طريقة سريعة وفعالة لتنقية خلايا الأديم المولدة من الخلايا الجذعية الجنينية البشرية

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

هنا، نحن تصف طريقة لتنقية الخلايا الجنينية البشرية المتباينة الجذعية التي ترتكب نحو الأديم الباطن نهائي لتحسين التطبيقات المصب ومزيد من التفرقة.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

قدرات تمايز الخلايا الجذعية المحفزة مثل الخلايا الجذعية الجنينية (المجالس الاقتصادية والاجتماعية) تسمح لتطبيق العلاجية المحتملة للعلاج استبدال الخلية. الميؤوس من شفائهم يمكن أن تستخدم أنواع الخلايا المتمايزة لعلاج العديد من الأمراض التنكسية. في المختبر التفريق بين هذه الخلايا نحو أنسجة الرئة والكبد والبنكرياس يتطلب كخطوة أولى توليد خلايا الأديم الباطن نهائية. هذه الخطوة من أجل مزيد من التمايز نحو أنواع الخلايا نضجت عضال مثل خلايا بيتا المنتجة للأنسولين، خلايا الكبد أو غيرها من أنواع الخلايا المشتقة الأديم معدل الحد. الخلايا التي ملتزمون تجاه السلالة الأديم تعبر عن درجة عالية من العديد من عوامل النسخ مثل FOXA2، SOX17، HNF1B، وأعضاء الأسرة غاتا، ومستقبلات سطح CXCR4. ومع ذلك، بروتوكولات التفريق نادرا فعالة 100٪. هنا، نحن تصف طريقة لتنقية سكان الخلية CXCR4 + بعد المفاضلةفي دي باستخدام ميكروبيدات المغناطيسية. هذا بالإضافة إلى تنقية يزيل خلايا الأنساب غير المرغوب فيها. طريقة تنقية لطيف سريع وموثوق بها ويمكن أن تستخدم لتحسين التطبيقات المصب والتفرقة.

Introduction

الخلايا الجذعية المحفزة مثل الخلايا الجذعية الجنينية (المجالس الاقتصادية والاجتماعية) لديها القدرة على التمايز إلى تقريبا أي نوع من الخلايا في الجسم البشري. وهكذا، في المختبر بروتوكولات التمايز يمكن استخدامها لتوليد العديد من أنواع الخلايا الكبار مثل العضلية 2 خلايا الكبد، وخلايا بيتا الظهارية الرئة 4 أو الخلايا العصبية 5. وهذا يجعل المجالس الاقتصادية والاجتماعية أداة قيمة لعلاج المحتملة لمختلف الأمراض التنكسية 3.

التمايز في المختبر من المجالس الاقتصادية والاجتماعية نحو أنسجة البالغين في الرئة والكبد والبنكرياس يتطلب الزائفة تكون المعيدة إلى خلايا تشبه الأديم الباطن نهائي (DE) 6. منذ التمايز المصب نحو أنواع الخلايا الجسدية المذكورة أعلاه بشكل ملحوظ أقل كفاءة، ويعتبر أحد التمايز الأديم الباطن على النحو الأمثل معدل الحد 7. الخلايا التي ملتزمون تجاه السلالة الأديم الباطن تخضع تشاالتغييرات racteristic في التشكيل التعبير الجيني بهم. وأسفل تنظيم الجينات منظم تعدد القدرات الرئيسية، في حين أن التعبير عن عوامل النسخ الأخرى مثل FOXA2، SOX17، HNF1B، وأعضاء الأسرة GATA ومستقبلات سطح CXCR4 وupregulated للغاية 6، 8، ومن المعروف 9. CXCR4 أن transactivated التي كتبها SMAD2 / 3، المصب العقدية الإشارات / TGF-β وSOX17 بسبب مواقع محددة ملزمة في منطقة المروج لها (10). وهكذا هو علامة مناسبة جدا تستخدم في عدد من التقارير 6، 8، 11-13. هذه التغييرات التعبير يعكس حالة شبه تكون المعيدة، الذي المجالس الاقتصادية والاجتماعية أولا اكتساب خصائص بدائية سكان الخلية مثل خط والالتزام بعد ذلك إلى الأديم الجرثومية طبقة 6.

ومع ذلك، بروتوكولات التفريق نادرا 100٪ كفاءة عن عدد قليل من الخلايا قد تقاوم عملية التمايز أو التفريق نحو الأنساب أخرى غير مقصودة 14. هذه الخلايا قد لحالات الإنفلونزا سلبامزيد من التمايز NCE. وعلاوة على ذلك، خلايا غير متمايزة المتبقية تؤوي مخاطر كبيرة لاجراء تجارب زرع وقت لاحق وربما تؤدي إلى مسخي المبيض 15-17.

لإزالة هذه الخلايا غير المرغوب فيها في وقت مبكر على السطح علامة CXCR4 يمكن أن تستخدم لتنقية الخلايا التي ملتزمون تجاه DE 18. هنا، نحن تصف طريقة لاختيار إيجابية من CXCR4 + الخلايا من الثقافات التمايز DE. لهذا، لا بد من علامة CXCR4 السطح بواسطة الأجسام المضادة التي ثم بدوره يربط ميكروبيدات المغناطيسية. وخلافا لظروف قاسية خلال FACS الفرز، والخلايا DE مثل المسمى مغناطيسيا يمكن بعد ذلك بسهولة يمكن تنقيته في شكل الفوق باستخدام طريقة تنقية لطيف. يوفر هذا البروتوكول طريقة واضحة لإزالة السكان الخلية التي قاومت عملية التمايز DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. تمايز ESC الإنسان نحو الأديم النهائي

  1. زراعة الخلايا الجذعية الجنينية البشرية (المجالس الاقتصادية والاجتماعية) في حاضنة عند 37 درجة مئوية و 5٪ CO 2.
  2. معطف جديدة 6 جيدا وحة زراعة الخلايا مع 1 مل من مصفوفة الغشاء القاعدي واحتضان الثقافة وير لمدة 30 دقيقة على الأقل في RT. للحصول على تفاصيل محددة يرجى التوجه لتعليمات الشركة الصانعة فيما يخصه.
  3. تأكد من أن المجالس الاقتصادية والاجتماعية البشرية المستزرعة وصلت إلى 80٪ -90٪ confluency تحت المجهر باستخدام التكبير المنخفض (مثل 4X). نضح في المتوسط ​​من تسوس الأسنان عن طريق مص قبالة المتوسطة مع زجاجي معقم باستور الماصة. غسل خلايا مرة واحدة مع الفوسفات مخزنة المالحة (PBS) حل. لهذا، إضافة 2 مل PBS إلى كل بئر بهدوء يهز لوحة وتمتص قبالة حل لإزالة الخلايا الميتة والحطام الخلية.
  4. إضافة 1 مل من خالية من إنزيم حل الركض كاشف عن التفكك طيف من مجموعات الخلايا. احتضان الخلايا عند 37 درجة مئوية لد 5٪ CO 2 حتى تظهر الخلايا إشارات واضحة من الاضطراب في مجموعات صغيرة.
    ملاحظة: فترة حضانة يعتمد على كاشف المستخدمة. من أجل حل الركض خالية من إنزيم المذكورة في قسم المواد، وفترة حضانة هو تقريبا 7 دقائق.
  5. إضافة 1 مل DMEM / F-12 متوسطة وتعطيل المجاميع خلية المتبقية في الخلايا واحد من قبل pipetting صعودا وهبوطا باستخدام 1 مل ماصة. استخدم هذا لمطاردة خلايا من على سطح الأرض ونقل الخلايا إلى أنبوب الطرد المركزي. لاسترداد جميع الخلايا، ويغسل كل جيدا مع 1 مل من DMEM / F-12 متوسطة وإضافة وسيلة لأنبوب الطرد المركزي.
  6. الطرد المركزي الخلايا لمدة 5 دقائق في 300 × ز. نضح في وطاف resuspend الخلايا في 5 مل ES خلية ثقافة المتوسط ​​تحتوي على 10 ميكرومتر رو-كيناز (ROCK) المانع.
  7. عد الخلايا تحت المجهر باستخدام عدادة الكريات والبذور 150،000 - 400،000 الخلايا في 6 جيدا أو في تخطيط لوحة أخرى، اعتمادا على خط الخلية ES المستخدمة. استخدام طريق مسدود تلح تحتوي على المتوسط ​​10 ميكرومتر ROCK المانع لتجنب موت الخلايا المبرمج والثقافة الخلايا في حاضنة عند 37 درجة مئوية و CO 2 5٪.
  8. ما يقرب من 24 ساعة بعد البذر نضح المتوسطة مع العقيمة الماصة الزجاج باستور وإضافة 2 مل من بدائية المتوسطة خط الاستقراء.
    ملاحظة: هذه الوسيلة يحتوي على تركيزات النهائي من 1٪ الجلوتامين، 0.2٪ FCS، 5 ميكرومتر CHIR-99021 و 50 نانوغرام / مل activin وفي المتقدم المتوسطة RPMI-1640. عادة، استخدام 2 مل من المتوسط ​​للزراعة في 6 لوحات جيدا.
  9. 48 ساعة بعد البذر، استبدل على المديين المتوسط ​​والأديم المتوسط ​​الاستقراء. زراعة خلايا في هذه الوسيلة لمدة 48 ساعة أخرى مع تغيير المتوسطة اليومي.
    ملاحظة: هذه الوسيلة يحتوي على 1٪ الجلوتامين، 0.2٪ FCS و 50 نانوغرام / مل activin وفي المتقدم المتوسطة RPMI-1640. الخلايا التي ملتزمون تجاه الأديم الباطن نهائي تعبر عن علامة السطح CXCR4. تلطيخ من CXCR4 يمكن استخدامها لتحديد عدد الخلايا التي ارتكبت DE.

الطبقة = "jove_title"> 2. تلطيخ CXCR4 + الأديم النهائي الخلايا لتحليل التدفق الخلوي

  1. للنهائية 24 ساعة ولكن لا يقل عن 1 ساعة قبل حصاد الخلايا تضيف 10 ميكرومتر ROCK المانع للثقافة المتوسط.
  2. معطف الخلية ثقافة وير التي سيتم استخدامها لإعادة البذر مع قبو غشاء المصفوفة، أي لوحات 12-جيدا للتحليل أو غرفة الشرائح QPCR لتلطيخ المناعي. احتضان لوحات أو الشرائح لمدة 30 دقيقة على الأقل في RT.
  3. نضح المتوسطة مع المعقمة الماصة الزجاج باستور من الآبار من خلايا متمايزة تستخدم لتلطيخ و / أو الفرز.
  4. إضافة 1 مل من خالية من إنزيم حل الركض كاشف للتفكك لطيف من مجموعات الخلايا. احتضان الخلايا عند 37 درجة مئوية و 5٪ CO 2 حتى تظهر الخلايا إشارات واضحة من الاضطراب في مجموعات صغيرة.
    ملاحظة: فترة حضانة يعتمد على كاشف المستخدمة. من أجل حل الركض خالية من إنزيم المذكورة في العتادالقسم المرض، فترة حضانة هو تقريبا 7 دقائق.
  5. إضافة 1 مل DMEM / F-12 متوسطة وتعطيل المجاميع الخلية في الخلايا وحيدة المتبقية قبل pipetting صعودا وهبوطا باستخدام تلميح 1 مل. استخدم هذا لمطاردة خلايا من على سطح الأرض ونقل الخلايا إلى أنبوب الطرد المركزي. لاسترداد جميع الخلايا، ويغسل كل جيدا مع 1 مل من DMEM / F-12 متوسطة ث / س FCS وإضافة وسيلة لأنبوب الطرد المركزي.
  6. عد الخلايا تحت المجهر باستخدام عدادة الكريات. يجب أن الخلايا من ثلاثة آبار لوحة 6 جيدا يؤدي إلى 10-15 × 10 6 خلايا بعد ثلاثة أيام من التمايز. الطرد المركزي الخلايا لمدة 5 دقائق في 300 × ز.
    ملاحظة: إن العدد الدقيق للخلايا التي تم الحصول عليها تعتمد على خط الخلية المحفزة المستخدمة في التمايز.
  7. نضح في وطاف resuspend الخلايا في المخزن الجاهزة التي تحتوي على 10 ميكرومتر ROCK المانع. استخدام 100 ميكرولتر من هذا المخزن المؤقت لمدة تصل إلى 10 7 خلايا. إضافة 10 ميكرومتر ROCK المانع يوم stainiنانوغرام. استخدام هذا المخزن المؤقت لجميع التطبيقات المصب (المشار إليها باسم عازلة الجاهزة + RI).
    ملاحظة: عازلة الجاهزة يحتوي على 0.5٪ BSA و 2 ملي EDTA في برنامج تلفزيوني. إذا كان أكثر الخلايا لتكون ملطخة، وضبط حجم العازلة وفقا لذلك.
  8. إضافة 10 ميكرولتر من الأجسام المضادة CXCR4-APC في 10 7 خلايا في 100 ميكرولتر، وهذا يمثل ما يقرب من تخفيف 01:10.
    ملاحظة: استخدام الأجسام المضادة المرتبطة APC ليس إلزاميا. وبدلا من ذلك يمكن أن تكون بديلا اعتمادا على ميكروبيدات المستخدمة. إذا كان أكثر الخلايا لتكون ملطخة ضبط حجم الأجسام المضادة وفقا لذلك.
  9. مزيج من قبل التقليب بلطف أنبوب مع الأصابع واحتضان عند 4 درجات مئوية في الثلاجة لمدة 15 دقيقة. resuspend الخلايا مع العازلة الجاهزة 1-2 مل. الطرد المركزي الخلايا لمدة 5 دقائق في 300 × ز.
  10. نضح طاف مع زجاجي معقم باستور الماصة و resuspend بيليه الخلية في 80 ميكرولتر الجاهزة في 10 7 الخلايا وإضافة 20 ميكرولتر ميكروبيدات مكافحة APC.
    ملاحظة:
  11. مزيج من قبل التقليب بلطف أنبوب مع الأصابع واحتضان عند 4 درجات مئوية في الثلاجة لمدة 15 دقيقة. resuspend الخلايا مع 1-2 مل العازلة الجاهزة + RI. الطرد المركزي الخلايا لمدة 5 دقائق في 300 × ز. نضح المخزن المؤقت. resuspend في 500 ميكرولتر عازلة الجاهزة + RI.

3. الفصل المغناطيسي للCXCR4 + الخلايا

  1. ضع عمود المغناطيسي متوسطة الحجم في مجال مغناطيسي حسب تعليمات التصنيع. قبل شطف العمود مع العازلة 500 ميكرولتر الجاهزة + RI. تطبيق تعليق خلية بأكمله إلى العمود. جمع التدفق من خلال الخلايا وليس كل وربط العمود. تأكد من عدم تعكير صفو أعمدة لاسترجاع الأمثل للCXCR4 + الخلايا.
  2. غسل العمود ثلاث مرات مع 500 ميكرولتر عازلة الجاهزة + RI. جمع تدفق الأولى من خلال ودمجها مع الخلايا التي تم جمعها من الخطوة 3.1. إزالة العمود المغناطيسي من الحقل المغناطيسي للأرض ووضعه فيأنبوب جمع مناسبة. إضافة 1 مل العازلة الجاهزة + RI على العمود. إلى أزل الخلايا اضغط بشدة أسفل المكبس في العمود.
  3. اختياري: جمع كل التدفق من خلال عينات بشكل منفصل واستخدام 20 ميكرولتر كل لتحليل عدد من CXCR4 + الخلايا باستخدام التدفق الخلوي. يجب أن ينخفض ​​عددهم مع كل خطوة الغسيل.
    ملاحظة: لا يقل عن 2 × 10 4 قابلة للحياة، ينبغي أن يحسب الخلايا المغلقة عن نتائج يمكن الاعتماد عليها.
  4. كرر الخطوات من 3،1-3،3 مع تدفق التي تم جمعها من خلال عينة من الخطوة 3.1 وتدفق الأول من خلال عينة من الخطوة 3.2 باستخدام عمود جديد. لا إعادة استخدام العمود السابق. باستخدام الهواء الغطاس الضغط في العمود، الذي يمنع ذلك.
  5. عد الخلايا تحت المجهر باستخدام عدادة الكريات. اعتمادا على كفاءة التمايز تصل إلى 6 × 10 6 خلايا يمكن فرزها في البداية و 1 × 10 6 خلايا أخرى باستخدام العمود الثاني عند استخدام 10 7 خلايا لهذا الإجراء. الطرد المركزي الخلايا في 300 x ج لمدة 5 دقائق. نضح في وطاف مع الماصة باستور الزجاج معقمة وresuspend الخلايا في 1 مل الأديم الحث المتوسطة من الخطوة 1.9 مع إضافي 10 ميكرومتر ROCK المانع.
  6. عد الخلايا تحت المجهر باستخدام عدادة الكريات. البذور الخلايا في كثافة المناسبة، أي ~ 4 × 10 5 خلايا لكل بئر من لوحة ال 12 أيضا (التطبيق. 3.6 سم 2 السطح) أو ~ 1.5 × 10 5 خلايا لكل بئر من غرفة الشريحة 8 جيدا.

4. اختياري: تحليل تنقية سكان الأديم النهائي

  1. لتلطيخ المناعي إصلاح خلايا النقاء من الخطوة 3.7 تقريبا 24 ساعة بعد البذر مع 4٪ لامتصاص العرق وصمة عار لالأديم الباطن نهائي (DE) و / أو البروتينات تعدد القدرات علامة.
    ملاحظة: تشمل يشيع استخدامها علامات DE FOXA2 وSOX17، وتشمل تستخدم عادة علامات تعدد القدرات OCT3 / 4، NANOG وSOX2 6 و 8.
  2. فوتحليل ص RT-QPCR، حصاد الخلايا النقاء مباشرة أو 24 ساعة بعد البذر، استخراج مجموع الحمض النووي الريبي وعكس نسخ كدنا] من العينات الكلي الحمض النووي الريبي المستخرج. استخدام 10 كدنا] نانوغرام كقالب في RT-QPCR رد فعل (يثلث) لتحليل التعبير عن DE والجينات تعدد القدرات علامة 6، 8.
    ملاحظة: يتم ذكر الجينات علامة يشيع استخدامها في الخطوة 4.1. شروط الدورة هي 5 دقائق في درجة حرارة 95 درجة مئوية و 40 دورات من 15 ثانية في 95 درجة مئوية و 1 دقيقة في 60 درجة مئوية، تليها ذوبان تحليل المنحنى.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

على التمايز المجالس الاقتصادية والاجتماعية تخضع لتغييرات جذرية في الجينات والبروتينات الشكل 1 يصور الجينات علامة النموذجية التي يمكن استخدامها للتحقق من تمايز الأديم ناجحة. الاهداف الرئيسية لتحليل التعبير الجيني هي GSC، FOXA2، وSOX17. وفي تحليل التعبير الجيني النسبي تزداد خصوصا FOXA2 وSOX17 بواسطة> 2000 أضعاف بالمقارنة مع المجالس الاقتصادية والاجتماعية غير متمايزة. GSC بالفعل أعرب في وقت مبكر جدا خلال 24 ساعة خلال تشكيل الشريط البدائي لكنه على الرغم من ذلك الناجم> 100 مرات في اليوم الرابع. يتم زيادة التعبير عن هذه الجينات بالتالي على فرز باستخدام سطح علامة CXCR4 6. المنظمين تعدد القدرات رئيسية مثل OCT3 / 4 (POU5F1) وNANOG وبشكل كبير بانخفاض ينظم على الرغم من أن التعبير عن هذه الجينات لا يزال اكتشافها بعد أربعة أيام. هذا مؤشر علىقسم التدريب والامتحانات أن بعض الخلايا لا تستجيب بشكل كاف لنظام المعالجة مع CHIR-99021 وactivin A. التعبير SOX7 الجينات وتعالج عادة للتمييز تشكيل الأديم خارج الجنينية ضد DE. في الحالة الأولى SOX17 هو المشارك أعرب مع SOX7 وفي الحالة الأخيرة SOX17 يشارك في التعبير عنها FOXA2. وتشير النتائج في الشكل 1 الذي جنبا إلى جنب مع DE بعض الخلايا خارج الجنينية قد تشكلت خلال التمايز، وعلى الرغم من أننا لم تتمكن حتى الآن من وصمة عار خلايا SOX7 +.

ويوضح الشكل 2 السكان مختلفة من الخلايا التي تكون موجودة بعد التفريق بين المجالس الاقتصادية والاجتماعية في دي. في خطوة هي المصنفة 1 المجالس الاقتصادية والاجتماعية كما الخلايا واحد ومن ثم التفريق عن طريق العلاج مع CHIR-99021 وactivin ولمدة أربعة أيام. تلطيخ إذا لDE علامات SOX17 وFOXA2 (الشكل 2A) يدل على أن كلا من علامات وشارك في EXPRESSE موحدد داخل نواة. ويعتبر هذا بمثابة السمة المميزة للالتزام DE. ومع ذلك، بعض الخلايا تقاوم عملية التمايز وسرعة أيا من اثنين من البروتينات DE علامة (الشكل 2A). في الواقع، لوحظ اثنين من السكان خلية متميزة بعد المفاضلة لمدة أربعة أيام. بينما العديد من الخلايا تعبر عن علامة FOXA2 DE لا تزال هناك خلايا المتبقية التي تعبر عن SOX2 تعدد القدرات علامة (الشكل 2B). يتم التعبير عن هذه البروتينات اثنين في اثنين من السكان منفصلة ولا شاركت في التعبير ويمكن ملاحظة (الشكل 2B).

في يوم ثلاثة أو أربعة من التمايز يتم استخدام البروتين CXCR4 سطح لفرز ارتكبت DE-السكان CXCR4 + وبالتالي إزالة الخلايا المحفزة المتبقية وغيرها من الأنساب غير المرغوب فيها. اعتمادا على كفاءة التفريق بين خط الخلية المستخدمة> 80٪ CXCR4 + الخلايا يمكن الحصول عليها باستخدام بروتوكول التمايز الموضحة في الخطوة 1 8 ويبين الشكل 3 التدفق الخلوي البيانات بعد تلطيخ وتنقية الكربون الكلورية فلورية من CXCR4 + الخلايا بعد التمايز نحو DE و يظهر التعبير عن DE وعلامة تعدد القدرات البروتينات الشائعة باستخدام المناعي (IF) تلطيخ قبل وبعد تنقية الكربون الكلورية فلورية. في اليوم الثالث من التمايز تم الحصول على ما يقرب من 60٪ CXCR4 + الخلايا باستخدام تلطيخ المناعي للCXCR4 هو موضح في الخطوة 2 (الشكل 3A، وسط لوحة). CXCR4 + خلايا تتحرك من Q4 لQ1 على تلطيخ مع APC مترافق الأجسام المضادة لمكافحة CXCR4. بعد تنقية الكربون الكلورية فلورية وصفت في الخطوة 3 وأثرى السكان CXCR4 + إلى 85٪. عملية التنقية، ومع ذلك، لا القضاء على جميع السلالات غير المرغوب فيها من الثقافات (الشكل 3A، اللوحة اليمنى).

بعد تنقية الكربون الكلورية فلورية،وCXCR4 + الخلايا يمكن المصنف لمزيد من التحليل أو اختياريا الجولة الثانية من فرز يجوز أداء لانتاج درجات نقاء أعلى ولكن انخفاض قدرتها على البقاء. قبل التمايز التعبير واسعة الانتشار من SOX2 تعدد القدرات علامة (الملون باللون الأخضر) تم الكشف عنها بواسطة IF تلطيخ. في المقابل، فإن علامة FOXA2 DE (ملطخة باللون الأحمر) لا يمكن أن يتم الكشف عن (الشكل 3B). في الشكل 3C CXCR4 + ملطخة الخلايا مع أجسام مضادة لFOXA2 (الأخضر) وشارك الملطخة لSOX2 تعدد القدرات علامة (الأحمر). بعد البذر من CXCR4 النقاء + الخلايا تم الكشف عن خلايا سوى عدد قليل SOX2 +. غالبية الخلايا المصنفة إيجابية للعلامة FOXA2 DE.

الشكل 1
الشكل 1. التغيرات التمثيلية في التعبير الجيني للجينات مختلفة تعدد القدرات وعلامة الأديم خلال تمايز الأديم الباطن لمدة أربعة أيام. (ا) 7، والعلاج مع activin وحدها، وCA-A (CHIR-99021 وactivin أ) بروتوكول، والذي يستخدم لأجهزة ماكينتوش والفرز (انظر التفاصيل في 8). وهنا يشار إلى وسائل الإعلام المستخدمة في CA-A البروتوكول كما البدائي المتوسطة خط الاستقراء والمتوسطة الأديم الاستقراء. (ب) صورت هو التعبير الجيني تقاس RT-QPCR من GSC، SOX17 وFOXA2، التي يتم التعبير عنها على التزام الأديم الباطن نهائي دون المزيد من أجهزة ماكينتوش الفرز. POU5F1 (OCT3 / 4) وNANOG هم المنظمين تعدد القدرات وعادة أسفل ينظم على التمايز، في حين أعرب SOX7 في الأديم خارج الجنينية. تم تطبيع التعبير الجيني ضد ثلاثة جينات التدبير المنزلي أعرب مستقر (<م> TBP، TUBA1A، G6PD) مما أدى إلى القيم CNRQ. تم تعيين التعبير عن الجينات المذكورة أعلاه في خلايا غير متمايزة إلى 1 ويتم رسم التغيرات مثل تغير أضعاف من التعبير الجيني. القيم هي وسائل ± SEM، ن = 4-5. أنوفا بالإضافة إلى بونفيروني في الاختبار اللاحق. ** P ≤ 0.01 مقارنة مع عشوائية و#P ≤ 0.05، ## P ≤ 0.01 مقارنة مع RP (تم مؤخرا نشر جميع البيانات ضمن هذا الرقم في 8). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. السكان خلية مختلفة بعد تمايز الأديم. (أ) تلطيخ للDE علامات SOX17 وFOXA2 مع الأجسام المضادة منهما على D4 التمايز يكشف لهم متجانسة شارك في التعريب. ومع ذلك، بعضقاومت خلايا عملية التمايز ولا تعبر عن هذه العلامات (الأزرق نواة تلطيخ فقط). يظهر الدمج من تلطيخ الأخضر والأحمر باللون الأصفر. (ب) بعد DE التمايز هناك نوعان من السكان خلية متميزة. خلايا DE تشبه تعبر عن FOXA2 في حين الخلايا التي تقاوم عملية التمايز لا يزال يعبر عن SOX2 تعدد القدرات علامة. تم counterstained (AB) النوى مع دابي (الأزرق). شريط النطاق في لوحة (A) هو 50 ميكرون وفي لوحة (ب) 100 ميكرومتر. وجرى التصوير بها في 670 نانومتر (الأحمر وCy5)، 520 نانومتر (الأخضر وFITC) و 433 نانومتر (الأزرق ودابي)، على التوالي. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. MACS فرز متباينة السكان الخلية DE والحادي والعشرين تمثيليaining بعد الفرز. يتم إثراء (A) CXCR4 + الخلايا الملون (Q1) بعد بالاعمال الفرز. وانخفض عدد الخلايا CXCR4- (Q4). اعتمادا على خط الخلية المستخدمة عائدات بروتوكول التمايز> 80٪، CXCR4 إيجابي خلايا 8 وأجهزة ماكينتوش يمكن استخدامها لإثراء لهم. (ب) خلايا غير متمايزة تعبر عن SOX2 تعدد القدرات علامة (الخضراء) ولكن ليس DE علامة FOXA2 (أحمر ). (C) بعد بالاعمال فرز الخلايا سوى عدد قليل جدا SOX2 غير متمايز + تبقى (الحمراء)، في حين أن عدد السكان فرزها يعبر بشكل موحد تقريبا علامة FOXA2 DE (الخضراء). تم counterstained (قبل الميلاد) النوى مع دابي (الأزرق). شريط النطاق في لوحة (C) هو 100 ميكرون، وينطبق على جميع لوحات. وجرى التصوير بها في 670 نانومتر (الأحمر وCy5)، 520 نانومتر (الأخضر وFITC) و 433 نانومتر (الأزرق ودابي)، على التوالي. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

بروتوكولات التمايز المستخدمة حاليا نادرا ما يؤدي إلى خلايا متمايزة 100٪. وذلك لأسباب لا تزال بحاجة الى معالجة بعض الخلايا تقاوم عملية التمايز. اعتمادا على كفاءة بروتوكول التمايز المستخدمة والميل للESC خط لوحظ عدد معين من الخلايا المحفزة المتبقية عادة حتى بعد التمايز إلى الأديم الباطن نهائي. هذه الخلايا المتبقية قد تضعف التفرقة المصب أو مزيد من التحليل مثل transcriptomics، البروتينات، وتحليل التعبير ميرنا. قد الخلايا المحفزة المتبقية أو غيرها من الأنساب غير المرغوب فيها أيضا يحمل آثار نظير الصماوي التي قد تتداخل مع أهداف التمايز. وبالتالي، فإن إزالة هذه الخلايا قد تؤدي إلى تحسين التكاثر.

تنقية CXCR4 + معربا عن الخلايا الأديم بعد التمايز يمكن استخدامها لتخصيب هؤلاء السكان وإزالة الخلايا التي تقاوم عملية التمايز.وDE سطح البروتين علامة CXCR4 يمكن أن تستخدم لتنقية معينة من الخلايا الأديم. ويمكن الانتهاء من بروتوكول تنقية الكربون الكلورية فلورية في متناول اليد في غضون اقل من 2 ساعة، ويمكن أن يتم تنفيذها في شكل مقاعد البدلاء أعلى بسيط في كل مختبر زراعة الخلايا دون معدات المختبرات مكلفة والأجهزة. تنقية نظام مراقبة الأصول الميدانية هي تقنية تستخدم عادة ولكن توظف ظروف قاسية. خلال FACS عادة يتم الاحتفاظ خلايا التنقيات في تعليق لفترة طويلة من الزمن والخلايا تخضع لعوامل الصعبة الأخرى، على سبيل المثال، ارتفاع الضغط في فوهة الجهاز FACS. في المقارنة الإجراء الكربون الكلورية فلورية هو سريع ولطيف. هذا يحسن قدرة الخلايا على أعد خلال البذر بعد عملية التنقية. لمزيد من تخفيف هذا تلامسه يضاف مثبط ROCK إلى وسائل الإعلام الثقافة بعد وقبل تنقية لمنع موت الخلايا المبرمج. عامل مهم آخر أن يؤثر إعادة المرتكز هو الكثافة الذي يتم reseeded الخلايا. هذا depen بقوةس على خط الخلية المستخدمة. الأرقام الخلايا المستخدمة لبذر في هذه الدراسة هي أرقام الهواتف المحمولة التمثيلية التي تعمل بشكل جيد في أيدينا. ومع ذلك، قد تكون هناك حاجة إلى ضبط هذه الأرقام لخطوط مختلفة من الخلايا. كل من التدابير، إضافة مثبط ROCK وتقييم أرقام الهواتف المحمولة لإعادة زرع النبتة، هي حاسمة لنجاح زراعة الخلايا أخرى بعد الفرز.

مع استخدام بروتوكول التمايز DE عادة> 70٪ CXCR4 + الخلايا يمكن الحصول دون فرز 8. أداء البروتوكول المستخدم لتوليد DE تؤثر بالتبعية على كفاءة لاحق بروتوكول تنقية أجهزة ماكينتوش. في العام، والتمايز كفاءة (> 80٪ CXCR4 + الخلايا) تعطي نقاء أعلى بعد بالاعمال الفرز (تصل إلى 95٪). وهكذا، فإن استخدام هذه الطريقة تنقية يقلل من عدد الخلايا غير المتمايزة إلى حد كبير ولكن 100٪ نقاء لا يمكن تحقيقه. في المستقبل، يمكن تعريف النسب علامات سطح معينة روقبعة تسمح تنقية المزيد من الخلايا متباينة عضال. إجراءات الفرز الكربون الكلورية فلورية هو اختيار رئيس الوزراء لهذا الغرض.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

واعترف بالمساعدة التقنية الماهرة من ياسمين Kresse العرفان.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics