ייצור מודרך זרימת דפוס בצפיפות גבוהה ברקוד נוגדן Microarray

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

פרוטוקול זה מתאר את הייצור של בקנה מידה גדול, מערך ה- DNA או נוגדן דו ממדים מרובב, עם יישומים פוטנציאליים במחקרי איתות תא וזיהוי סמנים ביולוגיים.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

microarrays הנוגדן היה בשימוש נרחב במחקרי proteomic במשך עשרות שנים כדי לבחון את נוכחותם של חלבונים ממוקדים, כוללים סמנים ביולוגיים חלבון 1-3. למרות שתחום זה ניצבת כיום בפני אתגרים גדולים מטכנולוגיות תפוקה גבוהה אחרות כגון ספקטרוסקופיית מסות (MS), יש עדיין הרבה מקום לשירות של microarrays נוגדנים, בעיקר משום שמכשירים אלה להרשות לעצמם נתונים לפרשנות פשוטה וממשק קל עם מבחני אחרים. בשנים האחרונות, שילוב של microarrays לפיגומי שבב סיפק microarray נוגדן הזדמנות חדשה לשגשג 4-7. לדוגמא, microarray ברקוד המשולב בשבב תא בודד בו נעשה שימוש במחקרי תקשורת סלולארי 8,9. טכנולוגיה זו יש יתרונות ייחודיים על פני טכנולוגיות microarray זמינות אחרות. הוא כולל אלמנטים במערך ב10-100 מיקרומטר, קטן בהרבה מהגודל הטיפוסי 150 מיקרומטר משמש בelemen microarray הקונבנציונליTS. הבנייה של אלמנטים במערך קטנים יותר מושגת באמצעות גישות זרימת דפוסים שיטתיות, וזה מעורר microarrays הקומפקטי שיכול לזהות חלבוני תא בודד מופרשים וחלבונים תאיים. יתרון נוסף הוא השימוש בהתקנה פשוטה, ללא מכשיר. הדבר חשוב במיוחד, משום שרוב המעבדות וחברות קטנות לא יכולים להיות מסוגלות לגשת למתקני גרעין microarray. microarrays הנוגדן ברקוד כגון תכונה משופרת תפוקת assay וניתן להשתמש בו כדי לבצע מבחני מרובבים מאוד על תאים בודדים תוך השגת רגישות גבוהה וספציפיות דומה לזו של assay immunosorbent כריך אנזים צמוד הקונבנציונלי (ELISA 8). טכנולוגיה זו מצאה יישומים רבים באיתור חלבונים מגליובלסטומה 9-11, תאי T 12, ומחזור התאים סרטניים 13. לחלופין, מערכי DNA ברקוד לבד כבר נוצלו במיקום המדויק של תאי עצב והאסטרוציטים ללחקותing ההרכבה vivo של רקמת מוח 14.

פרוטוקול זה מתמקד רק בשלבי הניסוי ולוקי הצטברות של microarray הנוגדן ברקוד דו-ממדי (2-D) שבה יש יישומים פוטנציאליים בזיהוי של סמנים ביולוגיים בדגימות fluidic ובתאים בודדים. הטכנולוגיה מבוססת על microarray דנ"א חד-גדילים, חד-ממדי (1-D) מיעון נבנה באמצעות oligonucleotides מאונך שהם בדוגמת מרחבית על מצעי זכוכית. דפוס 1-D נוצר כאשר זרימת ערוצים מקבילים המשמשים בשלב זרימת הדפוסים, ודפוס כזה מופיע כלהקות דיסקרטיות חזותי דומות ל1-D Universal Product Code (UPC) ברקודים. בניית מערך נוגדן 2-D (מ 'x n) - מזכירה קוד מטריקס 2-D מהיר התגובה (QR) - צריכה אסטרטגיות דפוסים מורכבות יותר, אך מאפשרת לקיבוע של נוגדנים בצפיפות גבוהה 8,15. הייצורדורש שני שלבי דפוסי DNA, עם הדפוס הראשון בניצב לשני. נקודות חיתוך של שני דפוסים אלה מהווים את המרכיבים מ 'x n של המערך. על ידי בחירה אסטרטגית הרצפים של DNA חד-גדילים (ssDNA) מנוצל בזרימת דפוסים, כל אלמנט במערך נתון מוקצה כתובת ספציפית. התייחסות מרחבית זה הכרחי בהבחנה בין אותות הקרינה בשקופית microarray. מערך ssDNA מומר מערך נוגדן דרך ההתאגדות של conjugates DNA-נוגדן המשלים, ויצר פלטפורמה שנקראת ספריית נוגדן בקידוד ה- DNA (DEAL 16).

פרוטוקול וידאו זה מתאר את השלבים העיקריים ביצירת מערכי nxm נוגדן הכוללים הכנת polydimethylsiloxane (PDMS) תבניות ברקוד, זרימת דפוסים ssDNA בשני כיוונים, הכנת conjugates DEAL הנוגדן-oligonucleotide, והמרת מערך 3 x 3 DNA ל3x 3 מערך נוגדנים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

זהירות: כימיקלים כמה שימוש בפרוטוקול זה הם מגרים ומסוכנים במקרה של מגע עם עור. התייעץ עם גיליונות נתוני בטיחות חומרים (MSDS) וללבוש ציוד מגן אישי מתאים לפני ביצוע פרוטוקול זה. פתרון Piranha משמש בשלב (1.1.1) הוא מאכל מאוד וצריך להיות מוכן על ידי הוספת חמצן לאט לחומצה עם תסיסה. ידית פתרון זה בזהירות רבה במנדף. השתמש בהגנה על העין מתאימה וכפפות עמידות חומצה. Trimethylchlorosilane (TMCS) הוא חומר כימי מאכל, דליק המשמש בשלב אופציונאלי אחרי (1.1.6). ידית כימית זה במנדף.

הערה: בצע את ייצור השקופיות ברקוד ונהלי זרימת דפוסים קריטיים בחדר נקי כדי למזער זיהום על ידי חומר חלקיקים. חלקיקי אבק עלולים לחסום את היציאות וmicrochannels של תבניות PDMS ולהפריע לזרימת דפוסים.

1. בנייה-dimensiona אחתשקופיות l DNA ברקוד

  1. הכנת המאסטר SU-8 לזרימה ברקוד דפוסים
    הערה: הציורים לתבניות זרימה בניצב (איור 1 א-B) נוצרים באמצעות תוכנה בעזרת מחשב עיצוב (CAD). דפוסים אלו ניתנות על photomask כרום. אזורים שקופים של המסיכה מתאימות לתכונות של המאסטר SU-8.
    1. נקה פרוסות סיליקון (100 מ"מ קוטר) ביסודיות בתערובת של 3 H 2 SO 4: 30% 2 O 2 (פתרון פיראניה) H 1 מחומם ל- 96 מעלות צלזיוס. לשטוף את הרקיק עם מים ללא יונים ואלכוהול איזופרופיל, ואחריו על ידי ייבוש עם אקדח מכת חנקן.
    2. יוצקים על 4 מיליליטר של photoresist SU-8 2,025 על פרוסות סיליקון. השתמש בcoater ספין לתכנות כדי להפיץ באופן אחיד על photoresist הרקיק במשך 10 שניות ב 500 סל"ד, אז 30 שניות בסל"ד 3000. זה יוצר שכבת photoresist בעובי של ~ 25 מיקרומטר. בהדרגה לאפשר מסתובב להאט לפני העצירה - זה למאיntain אפילו ציפוי על פני השטח של פרוסות סיליקון.
    3. אופים את פרוסות מצופים על פלטה חמה דקות 1 על 65 מעלות צלזיוס, אז במשך 5 דקות על 95 מעלות צלזיוס. צעד זה מאפשר לציפוי כדי לחזק. מגניב RT במשך 5 דקות.
    4. מניחים את מסכת הכרום (איור 1 ג) על מעיל photoresist. לחשוף את תכונות המסכה ליד-אור UV (350-400 ננומטר, אנרגיית חשיפה 150-160 mJ / 2 סנטימטר) במשך 20 שניות.
      הערה: העיצוב על מסכת הכרום מכיל 20 ערוצים, כל אחד מהם הם 20 מיקרומטר רחבים עם 50 מיקרומטר המגרש. הערוצים מתפתלים מקצה אחד של התבנית לקצה השני. בסך הכל, 20 הערוצים לכסות שטח מלבני באורך של 40 מ"מ ~ ורוחב של ~ 20 מ"מ. כל ערוץ מוקף שתי תכונות מעגליות שמתאימות לכניסה ויציאה. פתחי הכניסה ושקעים ניתנים להחלפה.
    5. אופים את פרוסות נחשפו על פלטה חמה למשך 5 דקות על 95 מעלות צלזיוס. מגניב RT בהדרגה.
    6. לטבול את פרוסות במפתח SU-8 עם תסיסהבמשך 5 דקות. לשטוף את הרקיק עם חלק קטן של מפתחי SU-8 טריים, ואחריו אלכוהול איזופרופיל. ייבש את הרקיק באמצעות אקדח מכת חנקן. קשה לאפות את הרקיק על פלטה חמה C ° 200 למשך 30 דקות, ולאפשר הרקיק להתקרר בהדרגה לRT.
      הערה: פיתוח יכול להתבצע במשך זמן ארוך יותר אם סרט לבן הוא ציין לאחר השטיפה בשלב זה.
      אופציונאלי: Silanize המאסטר SU-8 על ידי חשיפתו לtrimethylchlorosilane אדים בצלחת פטרי סגורה במשך 10 דקות.
  2. הכנה של העובש ברקוד PDMS
    1. לשלב בסיס אלסטומר סיליקון 40.0 g עם סוכן ריפוי 4.0 גר '. מערבבים את תערובת prepolymer מרץ במשך 10 דקות. דגה במשך 20 דקות תחת ואקום.
      הערה: ככלל, שימוש 10: 1 (בסיס: סוכן ריפוי) יחס המוני.
    2. יוצקים את prepolymer לתוך צלחת פטרי המכילה פרוסות סיליקון עם המאסטר SU-8 של הדפוס ברקוד. הגובה של תערובת PDMS צריך להיות על 7.5 מ"מ ומעלה. דגה התערובת בפטראני צלחת בפעם שנייה כדי להסיר בועות שנותרו, ואז לאפות את התערובת למשך שעה 1 על 75 מעלות צלזיוס, כדי לאפשר PDMS לרפא.
      הערה: חשוב לשמור על מספיק עובי של לוח PDMS ב ~ 7.5 מ"מ ומעלה, כדי למנוע הוספה יותר מדי מתח לאג"ח PDMS הזכוכית על החדרת סיכות / צינורות דרך חורים בעובש PDMS בצעד (1.3.3.1)
    3. באמצעות אזמל, לחתוך בזהירות מסביב לאזור של לוח PDMS המכיל את תכונות העובש ברקוד ולקלף את הלוח מהרקיק.
    4. חתוך את הקצוות של הלוח כדי להשיג את הצורה הרצויה של העובש ברקוד PDMS. אגרוף 20 חורים (בקוטר 1.0 מ"מ) דרך העובש באמצעות אגרוף ביופסיה עם בוכנה. ודא כי החורים מיושרים עם התכונות מעגליות של הדפוס ברקוד. חורים אלה ישמשו פתחי הכניסה ושקעים.
  3. דפוסים חד-ממדיים של פולי-L ליזין (PLL)
    1. הסר את כל אבק על פני השטח של שקופיות זכוכית מצופה פולי-L ליזין באמצעות אקדח מכת חנקן. ATTACh עובש PDMS לשקופית הזכוכית נקייה. ודא שהקצוות של העובש והשקופיות מיושרים.
    2. אופים במשך 1.5 שעות על 75 מעלות צלזיוס לחזק את הקשר בין עובש PDMS ואת השקופיות מצופות PLL. בינתיים, להכין 20 חתיכות של צינורות פוליאתילן גמישים (3 לחתיכות 4 אינץ ', עם קוטר פנימי של 0.5 מ"מ וקוטר חיצוני של 1.5 מ"מ).
      הערה: מספר החתיכות של צינורות מתאים למספר פתחי הכניסה בעובש ברקוד PDMS. צינורות משמש לזוג הערוצים בעובש ברקוד PDMS למכל גז חנקן מצויד בוסת לחץ.
    3. בקצה אחד של כל חתיכה של צינורות, לצרף סיכה חלולה נירוסטה (קוטר 1 מ"מ). לשאוב פולי-L ליזין פתרון באמצעות הסיכה, לפחות עד 1 סנטימטר של הצינור מלא בפתרון-מסונן סטרילי.
      1. להדק את הסיכות (מחוברות לצינורות מלא פתרון) לפתחי הכניסה של העובש ברקוד PDMS (איור 1E). חבר את הקצה השני של הצינורות להגדרת טנק מוסדר לחץ חנקן. אפשר הפתרון לזרום דרך העובש באמצעות מגוון לחץ של 0.5-1 psi במשך לפחות 6 שעות.
        הערה: עיין בצעד (1.3.3) לכל נהלי זרימת הדפוסים.
  4. דפוסים חד-ממדיים של 14 ssDNA
    הערה: בופר פוספט (PBS) בשימוש בשלבים הבאים מוכן מ137 מ"מ NaCl, 10 מ"מ Na 2 4 HPO, ו -2 מ"מ KH 2 PO 4. pH של החיץ הוא 7.4.
    1. הכן 2 פתרון מ"מ BIS (sulfosuccinimidyl) suberate (BS3) ב- PBS. הכן 300 מיקרומטר פתרונות של A, B, ו- C ssDNA (5'-אמין שונה, 80 נוקלאוטידים) בPBS או מים ultrapure.
      הערה: השתמש בפתרון BS3 בתוך כ -30 דקות לאחר הכנה, כי אסתר -hydroxysuccinimide N בקלות עוברת הידרוליזה.
    2. שלב 2.5 μl של 300 מיקרומטר, B, או C ssDNA עם 2.5 μl של 2 bis מ"מ (sulfosuccinimsuberate אִידִילִיָה) ב PBS לכל ערוץ. A, B, ו- C DNA מיועד לערוצי 1, 2, ו -3, בהתאמה. הסדר זה ​​חל גם על קבוצות הנותרות של 3 ערוצים (איור 2 א).
    3. צעד לבצע (1.3.3). הפעם, לשאוב את פתרונות BS3 / DNA 5-μl באמצעות סיכות נירוסטה ולתוך צינורות פוליאתילן, אז כמה העובש PDMS למקור החנקן. אפשר פתרון BS3 / DNA לזרום דרך העובש ברקוד לכ -40 דקות או עד שהערוצים מלאים.
    4. עצור את הזרימה פעם כל הערוצים מלאים, אז דגירה פתרון BS3 / DNA ברקוד ב RT עבור שעה 2. אל תאפשר הפתרון להתייבש. אופים את עובש PDMS עם שקופיות ברקוד מצורפים לשעה 1 על 75 מעלות צלזיוס.
      הערה: כדי להקל על יישור בצעדי זרימת דפוסים שלאחר מכן, בשולי תבנית הערוץ בשקופית ברקוד יכולים להיות מתוארים. הדבר נעשה על ידי מגרד בזהירות את משטח הזכוכית באמצעות scrib יהלומיםדואר כדי ליצור סמני יישור בתחתית שקופיות הזכוכית. יישור בשלבים מאוחר יותר של הפרוטוקול ניתן לבדוק תחת מיקרוסקופ.
    5. להסיר את תבנית PDMS מהשקופיות ברקוד. לשטוף את השקופית בעדינות עם 0.01% SDS פעמים פעם אחת ושלוש עם מים ultrapure.
      1. ייבש את השקופית ברקוד באמצעות טווה שקופיות מיקרוסקופ. אחסן את השקופיות ברקוד בצינור צנטריפוגות 50 מ"ל נקי לשימוש הבא.

2. אימות של התבנית חד-ממדית על השקופיות ברקוד

הערה: פרוטוקול אימות זה גם יכול להיות מותאם לשימוש בהערכת האיכות של צעדי זרימת דפוסים שלאחר מכן.

  1. חסימה של השקופית
    1. הכן 1% אלבומין בסרום שור (BSA) ב- PBS. סנן את הפתרון הזה באמצעות מסנן מזרק 0.45 מיקרומטר לפני השימוש. שימוש בטיפ ג'ל טעינה, תחול 50 μl של 1% פתרון BSA לקצה אחד של השקופית ברקוד.
    2. דגירה solut BSA 1%יון עבור שעה 1 ב RT.
  2. דגירה עם Cyanine 3 (Cy3) -conjugated DNA משלים
    1. הכן קוקטייל של ', ב', וoligonucleotides 'C מצומדת לCy3 בקצה אחד. הרצפים של ', ב', ו-ג 'הם משלימים לאלה של A, B, ו- C, בהתאמה. ריכוז העבודה של Cy3-DNA הוא 0.05 מיקרומטר בBSA 0.1%.
    2. הסר את פתרון BSA מהשקופיות על ידי pipetting, ולאחר מכן להחיל 30 μl של פתרון ה- DNA הקוקטייל באותו הקצה של השקופית. דגירה קוקטייל Cy3-DNA בשקופית ב RT עבור שעה 1. לבצע שלב דגירה זה בחושך כדי להגן על מחצית Cy3 מphotobleaching.
  3. ניתוח של עוצמת הקרינה
    1. פיפטה את קוקטייל Cy3-DNA ולשטוף את השקופית בBSA 1%, PBS, ולבסוף בPBS המדולל (עמ '1אמנות PBS עם מים ultrapure 50 חלקים). ייבש את השקופית באמצעות טווה.
    2. שים לב לקרינה (איור 2) באמצעות מיקרוסקופ פלואורסצנטי או סורק microarray. בעת שימוש בסורק microarray, להגדיר את אורך גל פליטת לייזר ל532 ננומטר, גודל פיקסל בשעת 5 מיקרון, צינור מכפיל רווח (PMT) ב450 וכוח ב 15%.

3. ייצור של מערך 2 ממדי DNA (3x3) 14

  1. הכנה של העובש ברקוד PDMS
    1. בצע נוהל (1.1) לבנות המאסטר SU-8 נוסף, אבל הפעם להשתמש מסכת כרום עם תבנית זרימה בניצב לזה של העיצוב הראשון. בצע נוהל (1.2) לבנות עובש PDMS חדש עם הדפוס בניצב.
  2. זרימת דפוסים דו-ממדיים של ssDNA
    1. למערך 3 x 3, להכין 150 מיקרומטר פתרונות מניות של A'-i, B'-II, III-C', A'-IV, B'-V, C'-VI, A'-ז, ב '"ה- DNA -viii, וC'-ט ב 3% BSA / PBS. oligonucleotides אלו משמש כ" רצפי גישור "(איור 2 א). לשלב את פתרונות oligonucleotide (פתרונות 1 עד 3) באופן שריכוז העבודה הוא 50 מיקרומטר לכל oligonucleotide. השתמש במדריך האמור בטבלה 1.
    2. לזרום BSA 3% / פתרון חסימת PBS לכל 20 ערוצים לשעה 1 ב0.5-1 psi.
    3. פתרונות זרימה 1, 2, ו -3 לערוצים 1, 2, ו -3, בהתאמה. עקוב צו זה לסטים הבאים של 3 ערוצים. הזרימה היא בדרך כלל סיימה בכ -40 דקות. דגירה פתרונות DNA ב RT עבור שעה 2 כדי לאפשר את ה- DNA ללהכליא.
    4. לזרום BSA 3% / פתרון חסימת PBS לכל 20 ערוצים לשעה 1 ב0.5-1 psi להסיר DNA unhybridized. קלפתי את לוח PDMS, ולשטוף את שקופית microarray DNA וכתוצאה מכך על ידי טבילת שקופיות הזכוכית לתוך 3 BSA% / PBS אחת וPBS פעמיים, ואחריו PBS המדולל (חלק 1 מים ultrapure PBS ו -50 חלקים). Dר"י השקופית באמצעות טווה שקופיות מיקרוסקופ.
    5. לבצע צעד שני אימות (איור 2 ג) דומה לזה בסעיף 2. oligonucleotides השתמש i 'עד IX "כי הם מצומדת-Cy3. אחסן את שקופיות מערך 3 x 3 בצינור צנטריפוגות 50 מ"ל לשימוש הבא.
      הערה: microarray DNA יכול להיות מאוחסן ב RT בייבוש במשך חודשים.

4. המרה של מערך ה- DNA 3 x 3 למערך נוגדן

  1. הכנת נוגדן-oligonucleotide conjugates (עסקה)
    1. הכן את הפתרונות של 200 succinimidyl-4-formylbenzoate מ"מ (S-4FB) ו -40 מ"מ succinimidyl-6-hydrazinonicotinamide (S-HyNic) בN נטול מים, -dimethylformamide N (DMF).
    2. הכן עד 7 פתרונות נפרדים של נוגדני לכידה (1 מ"ג / מיליליטר) ב- PBS.
      הערה: אם פתרונות מניות הנוגדן מכילים bacteriostat אזיד הנתרן, לבצע חילופי חיץ עם PBS באמצעות desalting ספין גolumns עם 7 kDa חתוך משקל מולקולרי (MWCO).
    3. הכן 400 מיקרומטר פתרונות נפרדים של i ', השני', ג ', ד', נ ', vi', ו- DNA 'ז. להקצות לכל נוגדן ללכוד רצף oligonucleotide אחד. לשלב 40 μl של 400 מיקרומטר DNA עם 12.25 μl של DMF בצינורות microcentrifuge ספין למטה ולמערבב היטב.
      1. לכל פתרון ה- DNA / DMF, להוסיף 2.3 μl של 200 מ"מ S-4FB בDMF. על כל 100 מיקרוגרם של נוגדן ללכוד, להוסיף 2.25 μl של 40 מ"מ S-HyNic בDMF.
    4. דגירה הנוגדן / פתרונות S-HyNic וDNA / S-4FB במשך 4 שעות ב RT.
    5. כהכנה לתגובת צימוד הנוגדן-DNA, להכין עמודות חדשות desalting הספין (אחד לכל פתרון ה- DNA ואחד לכל נוגדן) על ידי שטיפתם עם חיץ ציטראט ב- pH 6.
    6. לאחר 4 שעות של דגירה, לבצע חילופי חיץ לכל נוגדן / S-HyNic ופתרון ה- DNA / S-4FB. מערבבים את S-4FB מצומדות- 'vii עם conjugates הנוגדן-S-HyNic. דגירה התערובות לשעה 2 ב RT.
    7. דגירה C ° O תגובה / N ב 4.
  2. טיהור של נוגדן-oligonucleotide conjugates (עסקה)
    הערה: כדי לטהר את conjugates הנוגדן-oligonucleotide, לבצע כרומטוגרפיה נוזלית חלבון מהיר (FPLC) במערכת FPLC סטנדרטית מצוידות בעמודת GL Superose 6 10/300.
    1. קבע את אורך הגל של גלאי UV של מערכת FPLC 280 ננומטר. השתמש בזרימת isocratic של PBS (pH 7.4) בשעת 0.3 מיליליטר / דקה להפריד conjugates הנוגדן-oligonucleotide מS-4FB-DNA העודף.
    2. בריכת השברים המכילים המצומד ולהתרכז השברים בהיקף של 150 μl באמצעות מסנני ספין עם kDa MWCO 10.
  3. דפוסים דו-ממדיים של נוגדנים
    1. הכן עובש PDMS אחר עם microchambers או מיקרו-בארותינונהלי ing ייצור בשלב (1.2). עובש PDMS עשוי להכיל microliter לבארות nanoliter לimmunoassays.
      הערה: זיהוי סמנים ביולוגיים כללי בדגימות fluidic, עובש PDMS עם בארות מרובות הזדווגו עם שקופית המערך. התכונות של עובש PDMS תלוי בנלמדות במערכת. לדוגמא, זיהוי של חלבונים מניסויי תא בודדים יכול להתבצע עם עובש PDMS המכיל microchambers עם כרכי 0.15-NL.
    2. (אופציונאלי) נושא העובש PDMS לפלזמת ניקוי (18 W) תמורת 1.5 דקות כדי להבהיר הידרופילי פני השטח בדוגמתה. לפני ניקוי פלזמה, להשתמש דבק כדי לחסום את כל משטחים האחרים שיהיה מלוכד ישירות לשקופית המערך 3 x 3.
      הערה: שלב (4.3.2) היא אופציונלית, אך בדרך כלל מבוצעת כאשר עובש PDMS מיועד לשימוש בניסויי תא בודדים.
    3. Mate עובש PDMS עם שקופית מערך 3 x 3, אז לחסום את השקופית עם BSA 1% ב- PBS. דגירה עבור שעה 1 ב RT. Meanwhile, להכין קוקטייל (200 נפח סופי μl) של conjugates נוגדן-oligonucleotide. ריכוז העבודה של כל המצומד הוא 10 מיקרוגרם / מיליליטר בBSA% 1 / PBS.
    4. הוסף את קוקטייל נוגדנים oligonucleotide, אז דגירה עבור שעה 1 ב 37 ° C כדי לאפשר מחצית oligonucleotide של conjugates להכליא עם כתמים ספציפיים על 3 x 3 מערכים, ובכך להמיר את מערך ה- DNA למערך נוגדנים.
    5. חזור על שלב (3.2.4) כדי לנקות ולייבש את השקופית. הרגישות הגבוהה ביותר ניתן להשיג אם מערך הנוגדן משמש באופן מיידי. אחסון ממושך עלול לגרום לאובדן של רגישות.
  4. זיהוי של חלבונים
    1. מחדש חלבונים רקומביננטיים או להכין מדגם תא מסונן.
    2. Mate microarray עם שבב אישי מעוצב, ולחסום את פני השטח עם ארגון ה- BSA 3% ב PBS עבור שעה 1. ואז להסיר את פתרון BSA, ולהחיל דגימות דגירה עבור שעה 2.
    3. פעמים לשטוף את הדגימות באמצעות BSA 3% ב PBS שלוש,d ולאחר מכן להוסיף נוגדני זיהוי בריכוז הניתן על ידי גליון הנתונים של המוצר. דגירה עבור שעה 2.
    4. לשטוף את נוגדני זיהוי על ידי ארגון ה- BSA 3% ב- PBS שלוש פעמים, ולאחר מכן להוסיף Cyanine 5 (Cy5) -streptavidin ב 1 מיליליטר מיקרוגרם /, ואחריו דגירה עבור שעה 1.
    5. חזור על שלב (3.2.4) כדי לנקות ולייבש את השקופיות לסריקה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

העיצובים לתבניות PDMS (איור 1 א-1B) נערך באמצעות תכנית CAD (AutoCAD). שני עיצובים לראות ערוצי תכונה לזרימת דפוסים, אחד אופקי ואחד אנכי. חלקי ימין ועל השמאל של כל עיצוב הם סימטריים; כל אחד מהם יכול להיות פתחי הכניסה או שקעים. כל אחד מערוצים 20 הוא מתפתל מקצה אחד כל הדרך לקצה השני. כל עיצוב מודפס על photomask כרום (איור 1 ג). המאסטר SU-8 המפוברק על רקיק מוצג באיור 1D. כדי להקל על זרימת הדפוסים של PLL או DNA, עובש PDMS היה מצמידים את הגדרת זרימת גז חנקן (איור 1E).

ישנם שלושה שלבי זרימת דפוסי שימוש בפרוטוקול זה. הצעד הראשון שמגביל PLL על מצע הזכוכית, ואילו הצעדים להצליח גם להציג את פתרונות oligonucleotide. בטבלה 1, oligonucleיצירות otide של פתרונות 1-3 מקבלות. ריכוז העבודה של כל oligonucleotide הוא 50 מיקרומטר והנפח הכולל של כל פתרון הוא 39 μl. פתרונות אלה הוכנו על ידי שילוב של 13 μl של כל פתרון מניות oligonucleotide (150 מיקרומטר).

יחידות microarray DNA בדוגמתם חוזר על עצמו וסמוכים על פני כל שקופית הזכוכית. במשך 3 x 3 microarrays, הצפיפות המרבית היא כ 400,000 נקודות בשקופית כוס אחת. השוואת Side-by-side עם microarray DNA המסחרי מגלה כי הטכנולוגיה שלנו היא בערך 5 פעמים רגישה יותר כאשר מחייבים Cy3 מתויג DNAs המשלים. DNAs הדוגמת יחסית אחיד עם וריאציה ~ 5% על פני מספר רב של חזרות. תכונות אלה מבטיחות את יכולת הכימות הגבוהה של הטכנולוגיה שלנו בעת מדידת תכולת חלבון מדגימות ביולוגיות. בנוסף, orthogonality של DNAs בשילוב עם עיצוב ערוץ הזרימה להציע flexibility של דפוסים במגוון רחב של גיאומטריות (איור 2 ד).

לאחר המרת מערך ה- DNA לתוך מערך נוגדן דרך הכלאה עם conjugates DNA-נוגדן (איור 3), פנל נוגדנים וכתוצאה מכך נמצא בשימוש בזיהוי מרובב, בעיקר באמצעות פלטפורמת ELISA כריך כפי שמוצג באיור 3 ג. בכריך ELISA, זיהוי נוגדני biotinylated (משניים) להתחבר לחלבונים שנתפסו, והתיוג הבא עם streptavidin fluorophore מצומדות מאפשר זיהוי הקרינה מבוססת (איור 3 ג-ה). איתור של מופעי חלבונים <וריאציה 10% מקצה אחד לקצה השני של שקופיות הזכוכית (איור 3D). עם מערך 3 x 3, אנו מסוגלים לזהות עד 7 חלבונים, תוך הקצאת אלמנט מערך אחד כהתייחסות (Cy3 שכותרת) ואלמנט נוסף כביקורת שלילית. לדוגמא, בניסוי תא בודד שבוצע למחקרי גידול, החלבונים interleukin-6 (IL-6), metallopeptidase המטריצה ​​9 (MMP9), גורם גדילת hepatocyte (HGF), גורם גדילה של אנדותל כלי דם (VEGF), interleukin-8 גורם (IL-8), ומעכב הגירת מקרופאג (MIF) מתא בודד יכול להיות מזוהה בו זמנית (איור 3E).

כמו כן, אנו מכוילים למערכת באמצעות חלבונים רקומביננטי בריכוזים שונים. באיור 3F, עקומות כיול לאינטרפרון-γ חלבונים רקומביננטיים (IFN-γ), α גורם נמק גידול (α TNF), (13-IL), β גורם נמק גידול (β TNF), granzyme B, אינטרלוקין interleukin-13 -4 (IL-4), וinterleukin-8 (IL-8) מוצגים. הרגישות של זיהוי היא די דומה לזה של ELISA כריך הקונבנציונלי על צלחות היטב גם עם טעינה גבוהה יותר של נוגדני DNAs ואולי על המצע.

Antibod ברקודmicroarray y יכול לשמש כדי לזהות סמנים ביולוגיים בדגימות fluidic כמו גם בתאים בודדים. מאז ניתוח תא בודד הוא לא המוקד של פרוטוקול זה, אנחנו פשוט באו לידי ביטוי היישום של microarray הנוגדן 3 x 3 בזיהוי של ציטוקינים. דרך אינטראקציות סמן נוגדן-פני השטח, מקבץ של בידול 8 (CD8) תאים חיוביים לנתפסו על אחד מרכיבי microarray (איור 3G; שבב PDMS בחלק העליון), ושאר האלמנטים שמשמשים לאיתור ציטוקינים מופרשים ( איור 3H). עם שיטת לכידת תא זה, "מערכי תא" יכולים להיווצר. טכניקת לכידת מערך זה גם מאפשרת לשליטה על מספר התאים נתון לכל ניסוי ELISA. התאים היו מבודדים מבחינה פיזית בmicrochambers כך שהחלבונים שזוהו נגעו לתאים בודדים בפרט. באיור 3H, הוא הראה כי כל microchamber מצויד עם 16 אלמנטי microarray כדי להבטיח אנקפסולציה שלסט microarray 3 x 3 מלא.

איור 1
איור 1. עיצוב וייצור של תבניות ברקוד PDMS לדפוסי DNA מבוסס זרימה. הלוח (א) מראה הציורים של AutoCAD לתבניות ברקוד חד-ממדיות אופקיים ואנכיות. לוח (ב) מציג את דפוסי רקוד אופקיים ואנכיים על גבי מ(). קופסות ירוקות לצרף אזורים בדוגמת עם 3 x 3 מערכים בדידים. מסכה (C) Chrome עבור בודה המאסטר SU-8. SU-8 הורים מפוברקים על פרוסות סיליקון (ד '). הגדרה לזרימת דפוסים (E). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2 איור 2. בנייה ותיקוף של מערך ה- DNA 3 x 3. נתון זה שונה מ" quantitating פונקציות האינטראקציה Cell-Cell עם יישומים לתאי גליובלסטומה Multiforme הסרטן, "על ידי וואנג, ג 'et al., 2012, ננו לט 12 . זכויות יוצרים 2012 על ידי האגודה האמריקנית לכימיה. מותאם באישור. תכנית () לשלבי זרימת דפוסי DNA. פרופיל עוצמה (ב) הקרינה של 20 ערוצים באזור שנבחר (לייחס על ידי קו אנכי) של רקוד 1D. oligonucleotides Cy3 מצומדות- היה הכלאה עם מערכי DNA לאימות. (ג) פרופיל עוצמת הקרינה של מערכי תוקף עם DNA Cy3 מצומדות- לאחר שסיים את שלב דפוסי DNA השני. (ד) תבניות ניאון אלטרנטיביות מfl שונהow-דפוסי אסטרטגיות. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
3. יישומי איור של microarray 3 x 3. (א) תכנית לסינתזה של conjugates DEAL נוגדן-oligonucleotide. תכנית (ב ') להמרה של מערך ה- DNA לתוך מערך נוגדן דרך הכלאה עם conjugates נוגדן-oligonucleotide. (ג) תכנית לניצול microarray 3 x 3 בפלטפורמת ELISA כריך. נתון זה שונה מ" quantitating פונקציות האינטראקציה Cell-Cell עם יישומים לתאי גליובלסטומה Multiforme הסרטן, "על ידי וואנג, ג 'et al., 2012, ננו לט 12. זכויות יוצרים 2012 על ידי האגודה האמריקנית לכימיה. מותאם באישורו. לוח (D) מראה על צג הקרינה שנוצר תחת ערוץ Cy5. זה מתאים לניסוי ELISA כריך שזוהה 6 חלבונים. לוח (E) הוא תקריב-בפרופיל של קריאת נתוני מערך 3 x 3 תחת ערוצי Cy3 ו Cy5. לוח (F) מציג את כריך עקומות כיול ELISA לחלבונים רקומביננטיים. לוח (G) מראה "מערך תאים" שהוקם על ידי לכידת תאים באמצעות קשירה עם נוגדנים במערך. לוח (H) מראה את תוצאת זיהוי גבי עם microchambers בשבב אלקטרוני. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

1
פִּתָרוֹן הרכב oligonucleotide
A'-i, B'-II, III-C'
2 A'-IV, B'-V, C'-VI
3 A'-ז, B'-VIII, C'-IX

הרכב 1. טבלה של פתרונות 1-3 לDNA זרימת דפוסים.

רצפי עיגון
א ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
B GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
ג GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
גישור רצפים
A'-i TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-II TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-iii TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-IV TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-V TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-VI TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-ז TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B'-viii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-IX TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
oligonucleotides Cy3 מצומדות- לאימות
א' TACGGACTTAGCTCCAGGAT
ב ' TAGGCATGATTCAATGAGGC
ג ' TAGCGATAGTAGACGAGTGC
אני' TACTCTGACATCTCGACCAT
ii " TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
נ ' CGCACCGCAGTTTGGTCAAT
vi ' TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
viii ' CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"FO: לשמור-together.within עמודים =" 1 "> טבלה 2. רצפים משמשים בזרימת דפוסי DNA.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

עיצוב תבנית זרימה הוא השלב הקריטי הראשון בבודת microarray 2-D. כדי ליצור שני דפוסי DNA חופפים על מצע זכוכית, תכונות הערוץ של העיצוב הראשון צריכה להיות בניצב לאלה של (1A-B איור) השני. העיצובים בחשבון גם את היישומים במורד הזרם של microarray. במקרה של ניתוח תא בודד, microarray משמש כדי לזהות חלבונים מהתאים בודדים המוקפים בmicrochambers, לכן ממדי הערוץ נעשים בקנה אחד עם microchambers שליישר עם מערכי 2-D. כל עיצוב שניתנו על photomask וטכניקות photolithography סטנדרטיים משמשות לפברק תכונות הערוץ בSU-8 על פרוסות סיליקון (איור 1 ג-ד). זה משמש כאדון לPDMS דפוס. ברגע העובש כבר מפוברק, זה הוא ערובה לשקופית מצופה PLL ולאחר מכן בשילוב עם הגדרת זרימת גז חנקן (איור 1E). אנו הסט-אפשימוש הוא פשוט ויש את היתרון של להיות משולב בקלות לתוך כל מעבדה עם מקור גז חנקן מוסדר לחץ. אנו משתמשים בהרכבה של שסתומי 3-דרך זולות מרובים המחוברים למכל חנקן גז. זרימת האוויר לדפוסים חייבת להישמר בלחצים נמוכים (0.5-1 psi), כדי למנוע את delamination של שקופיות זכוכית מהתבנית. דליפות בתוך תבנית PDMS יכולות להתפשר על שלמות הדפוסים.

צעדי דפוסי זרימת DNA בפרוטוקול זה לנצל ssDNA עם רצפים שנבחרו בקפידה אורתוגונלי (איור 2 א). לזרום-דפוסים קודמים, הרצפים הייחודיים על oligonucleotides אלה צריכים להיבדק על היעדריו של הצטלבות. בדיקה פשוטה להצטלבות נעשית על ידי שינוי הליך האימות אנחנו מציגים בפרוטוקול שלנו (שלב 2). במקום להשתמש בקוקטייל של Cy3 מתויג DNA המשלים, רק סוג אחד של רצף משלים משמש בכל פעם לאזור שנבחר של השקופית שבי מרובהרצפי DNA הם משותקים. בהעדר DNA הצטלבות, רק פס אחד (למערך ה- DNA 1-D) או נקודה אחת (למערך ה- DNA 2-D) צריך להיות תחת פלורסנט מסנן Cy3. ניתן למצוא דוגמאות לרצפים המאונכות תוקף ביסודיות בטבלה של חומרים וציוד. צעד דפוסי DNA הראשון מציג שלושה סוגים של oligonucleotides "העוגן". רצפי 80-NT אלו מורכבים משני אזורי פולי-20-Mer שחלופי עם שני רצפים 20-Mer ייחודיים. שינוי 5'-האמין על רצפי עוגן אלה הוא הכרחי ל- קישור צולב אמין לאמין 17 עם PLL בתיווך BS3. צעד דפוסי DNA השני אינו דורש צולב מקשר. צעד זה מציג oligonucleotides "גישור" שלהכליא בחלקו עם רצפי העוגן. כל רצף גישור 60-NT מורכב מאזור 20-Mer משלים לרצף אחד עוגן, פולי-spacer 20-Mer, ורצף 20-Mer ייחודי. אימות של מערכי ה- DNA (Figurהדואר 2B-C) מתבצע לאחר כל צעד זרימת דפוסי DNA כדי להעריך את האיכות של צעדי דפוסים וכדי להבטיח שאין זיהום צולב 14. זו מבוצעת על ידי החדרת בדיקות oligonucleotide Cy3 מצומדות- שלהכליא עם דפוסי DNA. עם הפרמטרים שנקבעו בשלב (2.3.2) לניתוח עוצמת הקרינה, דפוסי DNA צריכים להפגין עוצמות הקרינה של לפחות 40,000 au למקסם את הרגישות של immunoassays במורד הזרם מתבצע באמצעות microarray. שימוש אסטרטגי של מערכות Cy3-דנ"א שונים במהלך האימות מוליד דפוסים חלופיים (איור 2 ד), ובכך מדגים את הגמישות של דפוסי DNA צעדים 8. כישלון להשיג דפוסים אחידים עלולים לגרום מדליפות או חסימות מכאניות (כגון חלקיקי אבק) נתקל בשלבי זרימת הדפוסים.

הכנת conjugates DEAL הנוגדן-oligonucleotide היא עוד שלב קריטי בההוא פרוטוקול. הבחירה של נוגדנים מוכתבת על ידי המערכת הביולוגית תחת מחקר. Oligonucleotides משמש בהטיה צריך להיות רצפים משלימים לאלו מעוגנים במערך ה- DNA. פתרונות מניות של linkers S-4FB ו- S-HyNic צריכים להיות מוכנים טרי ולהימנע מהרטבה להימנע הידרוליזה. הפעמים הדגירה בשימוש בפרוטוקול נטיה שלנו הן מספיק זמן כדי להציג את הפונקציות הרצויות בנוגדנים ו- DNA. תגובת הצימוד הסופית הוא הרווה רק על ידי הסרת oligonucleotides S-4FB מצומדות- unreacted באמצעות FPLC. לפיכך, טיהור FPLC צריכה להתבצע מייד לאחר שסיים את נטיה. גם בעת ביצוע FPLC עם המערכת שתוארה בפרוטוקול שלנו, שיעור נמוך יותר זרימה (0.2-.25 מיליליטר / דקה) ניתן להשתמש כדי לשפר את הרזולוציה. Conjugates הם eluted כשיא רחב (elution נפח של כ 9-15 מיליליטר) שמופיע לפני שיא צר וגבוה DNA (17-20 מיליליטר elution נפח). אנחנו לא ממליצים אחסון פתרונותשל conjugates עם S-4FB-DNA העודף כי זה יכול להוביל לאובדן של אתרי קישור אנטיגן בנוגדנים על נטיה עם DNA העודף פונקציונליות. הרגישות, סגוליות, והשחזור של ELISAs כריך באמצעות conjugates DEAL הוכח במחקרים קודמים. 8,9,11,12,16 כדי להעריך את האיכות של conjugates הנוגדן ה- DNA, conjugates ניתן מודגרות על מערכי ה- DNA כדי ליצור את מערך נוגדנים, המשמש לאחר מכן בניסויי ELISA הכריך ליצור עקומות כיול לגילוי חלבון (איור 3F). כדי ליצור עקומות כיול אלה, ניתן להשתמש בחלבונים רקומביננטי הניתנים בערכת ELISA כריך קונבנציונלית. השימוש בהטיות באיכות גבוהה צריכים להצמיח טווחים יניארי וגבולות התחתונים של זיהוי דומים לאלו של הערכה. כדוגמא, את הגבולות נמוכים יותר עבור INFγ וTNFα לכריך ELISA על מערך הנוגדן שלנו (איור 3F) הם ~ 50-100 pg / ml, והם consistenלא עם טווח הגילוי ליניארי של ~ 15-1,000 pg / ml מצויינים בגיליון הנתונים של המוצר לערכת ELISA כריך הקונבנציונלי. קריאת נתוני אות עניה שהושגו בניסויי ELISA הכריך במורד הזרם יכולים להיות מיוחסים לאיכות הנמוכה של מערך ה- DNA, ההתערבות של DNA העודף בפתרונות המצומד, או לחלופין, נטיה שלמה של ssDNAs עם נוגדנים.

חששות עיקריים לביצוע הכריך ELISA על מערך הנוגדן כוללים הצטלבות בין חומרים כימיים ואם האות משקפת את האירועים ביולוגיים האמיתיים. DNAs מאונך אנו משתמשים בפרוטוקול זה אומתו באופן יסודי יש פחות מ -0.1% הצטלבות. לכן כל דיבורים צולבים שנצפו בשלב immunoassay הוא בעיקר מהנוגדנים והחומרים הכימיים ELISA. בדיקה להצטלבות בין נוגדנים במערך יש לבצע לפני ביצוע מבחני על דגימות אמיתיות. ברגע שפנל נוגדן בנוי, כמה כריך ניסויי שליטת ELISA צריכים להיות Performed עם התנאים הבאים: 1. בלי אנטיגנים, 2. ללא נוגדנים לזיהוי, ו3. נוגדנים באיתור ובחומרים כימיים תיוג בלבד. אם הצטלבות הוא ציין בשלב immunoassay, זוגות הנוגדן ו / או חומרים כימיים ELISA צריכים להיות מוחלפים. יש לציין כי השימוש בנוגדנים זמינים מסחרי מערכות ELISA קונבנציונליות אינו מבטיח תחולה לטכניקת ELISA כריך מבוסס מערך.

היתרונות של טכנולוגיה זו כוללים ייצור זול, גודל זעיר, וגמישות של עיצוב. פרוטוקול הייצור שלנו לא צריך הצופה microarray שלא יהיה זמין למשתמשים רבים של מערכי נוגדנים. הגדרת זרימת הדפוסים ניתן להרכיב בקלות במעבדות פשוטות. למעבדות שאינם מצוידים בכלים לphotolithography, עיצובי CAD אנו מספקים בפרוטוקול שלנו עשויים להיות מועברים לחברות המציעות שירותי microfabrication. צמצומים microarray הקונבנציונלי להמערך הקומפקטי מפוברק עם הפרוטוקול שלנו מאפשר תאימות עם שבבים המשמשים בניסויי תא בודד. הפרוטוקול שלנו כולל ייצור של מערך כמערך ssDNA הראשון לפני המרה למערך נוגדנים. דפוסים ראשוניים עם ssDNAs יש מספר היתרונות. ראשית, ssDNAs הם כימי יציב יותר בהשוואה לנוגדנים, ובכך ניתן לאחסן את השקופיות בדוגמת ssDNA בייבוש במשך לפחות 6 חודשים ללא השפלה משמעותית 8,16. שנית, הגישה שלנו מציעה למשתמש קצה הגמישות לבחור מבחני דרושים, פשוט על ידי ערבוב conjugates סלקטיבית יחד בתמיסה ללא שינוי של microarray; להיפך, חלבון / מערכי נוגדנים קונבנציונליים וקבוע על מצע תוכנן מראש, ולכן השינוי של מבחני ידרוש דפוסים / הדפסה של חלבונים / נוגדנים מההתחלה. מחקרי נציג להמחיש את השימוש בנוגדן microarray ברקוד בתפוקה גבוהה detection של חלבוני איתות מרובים מהתאים בודדים. על ידי שינוי עיצובי דפוס זרימה ו / או פתרונות דפוסי oligonucleotide משמשים, רב של פריסות מערך ניתן לחקור. כדוגמא ליישום זה, חלבונים פונקציונליים מהתאים בודדים ניתן ללמוד. השבב לניתוח תא בודד מקיף רב כמו 8,700 microchambers ~, כל מיושר עם מערך נוגדן 3 x 3 שלם (איור 3H). כגון הגדרה מאפשרת זיהוי תפוקה גבוהה. חלבונים המופרשים על ידי תאים בתרבית בmicrochambers יכולים להיות מזוהים על ידי מערך זה. עיצוב microarray תכליתי מאפשר גם זיהוי מרובב של חלבונים מסרום, lysates תא, ותאים בודדים לאחר שילוב microarray עם רכיבים גנריות אחרים 8,15. בנוסף לגילוי חלבון, מערך נוגדן 3 x 3 שימושי גם בתאי לכידה (איור 3G).

החסרון העיקרי של גישה זו הוא compl המוסף שלוexity לעומת הייצור של microarrays הקונבנציונלי. אסטרטגיות לדפוסים ולעיצוב מערך חייבים להיות נתפסות בזהירות תוך התחשבות ביישומים הספציפיים של המערך המפוברק. גישה זו מחייבת גם מספר הצעדים קריטיים לרבות נהלי אימות ובדיקות להצטלבות. 3 x 3 המערך נבנה באמצעות הפרוטוקול שלנו מוגבל לאיתור 7 חלבונים בכל פעם. עם זאת, מגבלה זו יכולה להיות עלה ידי יצירת מערכים גדולים יותר. הפרוטוקול בהשתתפות כאן אינו מוגבל לייצור של 3 x 3 microarrays. אנחנו כבר מסוגלים לייצר בהצלחה 5 X 5 microarrays וממדים אחרים של אלמנטים במערך. באופן עקרוני, מערכים מ 'x n אחרים עשויים להיות מפוברקים תוך שימוש בטכניקות דומות, כל עוד סטי oligonucleotide המשמשים ליצירת מערך דוגמת DNA הראשוני הם מאונך למניעת הצטלבות בין אלמנטים במערך. יצירת המערכים הרחיבו מושגת על ידי זרימת patterning n סוגים של ssDNA מעגן לצעד דפוסי DNA הראשון, ואחריו מ 'x n גישור רצפי ssDNA לצעד הדפוסים השני. לדוגמא, כדי ליצור מערך 5 X 5, רצפי עוגן לE עשוי לשמש, בעת רצפי גישור A'-i למנוצל-XXV E'. כדי להפוך את תהליך דפוסי הזרימה, פלטפורמת רובוטיקה פותחה 18 למרות שזה מנוצל צעד זרימת דפוסי DNA אחד בלבד. בעיקרון, אותה הפלטפורמה יכולה להתארך עד השלב השני של זרימת דפוסי ניצב, תוך המיתוג בין שני שלבים עשוי לדרוש ידני קילוף עובש PDMS הראשון אחרי צעד הדפוסים הראשון, ואחריו כביסה וייבוש השקופיות (צעד זה היה לקחת כ -10 דקות), לפני הזדווגות השקופיות עם עובש PDMS אחר כדי להקל על צעד דפוסים השני בכיוון האנכי.

דנו נהלים מפורטים לבודת מערך nxm בדוגמתעם נוגדנים בצפיפות גבוהה, אשר טומנת בחובו הבטחה גדולה עבור יישומים עתידיים במחקרי proteomic ואיתות תא. הפרוטוקול המובא כאן יכול גם לשמש כמדריך לבניית מערכי DNA / נוגדן משוכללים יותר למטרות אחרות.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics