड स्लाइड सूखी। बाद के उपयोग के लिए एक स्वच्छ 50 मिलीलीटर अपकेंद्रित्र ट्यूब में बारकोड स्लाइड स्टोर।

बारकोड स्लाइड पर एक-आयामी पैटर्न 2. मान्यकरण

नोट: यह सत्यापन प्रोटोकॉल भी बाद के प्रवाह patterning के कदम की गुणवत्ता का आकलन करने में उपयोग के लिए अनुकूलित किया जा सकता है।

  1. स्लाइड के अवरुद्ध
    1. पीबीएस में 1% गोजातीय सीरम albumin (बीएसए) तैयार करें। उपयोग करने से पहले एक 0.45 माइक्रोन सिरिंज फिल्टर के माध्यम से इस समाधान फ़िल्टर। एक जेल लोडिंग टिप का उपयोग करना, बारकोड स्लाइड के एक किनारे करने के लिए 1% बीएसए समाधान के 50 μl लागू होते हैं।
    2. 1% बीएसए solut सेतेआरटी पर 1 घंटे के लिए आयन।
  2. जाती 3 (Cy3) के साथ ऊष्मायन पूरक डीएनए संयुग्मित
    1. एक छोर पर Cy3 संयुग्मित एक एक की कॉकटेल ', बी', और 'सी' oligonucleotides तैयार करें। 'बी', और सी 'ए के दृश्यों क्रमश: ए, बी, और सी के उन लोगों के पूरक हैं। Cy3-डीएनए के काम एकाग्रता 0.1% BSA में 0.05 माइक्रोन है।
    2. Pipetting द्वारा स्लाइड से बीएसए समाधान निकालें, तो स्लाइड के एक ही किनारे पर डीएनए कॉकटेल समाधान के 30 μl लागू होते हैं। 1 घंटे के लिए आरटी पर स्लाइड पर Cy3 डीएनए कॉकटेल सेते हैं। Photobleaching से Cy3 आधा भाग की रक्षा के लिए अंधेरे में इस ऊष्मायन कदम प्रदर्शन।
  3. प्रतिदीप्ति तीव्रता का विश्लेषण
    1. पतला पीबीएस में अंत में Cy3 डीएनए कॉकटेल बाहर पिपेट और, 1% BSA में पीबीएस स्लाइड धोने, और (1 पी50 भागों ultrapure पानी के साथ कला पीबीएस)। एक स्पिनर का उपयोग स्लाइड सूखी।
    2. एक प्रतिदीप्ति सूक्ष्मदर्शी या एक माइक्रोएरे स्कैनर का उपयोग कर प्रतिदीप्ति (चित्रा 2 बी) का निरीक्षण करें। एक माइक्रोएरे स्कैनर का उपयोग करते समय, 532 एनएम, 5 माइक्रोन पर पिक्सेल आकार, 15% से कम photomultiplier ट्यूब (पीएमटी) 450 में लाभ और सत्ता के लिए लेजर तरंग दैर्ध्य उत्सर्जन निर्धारित किया है।

2-आयामी (3x3) डीएनए ऐरे 14 3. निर्माण

  1. PDMS बारकोड ढालना की तैयारी
    1. एक और SU-8 मास्टर के निर्माण के लिए प्रक्रिया (1.1) करते हैं, लेकिन इस बार सीधा पहली डिजाइन की है कि एक प्रवाह पैटर्न के साथ एक क्रोम मुखौटा का उपयोग करें। सीधा पैटर्न के साथ एक नया PDMS मोल्ड के निर्माण के लिए प्रक्रिया (1.2) को पूरा करें।
  2. SsDNA के दो आयामी प्रवाह patterning
    1. एक 3 एक्स 3 सरणी के लिए, A'-मैं, B 'की द्वितीय के 150 माइक्रोन के शेयर समाधान, C'-III, A'-चतुर्थ, B' वी, C'छठी, A'-सातवीं, बी तैयार3% बीएसए / पीबीएस में '-viii, और C'-IX डीएनए। ये oligonucleotides "ब्रिजिंग दृश्यों" (2A चित्रा) के रूप में काम करते हैं। Oligonucleotide समाधान (समाधान 1-3) काम एकाग्रता प्रत्येक oligonucleotide के लिए 50 माइक्रोन है कि इस तरह का मिश्रण। तालिका 1 में प्रदान की गाइड का प्रयोग करें।
    2. 0.5-1 साई पर 1 घंटे के लिए सभी 20 चैनलों में 3% BSA / पीबीएस अवरुद्ध समाधान प्रवाह।
    3. प्रवाह समाधान 1, क्रमश: 2, और चैनल 1, 2 में 3, और 3,। 3 चैनलों के बाद के सेट के लिए इस आदेश का पालन करें। प्रवाह आमतौर पर लगभग 40 मिनट में पूरा हो गया है। डीएनए संकरण करने के लिए अनुमति देने के लिए 2 घंटे के लिए आरटी पर डीएनए समाधान सेते हैं।
    4. Unhybridized डीएनए दूर करने के लिए 0.5-1 साई पर 1 घंटे के लिए सभी 20 चैनलों में 3% BSA / पीबीएस अवरुद्ध समाधान प्रवाह। PDMS स्लैब को छीलकर, और 3% बीएसए में कांच स्लाइड सूई से जिसके परिणामस्वरूप डीएनए माइक्रोएरे स्लाइड धो / पीबीएस एक बार और पीबीएस दो बार, पतला पीबीएस (1 भाग पीबीएस और 50 भागों ultrapure पानी) द्वारा पीछा किया। डीएक खुर्दबीन स्लाइड स्पिनर का उपयोग स्लाइड ry।
    5. मैं Cy3 संयुग्मित हैं कि 'नौवीं के लिए' खंड 2. इस्तेमाल oligonucleotides में है कि इसी तरह एक दूसरी मान्यता के कदम (चित्रा -2) निष्पादित करें। बाद के उपयोग के लिए एक 50 मिलीलीटर अपकेंद्रित्र ट्यूब में 3 एक्स 3 सरणी स्लाइड स्टोर।
      नोट: डीएनए माइक्रोएरे महीनों के लिए एक desiccator में आरटी पर संग्रहित किया जा सकता है।

एक एंटीबॉडी सरणी में 3 एक्स 3 डीएनए ऐरे 4. रूपांतरण

  1. एंटीबॉडी oligonucleotide (डील) conjugates की तैयारी
    1. 200 मिमी succinimidyl-4-formylbenzoate (एस 4FB) और निर्जल एन में 40 मिमी succinimidyl-6-hydrazinonicotinamide (एस HyNic), एन -dimethylformamide (DMF) के समाधान के लिए तैयार करें।
    2. पीबीएस में कब्जा एंटीबॉडी के 7 अलग समाधान (1 मिलीग्राम / एमएल) के लिए तैयार करें।
      नोट: एंटीबॉडी स्टॉक समाधान सोडियम azide bacteriostat होते हैं, स्पिन desalting ग का उपयोग करते हुए पीबीएस के साथ बफर विनिमय प्रदर्शन7 केडीए आणविक वजन कट ऑफ (MWCO) के साथ olumns।
    3. मैं की, '' द्वितीय III ', चतुर्थ,' वी ', छठी, सातवीं और' डीएनए अलग 400 माइक्रोन के समाधान तैयार करें। एक oligonucleotide अनुक्रम करने के लिए प्रत्येक कब्जा एंटीबॉडी निरुपित। Microcentrifuge ट्यूबों में DMF के 12.25 μl के साथ 400 माइक्रोन के डीएनए के 40 μl का मिश्रण है और मिश्रण अच्छी तरह से करने के लिए नीचे स्पिन।
      1. प्रत्येक डीएनए / DMF समाधान करने के लिए, DMF में 200 मिमी एस 4FB के 2.3 μl जोड़ें। कब्जा एंटीबॉडी के हर 100 ग्राम के लिए, DMF में 40 मिमी एस HyNic की 2.25 μl जोड़ें।
    4. आरटी पर 4 घंटे के लिए एंटीबॉडी / एस HyNic और डीएनए / एस 4FB समाधान सेते हैं।
    5. एंटीबॉडी डीएनए युग्मन प्रतिक्रिया के लिए तैयार करने में, पीएच 6 पर साइट्रेट बफर के साथ उन्हें धोने से नए स्पिन desalting कॉलम (प्रत्येक एंटीबॉडी के लिए प्रत्येक डीएनए समाधान के लिए एक और एक) तैयार करते हैं।
    6. ऊष्मायन के 4 घंटे के बाद, प्रत्येक एंटीबॉडी / एस-HyNic और डीएनए / एस 4FB समाधान के लिए बफर विनिमय प्रदर्शन करते हैं। एस-4FB संयुग्मित जुडा सातवीं' oligonucleotides। आरटी पर 2 घंटे के लिए मिश्रण को सेते हैं।
    7. प्रतिक्रिया हे / एन 4 डिग्री सेल्सियस पर सेते हैं।
  2. एंटीबॉडी oligonucleotide (डील) conjugates के शुद्धीकरण
    नोट:, एंटीबॉडी oligonucleotide conjugates शुद्ध एक Superose 6 10/300 जीएल स्तंभ से लैस एक मानक FPLC सिस्टम पर तेजी से प्रोटीन तरल क्रोमैटोग्राफी (FPLC) करने के लिए।
    1. 280 एनएम के लिए FPLC प्रणाली की यूवी डिटेक्टर की तरंग दैर्ध्य सेट करें। अतिरिक्त एस 4FB डीएनए से एंटीबॉडी oligonucleotide conjugates अलग करने के लिए 0.3 मिलीग्राम / मिनट पर पीबीएस (7.4 पीएच) के isocratic प्रवाह का प्रयोग करें।
    2. संयुग्म युक्त भिन्न पूल और एक 10 केडीए MWCO के साथ स्पिन फिल्टर का उपयोग कर 150 μl की एक मात्रा के अंशों ध्यान केंद्रित।
  3. एंटीबॉडी के दो आयामी patterning
    1. Microchambers या सूक्ष्म कुओं हमारे साथ एक और PDMS मोल्ड तैयारकदम में आईएनजी निर्माण प्रक्रियाओं (1.2)। PDMS मोल्ड immunoassays के लिए nanoliter वेल्स को माइक्रोलीटर हो सकती है।
      नोट: fluidic नमूनों में सामान्य बायोमार्कर का पता लगाने के लिए, कई कुओं के साथ एक PDMS ढालना सरणी स्लाइड के साथ mated है। PDMS मोल्ड की सुविधाओं प्रणाली का अध्ययन किया जा रहा है पर निर्भर करते हैं। उदाहरण के लिए, एकल कोशिका के प्रयोगों से प्रोटीन का पता लगाने के 0.15-NL संस्करणों के साथ microchambers युक्त एक PDMS मोल्ड के साथ किया जा सकता है।
    2. (वैकल्पिक) ने अपने नमूनों सतह हाइड्रोफिलिक प्रस्तुत करने के लिए 1.5 मिनट के लिए प्लाज्मा के लिए PDMS मोल्ड सफाई (18 डब्ल्यू) विषय। पहले प्लाज्मा सफाई करने के लिए, सीधे 3 एक्स 3 सरणी स्लाइड को बंधुआ किया जाएगा कि सभी अन्य सतहों को ब्लॉक करने के लिए चिपकने वाला टेप का उपयोग करें।
      नोट: चरण (4.3.2) वैकल्पिक है लेकिन PDMS मोल्ड एकल कोशिका के प्रयोगों में उपयोग के लिए है जब आम तौर पर किया जाता है।
    3. 3 एक्स 3 सरणी स्लाइड के साथ PDMS ढालना मेट, तो पीबीएस में 1% BSA के साथ स्लाइड ब्लॉक। आरटी पर 1 घंटे के लिए सेते हैं। MeanwhiLe, एंटीबॉडी oligonucleotide conjugates के एक कॉकटेल (200 μl अंतिम मात्रा) तैयार करते हैं। प्रत्येक रूप साधना का काम कर रहे एकाग्रता 1% BSA / पीबीएस में 10 माइक्रोग्राम / एमएल है।
    4. तो इस तरह एक एंटीबॉडी सरणी के लिए डीएनए सरणी परिवर्तित करने, conjugates के oligonucleotide आधा भाग 3 एक्स 3 सरणियों पर विशिष्ट स्थानों के साथ संकरण करने के लिए अनुमति देने के लिए 37 डिग्री सेल्सियस पर 1 घंटे के लिए सेते हैं, एंटीबॉडी oligonucleotide कॉकटेल जोड़ें।
    5. साफ है और स्लाइड को सुखाने के लिए दोहराएँ कदम (3.2.4)। एंटीबॉडी सरणी तुरंत इस्तेमाल किया जाता है, तो सबसे अधिक संवेदनशीलता से हासिल किया जा सकता है। लंबे समय तक भंडारण संवेदनशीलता का नुकसान हो सकता है।
  4. प्रोटीन की जांच
    1. पुनः संयोजक प्रोटीन Reconstitute या एक फ़िल्टर सेल नमूना तैयार करते हैं।
    2. एक कस्टम डिजाइन चिप के साथ माइक्रोएरे मेट, और 1 घंटे के लिए पीबीएस में 3% BSA के साथ सतह ब्लॉक। फिर बीएसए समाधान निकालने के लिए, और नमूने लागू करते हैं और 2 घंटे के लिए सेते हैं।
    3. पीबीएस में 3% बीएसए का उपयोग कर नमूने से धो लें तीन बार, एकफिर उत्पाद datasheet द्वारा प्रदान की एकाग्रता में पता लगाने के एंटीबॉडी जोड़ने घ। 2 घंटे के लिए सेते हैं।
    4. पीबीएस में तीन बार 3% बीएसए द्वारा पता लगाने एंटीबॉडी से धो लें, और फिर एक घंटे के लिए ऊष्मायन द्वारा पीछा 1 माइक्रोग्राम / मिलीलीटर में -streptavidin जाती 5 (Cy5), जोड़ें।
    5. साफ और स्कैनिंग के लिए स्लाइड सुखाने के लिए दोहराएँ कदम (3.2.4)।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

PDMS नए साँचे (चित्रा 1 ए -1 बी) के लिए डिजाइन एक सीएडी कार्यक्रम (ऑटोकैड) का उपयोग कर तैयार किया गया। प्रवाह patterning, क्षैतिज और एक ऊर्ध्वाधर के लिए सुविधा चैनलों दिखाया दो डिजाइन। प्रत्येक डिजाइन के लिए छोड़ दिया और सही भागों सममित हैं; उनमें से किसी के inlets या दुकानों हो सकता है। 20 चैनलों में से प्रत्येक के लिए सभी तरह से दूसरे छोर तक एक छोर से घुमावदार है। प्रत्येक डिजाइन एक क्रोम photomask (चित्रा 1 सी) पर छपा हुआ है। एक वेफर पर गढ़े SU-8 मास्टर चित्रा -1 में दिखाया गया है। पीएलएल या डीएनए के प्रवाह-आकृति की सुविधा, PDMS मोल्ड एक नाइट्रोजन गैस का प्रवाह सेट-अप (चित्रा 1E) के लिए मिलकर किया गया था।

इस प्रोटोकॉल में प्रयुक्त तीन प्रवाह patterning के कदम उठाए हैं। सफल कदम oligonucleotide समाधान परिचय दोनों जबकि पहला कदम है, कांच के अध पर पीएलएल immobilizes। तालिका 1, oligonucle मेंसमाधान 1-3 की otide रचनाओं दिया जाता है। प्रत्येक oligonucleotide के काम कर रहे एकाग्रता 50 माइक्रोन है और प्रत्येक समाधान की कुल मात्रा 39 μl है। ये समाधान प्रत्येक oligonucleotide शेयर समाधान (150 माइक्रोन) के 13 μl के संयोजन से तैयार कर रहे हैं।

नमूनों के डीएनए माइक्रोएरे इकाइयों दोहराव और पूरे गिलास स्लाइड भर में आसन्न हैं। 3 एक्स 3 प्रोटीन के लिए, अधिकतम घनत्व एक गिलास स्लाइड पर के बारे में 400.000 स्पॉट है। वाणिज्यिक डीएनए माइक्रोएरे के साथ पक्ष द्वारा साइड तुलना हमारी प्रौद्योगिकी Cy3 के लिए बाध्य पूरक DNAs टैग किया जब लगभग 5 गुना अधिक संवेदनशील है कि पता चलता है। नमूनों DNAs कई दोहराता भर में ~ 5% बदलाव के साथ अपेक्षाकृत एक समान हैं। जैविक नमूने से प्रोटीन की सामग्री को मापने जब उन सुविधाओं हमारी प्रौद्योगिकी की उच्च मात्रा का ठहराव क्षमता वादा करता हूँ। इसके अलावा, प्रवाह चैनल डिजाइन के साथ संयोजन में DNAs की ओर्थोगोनालिटी flexibili की पेशकशgeometries के एक किस्म (चित्रा 2 डी) में patterning के Ty।

चित्रा 3 सी के रूप में दिखाया डीएनए एंटीबॉडी conjugates (चित्रा 3 बी) के साथ संकरण के माध्यम से एक एंटीबॉडी सरणी में डीएनए सरणी परिवर्तित करने के बाद, जिसके परिणामस्वरूप एंटीबॉडी पैनल मुख्य रूप से सैंडविच एलिसा मंच के माध्यम से, मल्टिप्लेक्स का पता लगाने में किया जाता है। सैंडविच एलिसा में, biotinylated का पता लगाने (माध्यमिक) एंटीबॉडी पर कब्जा कर लिया प्रोटीन के लिए बाध्य है, और fluorophore संयुग्मित streptavidin के साथ बाद में लेबलिंग प्रतिदीप्ति आधारित पहचान (चित्रा -3 सी-ई) के लिए अनुमति देता है। प्रोटीन से पता चलता है <गिलास स्लाइड (चित्रा 3 डी) के दूसरे छोर से एक छोर से 10% भिन्नता का पता लगाने। 3 एक्स 3 सरणी के साथ, हम संदर्भ के रूप में एक सरणी तत्व बताए हैं, जबकि 7 प्रोटीन के लिए ऊपर का पता लगाने में सक्षम हैं (Cy3 लेबल) और नकारात्मक नियंत्रण के रूप में एक और तत्व। उदाहरण के लिए, एक एकल कोशिका के प्रयोग के लिए प्रदर्शनट्यूमर के अध्ययन, प्रोटीन इंटरल्यूकिन -6 (आईएल -6), मैट्रिक्स metallopeptidase 9 (MMP9), hepatocyte वृद्धि कारक (HGF), संवहनी endothelial वृद्धि कारक (VEGF), इंटरल्यूकिन -8 (आईएल 8), और मैक्रोफेज पलायन निरोधात्मक कारक एक एकल कोशिका से (MIF) (चित्रा 3E) एक साथ पता लगाया जा सकता है।

हम भी विभिन्न सांद्रता में पुनः संयोजक प्रोटीन का उपयोग कर प्रणाली calibrated। चित्रा 3F में, पुनः संयोजक प्रोटीन इंटरफेरॉन γ के लिए अंशांकन घटता (IFN-γ), ट्यूमर नेक्रोसिस फैक्टर α (TNF α), इंटरल्यूकिन 13 (आईएल -13), ट्यूमर नेक्रोसिस फैक्टर β (TNF β), granzyme बी, इंटरल्यूकिन -4 (आईएल 4), और इंटरल्यूकिन -8 (आईएल -8) दिखाए जाते हैं। पता लगाने की संवेदनशीलता भी सब्सट्रेट पर DNAs और संभवतः एंटीबॉडी के उच्च लोड करने के साथ अच्छी तरह से प्लेटों पर पारंपरिक सैंडविच एलिसा के लिए काफी समान है।

बारकोड antibodY माइक्रोएरे fluidic नमूनों में और साथ ही एकल कक्षों में बायोमार्कर का पता लगाने के लिए इस्तेमाल किया जा सकता है। एकल कोशिका विश्लेषण इस प्रोटोकॉल का ध्यान नहीं है, हम बस साइटोकिन्स का पता लगाने में 3 एक्स 3 एंटीबॉडी माइक्रोएरे के आवेदन का उदाहरण है। एंटीबॉडी सतह मार्कर बातचीत के माध्यम से, भेदभाव 8 की क्लस्टर (सीडी 8) पॉजिटिव कोशिकाओं माइक्रोएरे तत्वों (चित्रा 3 जी; शीर्ष पर एक PDMS चिप) में से एक पर कब्जा कर लिया गया है, और तत्वों के बाकी (स्रावित साइटोकिन्स का पता लगाने के लिए इस्तेमाल किया गया चित्रा 3H)। इस सेल पर कब्जा विधि के साथ, "सेल सरणियों" का गठन किया जा सकता है। इस सरणी कब्जा तकनीक को भी प्रत्येक एलिसा प्रयोग के अधीन कोशिकाओं की संख्या पर नियंत्रण के लिए अनुमति देता है। पता चला प्रोटीन विशेष एकल कक्षों से संबंधित है, ताकि कोशिकाओं शारीरिक रूप से microchambers में अलग थे। चित्रा 3H में, यह दिखाया गया है प्रत्येक microchamber के encapsulation सुनिश्चित करने के लिए 16 माइक्रोएरे तत्वों के साथ सुसज्जित है किएक पूर्ण 3 एक्स 3 माइक्रोएरे सेट।

आकृति 1
चित्रा 1. डिजाइन और प्रवाह के आधार पर डीएनए patterning के लिए PDMS बारकोड molds के निर्माण। पैनल (ए) क्षैतिज और ऊर्ध्वाधर एक आयामी बारकोड पैटर्न के लिए AutoCAD चित्र से पता चलता है। पैनल (बी) (ए) से आरोपित क्षैतिज और ऊर्ध्वाधर बारकोड पैटर्न से पता चलता है। ग्रीन बक्से असतत 3 एक्स 3 सरणियों के साथ नमूनों क्षेत्रों लगा देना। SU-8 मास्टर fabricating के लिए (सी) क्रोम मुखौटा। (डी) एक सिलिकॉन वेफर पर गढ़े SU-8 मास्टर। (ई) के प्रवाह patterning के लिए सेट अप। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2 चित्रा 2. निर्माण और एक 3 एक्स 3 डीएनए सरणी का सत्यापन। यह आंकड़ा वांग, जे एट अल।, 2012, नैनो लेटिष 12 से ", ग्लयोब्लास्टोमा Multiforme कैंसर की कोशिकाओं को आवेदन के साथ सेल सेल इंटरेक्शन कार्य Quantitating" से संशोधित किया गया है । अमेरिकन केमिकल सोसायटी द्वारा कॉपीराइट 2012। अनुमति के साथ अनुकूलित। डीएनए प्रवाह patterning के चरणों के लिए (ए) योजना। -1 डी बारकोड (एक खड़ी रेखा से पता लगाया) एक चयनित क्षेत्र में 20 चैनलों में से (बी) प्रतिदीप्ति तीव्रता प्रोफ़ाइल। Cy3 संयुग्मित oligonucleotides के सत्यापन के लिए डीएनए सरणियों के साथ संकरित किया गया। दूसरी डीएनए patterning के कदम को पूरा करने के बाद Cy3 संयुग्मित डीएनए के साथ मान्य सरणियों (सी) प्रतिदीप्ति तीव्रता प्रोफ़ाइल। (डी) अलग FL से वैकल्पिक फ्लोरोसेंट पैटर्नरणनीतियों-patterning ओउ। ​​यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
3 एक्स 3 माइक्रोएरे चित्रा 3. आवेदन। (ए) योजना एंटीबॉडी oligonucleotide सौदा conjugates के संश्लेषण के लिए। एंटीबॉडी oligonucleotide conjugates के साथ संकरण के माध्यम से एक एंटीबॉडी सरणी में डीएनए सरणी के रूपांतरण के लिए (बी) योजना। एक सैंडविच एलिसा मंच में 3 एक्स 3 माइक्रोएरे उपयोग करने के लिए (सी) योजना। यह आंकड़ा वांग, जे एट अल।, 2012, नैनो लेटिष 12 से ", ग्लयोब्लास्टोमा Multiforme कैंसर की कोशिकाओं को आवेदन के साथ सेल सेल इंटरेक्शन कार्य Quantitating" से संशोधित किया गया है। कॉपीराइट 20अमेरिकन केमिकल सोसायटी द्वारा 12। अनुमति के साथ अनुकूलित। पैनल (डी) एक Cy5 चैनल के तहत उत्पन्न एक प्रतिदीप्ति readout से पता चलता है। यह 6 प्रोटीन का पता चला है कि एक सैंडविच एलिसा प्रयोग से मेल खाती है। पैनल (ई) है एक में बढ़कर Cy3 और Cy5 चैनलों के तहत एक 3 एक्स 3 सरणी readout के प्रोफ़ाइल। पैनल (एफ) पुनः संयोजक प्रोटीन के लिए सैंडविच एलिसा अंशांकन घटता से पता चलता है। पैनल (जी) सरणी पर एंटीबॉडी के साथ बंधन के माध्यम से कोशिकाओं पर कब्जा करने से गठित एक "सेल सरणी" से पता चलता है। पैनल (एच) एक माइक्रोचिप में microchambers के साथ आरोपित पता लगाने के परिणाम से पता चलता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

1
समाधान प्रोटोकॉल संरचना
A'-मैं, B 'की द्वितीय, C'-III
2 A'-चतुर्थ, B 'वी, C'-VI
3 A'-सातवीं, B 'की आठवीं, C'-IX

डीएनए प्रवाह patterning के लिए समाधान 1-3 की तालिका 1. संरचना।

एंकरिंग दृश्यों
ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
बी GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
सी GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
दृश्यों को पाटना
A'-मैं TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B 'की द्वितीय TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-III TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-चतुर्थ TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B 'वी TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-VI TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-सातवीं TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B 'की आठवीं TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-IX TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
सत्यापन के लिए cy3 संयुग्मित oligonucleotides
ए' TACGGACTTAGCTCCAGGAT
बी ' TAGGCATGATTCAATGAGGC
सी' TAGCGATAGTAGACGAGTGC
मैं' TACTCTGACATCTCGACCAT
द्वितीय ' TAGATACTGCCACTTCACAT
III ' TACCGTGAACCTTACCTGAT
चतुर्थ ' AATGCTGGGGAAGGCTACTC
वी ' CGCACCGCAGTTTGGTCAAT
छठी ' TCCGACGCAACAATAGGGCA
'सप्तम CCTGCTCGACAACTAGAAGA
'आठवीं CCGCGACCAGAATTAGATTA
नौवीं ' GCCGAAGCAGACTTAATCAC
"के लिए: रख-together.within-पेज =" 1 "> तालिका 2 डीएनए प्रवाह patterning में इस्तेमाल किया दृश्यों।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

प्रवाह पैटर्न डिजाइन 2-डी माइक्रोएरे fabricating में पहला महत्वपूर्ण कदम है। एक गिलास सब्सट्रेट पर दो ओवरलैपिंग डीएनए पैटर्न उत्पन्न करने के लिए, पहली डिजाइन के चैनल सुविधाओं दूसरा (चित्रा 1 ए-बी) के उन लोगों के लिए खड़ा होना चाहिए। डिजाइन भी माइक्रोएरे के बहाव के आवेदन पर विचार। एकल कोशिका विश्लेषण के मामले में, माइक्रोएरे इसलिए चैनल आयाम 2-डी सरणियों के साथ पंक्ति में है कि microchambers के साथ संगत बना रहे हैं, microchambers में संलग्न एकल कक्षों से प्रोटीन का पता लगाने के लिए प्रयोग किया जाता है। प्रत्येक डिजाइन एक photomask पर प्रदान की गई है और मानक फोटोलिथोग्राफी तकनीक एक सिलिकॉन वेफर (चित्रा 1 सी-डी) पर र -8 में चैनल सुविधाओं के निर्माण के लिए उपयोग किया जाता है। इस मोल्डिंग PDMS के लिए गुरु के रूप में कार्य करता है। ढालना गढ़े किया गया है, यह एक PLL लेपित स्लाइड को बंधुआ और फिर एक नाइट्रोजन गैस का प्रवाह सेट-अप (चित्रा 1E) के साथ युग्मित है। सेट-अप हमउपयोग में आसान है और आसानी से एक दबाव विनियमित नाइट्रोजन गैस के स्रोत के साथ किसी भी प्रयोगशाला में शामिल होने का लाभ है। हम एक नाइट्रोजन गैस टैंक से जुड़ा सस्ती कई 3 तरह वाल्व के एक विधानसभा का उपयोग करें। patterning के लिए हवा का प्रवाह मोल्ड से गिलास स्लाइड के delamination से बचने के लिए कम दबाव (0.5-1 साई) में बनाए रखा जाना चाहिए। PDMS मोल्ड के भीतर लीक पैटर्न की अखंडता समझौता कर सकते हैं।

इस प्रोटोकॉल में डीएनए प्रवाह patterning के कदम का चयन सावधानी से ओर्थोगोनल दृश्यों (2A चित्रा) के साथ ssDNA का उपयोग। प्रायर को प्रवाह patterning, इन oligonucleotides पर अद्वितीय दृश्यों पार बात की अनुपस्थिति के लिए परीक्षण किया जाना चाहिए। पार से बात करने के लिए एक साधारण परीक्षण है कि हम अपने प्रोटोकॉल में परिचय सत्यापन प्रक्रिया (चरण 2) को संशोधित करके किया जाता है। इसके बजाय का कॉकटेल का उपयोग करने का पूरक डीएनए Cy3 टैग, पूरक अनुक्रम का ही एक प्रकार स्लाइड के एक चयनित क्षेत्र के लिए एक समय में प्रयोग किया जाता है, जो कई परडीएनए दृश्यों स्थिर कर रहे हैं। डीएनए पार बात के अभाव में, केवल (1-डी डीएनए सरणी के लिए) एक पट्टी या (2 डी डीएनए सरणी के लिए) एक जगह एक Cy3 फिल्टर के तहत फ्लोरोसेंट किया जाना चाहिए। अच्छी तरह से मान्य ओर्थोगोनल दृश्यों के उदाहरण सामग्री और उपकरणों की तालिका में पाया जा सकता है। पहले डीएनए patterning के कदम "लंगर" oligonucleotides के तीन प्रकार का परिचय। ये 80-NT दृश्यों दो अद्वितीय 20-मेर दृश्यों के साथ वैकल्पिक कि दो 20-मेर पाली-ए क्षेत्रों के शामिल हैं। इन लंगर दृश्यों पर 5'-एमाइन संशोधन अमाइन-से-एमाइन BS3 द्वारा मध्यस्थता पीएलएल के साथ 17 पार से जोड़ने के लिए आवश्यक है। दूसरी डीएनए patterning के कदम के लिए एक पार linker की आवश्यकता नहीं है। यह कदम आंशिक रूप से लंगर दृश्यों के साथ संकरण कि "सेतु" oligonucleotides परिचय। प्रत्येक 60-NT ब्रिजिंग अनुक्रम एक लंगर अनुक्रम, एक 20 मेर पाली-एक स्पेसर, और एक अद्वितीय 20-मेर दृश्य करने के लिए पूरक एक 20 मेर क्षेत्र के होते हैं। डीएनए सरणियों की मान्यता (Figurई 2 बी-सी) patterning के कदम की गुणवत्ता का आकलन करने के लिए और कोई पार संदूषण 14 सुनिश्चित करने के लिए हर डीएनए प्रवाह patterning के कदम के बाद किया जाता है। यह डीएनए पैटर्न के साथ संकरण कि Cy3 संयुग्मित oligonucleotide जांच शुरू करने से किया जाता है। प्रतिदीप्ति तीव्रता का विश्लेषण करने के लिए कदम (2.3.2) में निर्धारित मानकों से, डीएनए पैटर्न माइक्रोएरे का उपयोग किया डाउनस्ट्रीम immunoassays की संवेदनशीलता को अधिकतम करने के लिए कम से कम 40,000 Au की प्रतिदीप्ति तीव्रता का प्रदर्शन करना चाहिए। सत्यापन के दौरान विभिन्न Cy3 डीएनए सेट के सामरिक का प्रयोग इस प्रकार 8 कदम डीएनए patterning के लचीलेपन का प्रदर्शन, वैकल्पिक पैटर्न (चित्रा 2 डी) को जन्म देता है। लीक या (जैसे धूल कणों के रूप में) यांत्रिक अवरोधों से परिणाम सकता वर्दी पैटर्न को प्राप्त करने में विफलता प्रवाह patterning के चरणों में सामना करना पड़ा।

एंटीबॉडी oligonucleotide सौदा conjugates की तैयारी वीं में एक और महत्वपूर्ण कदम हैप्रोटोकॉल है। एंटीबॉडी के चुनाव अध्ययन के तहत जैविक प्रणाली से निर्धारित होता है। संयोजन में इस्तेमाल किया oligonucleotides के डीएनए सरणी पर लंगर डाले उन लोगों के लिए पूरक दृश्यों होनी चाहिए। एस-4FB और एस HyNic linkers के शेयर समाधान हौसले से तैयार और हाइड्रोलिसिस से बचने के लिए दूर नमी से दूर रखा जाना चाहिए। हमारे विकार प्रोटोकॉल में इस्तेमाल किया ऊष्मायन बार एंटीबॉडी और डीएनए पर वांछित कार्यक्षमताओं लागू करने के लिए काफी लंबे समय से कर रहे हैं। अंतिम युग्मन प्रतिक्रिया केवल FPLC के माध्यम से unreacted एस 4FB संयुग्मित oligonucleotides हटाने से बुझती है। इस प्रकार, FPLC शुद्धि विकार को पूरा करने के तुरंत बाद किया जाना चाहिए। हमारे प्रोटोकॉल में वर्णित व्यवस्था, कम प्रवाह दर (0.2-0.25 मिलीग्राम / मिनट) के साथ FPLC जब प्रदर्शन भी संकल्प में सुधार करने के लिए इस्तेमाल किया जा सकता है। conjugates एक संकरा और उच्च डीएनए शिखर (17-20 मिलीलीटर क्षालन मात्रा) से पहले प्रकट होता है कि एक व्यापक चोटी (लगभग 9-15 मिलीलीटर की क्षालन मात्रा) के रूप में eluted हैं। हम समाधान के भंडारण की सिफारिश नहीं हैअतिरिक्त एस 4FB-डीएनए के साथ conjugates के इस अतिरिक्त क्रियाशील डीएनए के साथ विकार पर एंटीबॉडी में प्रतिजन बाध्यकारी साइटों की हानि हो सकती है। सौदा conjugates का उपयोग कर सैंडविच ELISAs की संवेदनशीलता, विशिष्टता, और reproducibility पिछले अध्ययनों में प्रदर्शन किया गया है। 8,9,11,12,16 एंटीबॉडी डीएनए conjugates की गुणवत्ता का आकलन करने के लिए, conjugates उत्पन्न करने के लिए डीएनए सरणियों पर incubated किया जा सकता है बाद में प्रोटीन का पता लगाने (3F चित्रा) के लिए अंशांकन घटता उत्पन्न करने के लिए सैंडविच एलिसा प्रयोगों में इस्तेमाल किया जाता है, जो एंटीबॉडी सरणी,। इन अंशांकन घटता उत्पन्न करने के लिए, एक पारंपरिक सैंडविच एलिसा किट में प्रदान की पुनः संयोजक प्रोटीन का इस्तेमाल किया जा सकता है। उच्च गुणवत्ता वाले conjugates के उपयोग किट के उन लोगों के साथ तुलनीय रेखीय पर्वतमाला और पता लगाने की निचली सीमा को जन्म देना चाहिए। एक उदाहरण के रूप में, हमारे एंटीबॉडी सरणी पर सैंडविच एलिसा के लिए INFγ और TNFα के लिए कम सीमा (चित्रा 3F) ~ 50-100 स्नातकोत्तर / एमएल हैं, और Consisten हैंपारंपरिक सैंडविच एलिसा किट के लिए उत्पाद डेटा पत्रक में संकेत ~ 15-1,000 स्नातकोत्तर / एमएल के रैखिक पता लगाने रेंज के साथ टी। नीचे की ओर सैंडविच एलिसा प्रयोगों में प्राप्त गरीब संकेत readout के डीएनए सरणी, वैकल्पिक रूप साधना समाधान में अतिरिक्त डीएनए के हस्तक्षेप, या, एंटीबॉडी के साथ ssDNAs की अधूरी विकार के कम गुणवत्ता के लिए जिम्मेदार ठहराया जा सकता है।

एंटीबॉडी सरणी पर सैंडविच एलिसा प्रदर्शन करने के लिए बड़ी चिंता अभिकर्मकों के बीच और संकेत असली जैविक घटनाओं को दर्शाता है कि क्या पार बात शामिल हैं। हम इस प्रोटोकॉल में उपयोग ओर्थोगोनल DNAs अच्छी तरह से कम से कम 0.1% पार बात है करने के लिए मान्य किया गया है। इसलिए प्रतिरक्षा स्तर पर मनाया किसी भी पार बात एंटीबॉडी और एलिसा अभिकर्मकों से मुख्य रूप से है। सरणी में एंटीबॉडी के बीच परस्पर बात के लिए परीक्षण वास्तविक नमूने पर assays का आयोजन करने से पहले किया जाना चाहिए। एक एंटीबॉडी पैनल का निर्माण हो जाने के बाद, कुछ सैंडविच एलिसा नियंत्रण प्रयोगों perf होना चाहिएपता लगाने के एंटीबॉडी के बिना एंटीजन 1. बिना, 2., और 3. जांच एंटीबॉडी और लेबलिंग अभिकर्मकों केवल: निम्न शर्तों के साथ ormed। पार बात प्रतिरक्षा स्तर पर मनाया जाता है, एंटीबॉडी जोड़े और / या एलिसा अभिकर्मकों प्रतिस्थापित किया जाना चाहिए। यह पारंपरिक एलिसा किट से व्यावसायिक रूप से उपलब्ध एंटीबॉडी का उपयोग सरणी आधारित सैंडविच एलिसा तकनीक के लिए प्रयोज्यता की गारंटी नहीं है कि ध्यान दिया जाना चाहिए।

इस प्रौद्योगिकी की खूबियों सस्ती विनिर्माण, लघु आकार और डिजाइन के लचीलेपन में शामिल हैं। हमारे निर्माण प्रोटोकॉल एंटीबॉडी के कई उपयोगकर्ताओं के लिए उपलब्ध नहीं हो सकता है कि एक माइक्रोएरे निशानदेही की जरूरत नहीं है। प्रवाह patterning के सेट-अप आसानी से सरल प्रयोगशालाओं में इकट्ठा किया जा सकता है। फोटोलिथोग्राफी के लिए उपकरणों के साथ सुसज्जित नहीं कर रहे हैं कि प्रयोगशालाओं के लिए, हमारे प्रोटोकॉल में हम प्रदान सीएडी डिजाइन microfabrication सेवाओं की पेशकश है कि कंपनियों के लिए भेजा जा सकता है। पारंपरिक माइक्रोएरे में आकार घटानेहमारे प्रोटोकॉल के साथ निर्मित कॉम्पैक्ट सरणी एकल कोशिका प्रयोगों में इस्तेमाल माइक्रोचिप्स के साथ संगतता के लिए अनुमति देता है। हमारी प्रोटोकॉल पहले एक एंटीबॉडी सरणी के लिए रूपांतरण से पहले एक ssDNA सरणी के रूप में सरणी के उत्पादन की सुविधा है। SsDNAs के साथ प्रारंभिक patterning के लाभ के एक नंबर है। सबसे पहले, ssDNAs इस प्रकार ssDNA नमूनों स्लाइड महत्वपूर्ण गिरावट 8,16 बिना कम से कम 6 महीने के लिए एक desiccator में संग्रहित किया जा सकता, एंटीबॉडी की तुलना में रासायनिक अधिक स्थिर हैं। दूसरा, हमारे दृष्टिकोण का अंत उपयोगकर्ता केवल माइक्रोएरे के संशोधन के बिना एक समाधान में एक साथ चयनात्मक conjugates मिश्रण द्वारा की जरूरत assays, का चयन करने के लिए लचीलापन प्रदान करता है; इसके विपरीत, पारंपरिक प्रोटीन / एंटीबॉडी पूर्व डिजाइन और एक सब्सट्रेट पर तय कर रहे हैं, इसलिए assays के परिवर्तन शुरू से ही प्रोटीन / एंटीबॉडी की patterning / मुद्रण की आवश्यकता होगी। प्रतिनिधि अध्ययनों उच्च throughput में बारकोड एंटीबॉडी माइक्रोएरे के उपयोग का वर्णन detectioएकल कक्षों से कई संकेत प्रोटीन की एन। प्रवाह पैटर्न डिजाइन और / या इस्तेमाल oligonucleotide patterning के समाधान अलग करके, सरणी लेआउट के एक भीड़ का पता लगाया जा सकता है। इस आवेदन का एक उदाहरण के रूप में, एकल कक्षों से कार्यात्मक प्रोटीन का अध्ययन किया जा सकता है। एकल कोशिका विश्लेषण के लिए चिप ~ 8,700 microchambers, एक पूर्ण 3 एक्स 3 एंटीबॉडी सरणी (चित्रा 3H) के साथ गठबंधन प्रत्येक के रूप में कई शामिल हैं। इस तरह के एक सेट अप उच्च throughput का पता लगाने के लिए अनुमति देता है। Microchambers में संवर्धित कोशिकाओं द्वारा स्रावित प्रोटीन इस सरणी से पता लगाया जा सकता है। बहुमुखी माइक्रोएरे डिजाइन भी अन्य सामान्य घटकों 8,15 साथ माइक्रोएरे संयोजन के बाद सीरम, सेल lysates, और एकल कक्षों से प्रोटीन की मल्टिप्लेक्स पता लगाने के लिए अनुमति देता है। प्रोटीन का पता लगाने के अलावा, 3 एक्स 3 एंटीबॉडी सरणी भी कब्जा कोशिकाओं (चित्रा 3 जी) में उपयोगी है।

इस दृष्टिकोण के मुख्य नुकसान अपनी जोड़ा compl हैपारंपरिक प्रोटीन के निर्माण के साथ तुलना में exity। गढ़े सरणी के विशिष्ट अनुप्रयोगों पर विचार करते समय patterning के लिए और सरणी डिजाइन के लिए रणनीतियाँ ध्यान अवधारणा किया जाना चाहिए। यह दृष्टिकोण भी पार बात के लिए सत्यापन प्रक्रिया और परीक्षण सहित महत्वपूर्ण कदम के एक नंबर की आवश्यकता है। 3 एक्स 3 सरणी हमारे प्रोटोकॉल का उपयोग एक समय में 7 प्रोटीन का पता लगाने के लिए सीमित है का निर्माण किया। बहरहाल, इस सीमा बड़े विन्यास बनाने से ही पार किया जा सकता है। यहाँ विशेष रुप से प्रोटोकॉल 3 एक्स 3 प्रोटीन का निर्माण करने के लिए सीमित नहीं है। हम सफलतापूर्वक 5 एक्स 5 प्रोटीन और सरणी तत्वों के अन्य आयामों के निर्माण करने में सक्षम है। सिद्धांत रूप में, अन्य एन एक्स एम सरणियों के रूप में लंबे समय तक प्रारंभिक डीएनए नमूनों सरणी बनाने में प्रयोग किया जाता oligonucleotide सेट सरणी तत्वों के बीच परस्पर बात से बचने के लिए orthogonal रहे हैं के रूप में इसी तरह की तकनीक का उपयोग कर निर्मित किया जा सकता है। विस्तार किया सरणियों का निर्माण प्रवाह patterni द्वारा हासिल की हैएनजी एन ssDNA के प्रकार दूसरे patterning के कदम के लिए ssDNA दृश्यों को पाटने एन एक्स एम द्वारा पीछा पहले डीएनए patterning कदम है, के लिए एंकर। ब्रिजिंग दृश्यों A'-मैं E'-XXV करने के लिए उपयोग किया जाता है, जबकि उदाहरण के लिए, एक 5 एक्स 5 सरणी बनाने के लिए, ई करने के लिए लंगर दृश्यों एक का उपयोग किया जा सकता है। यह केवल एक ही डीएनए प्रवाह patterning के कदम का उपयोग किया गया है, हालांकि प्रवाह patterning प्रक्रिया को स्वचालित करने के लिए, एक रोबोटिक्स मंच 18 विकसित किया गया है। दो चरणों के बीच स्विचिंग पहले patterning के कदम के बाद पहली PDMS मोल्ड बंद छीलने मैन्युअल की आवश्यकता हो सकती है, जबकि सिद्धांत रूप में, एक ही मंच होगा धोने से पीछा किया और स्लाइड (इस कदम सुखाने, सीधा प्रवाह patterning के दूसरे चरण के लिए बढ़ाया जा सकता है लंबरूप उन्मुख दूसरी patterning के कदम की सुविधा के लिए एक और PDMS मोल्ड के साथ स्लाइड संभोग से पहले,) के बारे में 10 मिनट लेते हैं।

हम नमूनों एक nxm सरणी fabricating के लिए विस्तृत प्रक्रिया पर चर्चा की हैप्रोटिओमिक अध्ययन और संकेतन सेल में भविष्य के अनुप्रयोगों के लिए महान वादा रखती है जो उच्च घनत्व, पर एंटीबॉडी के साथ। यहाँ प्रस्तुत प्रोटोकॉल भी अन्य प्रयोजनों के लिए और अधिक व्यापक डीएनए / एंटीबॉडी के निर्माण के लिए एक गाइड के रूप में सेवा कर सकते हैं।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics