שיטה מהירה ויעילה עבור טיהור של תאים האנדודרם המופקים מתאי גזע עובריים אנושיים

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן אנו מתארים שיטה לטיהור של תאי גזע עובריים אנושיים הבדילו כי מחויב כלפי האנדודרם הסופי לשיפור יישומים במורד בידול נוסף.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

יכולות ההתמיינות של תאי גזע פלוריפוטנטיים כגון תאי גזע עובריים (ESCs) לאפשר יישום טיפולי פוטנציאל טיפולי התחדשות תאים. סופני סוגי תאים מובחנים יכול לשמש לטיפול במחלות ניווניות שונות. חוץ גופית התמיינות של תאים אלה כלפי רקמות של ריאות, כבד ולבלב דורש כצעד ראשון הדור של תאים endodermal מוחלטות. שלב זה הוא הגבלת קצב לבידול נוסף לקראת סוגי תאים התבגר סופני כגון תאי ביתא מייצרי אינסולין, hepatocytes או סוגי תאים אחרים הנגזרות האנדודרם. תאים מחויבים כלפי השושלת endoderm מאוד להביע שפע של גורמי שעתוק כגון FOXA2, SOX17, HNF1B, בני משפחת גאטה, ואת לקולטן CXCR4. עם זאת, פרוטוקולי בידול הם לעתים רחוקות 100% יעילים. כאן אנו מתארים שיטה לטיהור של אוכלוסיית תא CXCR4 + לאחר התמיינותאל DE באמצעות microbeads מגנטי. טיהור זה גם מסיר תאים של שושלות רצויות. שיטת הטיהור העדינה היא מהירה ואמינה ועשויה לשמש כדי לשפר יישומי differentiations במורד זרם.

Introduction

תאי גזע פלוריפוטנטיים כגון תאי גזע עובריים (ESCs) יש את היכולת להתמיין כמעט כל סוג תא בגוף האדם. לפיכך, פרוטוקולים בידול במבחנה יכול לשמש כדי ליצור סוגי תאים בוגרים רבים כגון cardiomyocytes 1, hepatocytes 2, תאי בטא 3, ריאות אפיתל 4 או 5 תאים עצביים. זה עושה ESCs כלי רב ערך לטיפול הפוטנציאל של מחלות ניווניות שונות 3.

בידול במבחנה של ESCs כלפי רקמות בוגרות של ריאות, כבד ולבלב דורש פסאודו gastrulation לתאים מזכיר את האנדודרם סופי (DE) 6. מאז בידול במורד כלפי סוגי תאים סומטיים הנ"ל הוא משמעותי פחות יעיל, בידול האנדודרם אופטימלי נחשב הגבלת קצב 7. תאים מחויבים כלפי שושלת endoderm לעבור צ'השינויי racteristic בפרופיל ביטוי הגנים שלהם. מאסטר pluripotency גנים הרגולטור למטה מוסדרים, ואילו הביטוי של גורמי שעתוק אחרים כגון FOXA2, SOX17, HNF1B, בני משפחת Gata ואת לקולטן CXCR4 הוא שהוגברו מאוד 6, 8, 9. CXCR4 ידוע להיות transactivated ידי SMAD2 / 3, במורד זרם של איתות קטרים ​​/ TGF-β ו SOX17 בשל אתרי קישור ספציפיים באזור האמרגן שלה 10. לכן הוא סמן מתאים מאוד בשימוש מספר הדיווחים 6, 8, 11-13. שינויי ביטוי אלה משקפים אירוע פסאודו gastrulation, שבו ESCs לרכוש הראשונה מאפיינים של אוכלוסיית תא פס דמוי פרימיטיבית ובהמשך להתחייב לתוך השכבה ניבטת endoderm 6.

עם זאת, פרוטוקולי בידול הם לעתים רחוקות 100% יעילים כמו כמה תאים עשויים להתנגד לתהליך הבידול או להבדיל כלפי שושלות מכוונות אחרות 14. תאים אלה עשויים לרעה influeבידול נוסף NCE. יתר על כן, תאים שלא עברו התמיינות שיורית נמל סיכונים גדולים לניסויי השתלה מאוחר יותר עשוי להצמיח teratomas 15-17.

כדי להסיר תאים לא רצויים אלה מוקדם על CXCR4 סמן המשטח יכול לשמש עבור טיהור של תאים מחויבים כלפי DE 18. כאן אנו מתארים שיטת הסלקציה החיובית של CXCR4 + תאים מתרבויות בידול DE. לשם כך, CXCR4 סמן המשטח מחויב נוגדן אשר בתורם נקשר microbeads המגנטי. בניגוד לתנאים הקשים במהלך מיון FACS, תאי DE הדמויים המתויגים מגנטי אז יכולים להיות מטוהרים בקלות בפורמט המעבדתיים באמצעות שיטת טיהור עדינה. פרוטוקול זה מספק שיטה פשוטה להסרת אוכלוסיות תאי המגן מפני תהליך התמיינות DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

בידול 1. של האדם ESC כלפי האנדודרם המכריע

  1. טפחו את תאי גזע עובריים אנושיים (ESCs) באינקובטור ב 37 מעלות צלזיוס, 5% CO 2.
  2. מעיל צלחת תרבות 6 היטב סלולרי חדש עם 1 מ"ל של מטריצה ​​קרום במרתף דגירה כלי התרבות למשך 30 דקות לפחות ב RT. לפרטים ספציפיים בבקשה לפנות להוראות היצרן בהתאמה.
  3. ודא ESCs האדם התרבותי יגיע ל -80% -90% confluency תחת מיקרוסקופ באמצעות בהגדלה נמוכה (למשל, 4X). לשאוב את המדיום מהנקבובי ידי מוצצת המדיום עם pipet פסטר זכוכית סטרילית. שוטפים את התאים פעם עם פתרון בופר פוספט (PBS). לשם כך, להוסיף 2 מ"ל PBS היטב כל ברכות לנער את צלחת ולמצוץ את הפתרון כדי להסיר תאים מתים ופסולת התא.
  4. הוסף 1 מ"ל של ריאגנט פתרון passaging ללא אנזים דיסוציאציה עדין של צבירי תאים. דגירת התאים לעבר 37 ° Cד 5% CO 2 עד התאים להראות סימנים ברורים של הפרעה בצבירים קטנים.
    הערה: זמן הדגירה תלוי המגיב בשימוש. לקבלת פתרון passaging ללא אנזים שהוזכר בסעיף החומרים, זמן דגירה הוא בערך 7 דקות.
  5. הוסף 1 מ"ל DMEM / בינוני F-12 ולשבש המצרפים תא הנותרים לתוך תאים בודדים ידי pipetting מעלה ומטה באמצעות קצה פיפטה 1 מ"ל. השתמש באפשרות זו כדי לרוקן את התאים מפני השטח ולהעביר את תאי צינור צנטריפוגה. כדי לאחזר את כל התאים, לשטוף היטב עם כל 1 מ"ל של DMEM / בינוני F-12 ולהוסיף המדיום אל הצינור צנטריפוגה.
  6. צנטריפוגה התאים למשך 5 דקות ב 300 x גרם. לשאוב supernatant ו resuspend התאים במדיום תרבית תאים 5 מ"ל ES המכיל מעכב 10 מיקרומטר Rho-קינאז (ROCK).
  7. ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer וזרעי 150,000 - 400,000 תאים לכל 6 באר או אחר צלחת פריסה, בהתאם לקו בתאי הגזע העוברי בשימוש. מבוי סתום שימוש ture בינוני מעכב ROCK 10 מיקרומטר המכיל להימנע אפופטוזיס והתרבות התאים באינקובטור ב 37 מעלות צלזיוס, 5% CO 2.
  8. כ -24 שעות לאחר זריעה לשאוב את המדיום עם pipet פסטר זכוכית סטרילית להוסיף 2 מ"ל של מדיום אינדוקציה הראשונית.
    הערה: בינוני זה מכיל ריכוזים סופי של 1% גלוטמין, 0.2% FCS, 5 מיקרומטר CHIR-99,021 ו 50 ng / A Activin מ"ל מתקדם RPMI-1640 בינוני. בדרך כלל, להשתמש 2 מ"ל של מדיום לגידול 6 צלחות היטב.
  9. 48 שעות לאחר הזריעה, להחליף את המדיום כדי endoderm בינוני אינדוקציה. טפחו את התאים במדיום הזה במשך 48 אחר שעה עם שינוי בינוני יומי.
    הערה: בינוני זה מכיל 1% גלוטמין, 0.2% FCS ו -50 ng / ml Activin א 'מתקדם RPMI-1640 בינוני. תאים מחויבים כלפי האנדודרם הסופי להביע את סמן המשטח CXCR4. המכתים של CXCR4 יכול לשמש כדי לכמת את מספר התאים המחויבים DE.

class = "jove_title"> 2. צביעת תאי CXCR4 + Definitive endoderm עבור ניתוח cytometry הזרימה

  1. במשך 24 שעות הסופיות אבל לפחות 1 שעה לפני קצירת התאים להוסיף 10 מיקרומטר ROCK מעכבים עד בינוני התרבות.
  2. מעיל התא-ware תרבות ישמש מחדש זריעה עם מטריצה ​​קרום במרתף, כלומר, 12-גם צלחות לניתוח qPCR או קאמרית שקופיות עבור מכתים immunofluorescence. דגירת הצלחות או שקופיות למשך 30 דקות לפחות ב RT.
  3. לשאוב את המדיום עם pipet פסטר זכוכית סטרילית מן הבארות של התאים הממוינים המשמשים מכתים ו / או מיון.
  4. הוסף 1 מ"ל של ריאגנט פתרון passaging האנזים ללא עבור דיסוציאציה עדין של צבירי תאים. דגירת התאים ב 37 מעלות צלזיוס, 5% CO 2 עד להראות את תאי סימנים ברורים של הפרעה בצבירים קטנים.
    הערה: זמן הדגירה תלוי המגיב בשימוש. לקבלת הפתרון passaging האנזים ללא המוזכרים materiסעיף als, זמן הדגירה הוא בערך 7 דקות.
  5. הוסף 1 מיליליטר DMEM / F-12 בינוניים ולשבש הנותרים אגרגטים תא לתוך תאים בודדים ידי pipetting מעלה ומטה בעזרת טיפ 1 מיליליטר. השתמש באפשרות זו כדי לרוקן את התאים מפני השטח ולהעביר את תאי צינור צנטריפוגה. כדי לאחזר את כל התאים, לשטוף היטב עם כל 1 מ"ל של DMEM / F-12 בינוני w / o FCS ולהוסיף המדיום אל הצינור צנטריפוגה.
  6. ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer. תאים משלוש בארות של צלחת 6-גם אמורים לגרום 10-15 x 10 6 תאים לאחר שלושה ימים של בידול. צנטריפוגה התאים למשך 5 דקות ב 300 x גרם.
    הערה: המספר המדויק של התאים המתקבלים יהיה תלוי שורת תאים פלוריפוטנטיים המשמש את הבידול.
  7. לשאוב supernatant ו resuspend התאים חיץ PEB המכילים מעכבי ROCK 10 מיקרומטר. השתמש 100 μl של חיץ זה לתקופה של עד 10 7 תאים. מוסיפים את מעכבי ROCK 10 מיקרומטר ביום staining. השתמש חיץ זה עבור כל היישומים במורד הזרם (המכונה חיץ PEB + RI).
    הערה: חיץ PEB מכיל 0.5% BSA ו -2 מ"מ EDTA ב PBS. אם יותר תאים להיות מוכתמים, להתאים את עוצמת קול החיץ בהתאם.
  8. הוסף 10 μl של נוגדן CXCR4-APC לכל 10 7 תאים 100 μl, זה בערך מייצג דילול של 1:10.
    הערה: השימוש של נוגדן APC צמוד אינו חובה. במקום זה ניתן להחליף בהתאם microbeads בשימוש. אם יותר תאים הם להיצבע לכוונן את עוצמת קול הנוגדן בהתאם.
  9. מערבבים על ידי היפוך הצינור בעדינות עם האצבעות דגירה על 4 מעלות צלזיוס במקרר במשך 15 דקות. Resuspend התאים עם חיץ PEB מ"ל 1-2. צנטריפוגה התאים למשך 5 דקות ב 300 x גרם.
  10. לשאוב supernatant עם pipet פסטר זכוכית סטרילית resuspend התא גלולה ב PEB 80 μl לכל 10 7 תאים ולהוסיף 20 microbeads μl אנטי APC.
    הערה:
  11. מערבבים על ידי היפוך הצינור בעדינות עם האצבעות דגירה על 4 מעלות צלזיוס במקרר במשך 15 דקות. Resuspend התאים עם חיץ PEB מ"ל 1-2 + RI. צנטריפוגה התאים למשך 5 דקות ב 300 x גרם. לשאוב את המאגר. Resuspend במאגר 500 μl PEB + RI.

3. הפרדה מגנטית של CXCR4 + תאים

  1. מניח טור מגנטי בגודל בינוני בתוך שדה מגנטי לפי הוראות ייצור. טרום לשטוף את העמודה עם 500 μl PEB חיץ + RI. החל את השעית התא כולו לעמודה. אסוף את הזרימה דרך תאים לא הכל כפי יהיה לאגד את העמודה. ודא שלא להפריע את העמודות לשליפה אופטימלית של תאי CXCR4 +.
  2. לשטוף את העמודה שלוש פעמים עם חיץ 500 μl PEB + RI. אסוף את הזרם הראשון דרך ולשלב אותו עם תאים שנאספו שלב 3.1. הסר את העמודה המגנטית מהשדה המגנטי ומניח אותו בתוךצינור איסוף מתאים. הוסף 1 מ"ל PEB חיץ + RI על הטור. כדי elute התאים היטב ומהדקים את הבוכנה לתוך הטור.
  3. אופציונלי: לאסוף את כל הזרימה דרך דגימות בנפרד ולהשתמש 20 μl כל לנתח את מספר CXCR4 + תאים באמצעות cytometry הזרימה. מספרם צריך לרדת עם כל צעד כביסה.
    הערה: לפחות 2 x 10 4 קיימא, תאים מגודרים צריכים לספור עבור תוצאות אמינות.
  4. חזור על שלבים 3.1-3.3 עם הזרם-שנאסף באמצעות מדגם משלב 3.1 ואת הזרם הראשון באמצעות מדגם משלב 3.2 באמצעות טור חדש. אל תשתמש שוב בטור הקודם. באמצעות אוויר הבוכנה נלחץ לתוך הטור, אשר חוסם אותו.
  5. ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer. בהתאם היעיל של עד הבידול עד 6 x 10 6 תאים ניתן למיין בתחילה ועוד 1 x 10 6 תאים באמצעות עמודה שנייה בעת שימוש 10 7 תאים עבור ההליך. צנטריפוגה התאים ב XG 300 במשך 5 דקות. לשאוב את supernatant עם pipet פסטר זכוכית סטרילית resuspend התאים במדיום אינדוקציה האנדודרם 1 מ"ל משלב 1.9 עם מעכב ROCK 10 מיקרומטר נוסף.
  6. ספירת התאים תחת מיקרוסקופ באמצעות hemocytometer. זרעי התאים בצפיפות מתאימה, כלומר, ~ 4 x 10 5 תאים לכל גם צלחת 12-היטב (אפליקציה. 3.6 סנטימטר 2 משטח) או ~ 1.5 x 10 5 תאים לכל טוב של 8-היטב קאמרי שקופיות.

4. אופציונאלי: ניתוח אוכלוסין endoderm Definitive מטוהרים

  1. עבור מכתים immunofluorescence לתקן את התאים מטוהרים משלב 3.7 בערך 24 שעות לאחר זריעה עם 4% paraformaldehyde ו כתם במשך האנדודרם סופי (DE) ו / או חלבונים סמן pluripotency.
    הערה: בשימוש נפוץ סמנים DE כוללים FOXA2 ו SOX17, סמנים pluripotency נפוצים כוללים OCT3 / 4, NANOG ו Sox2 6, 8.
  2. For ניתוח RT-qPCR, לקצור את התאים מטוהרים ישירות או 24 שעות לאחר זריעה, לחלץ סך-RNA הפוכה לתמלל cDNA מן מכלל הדגימות-RNA חילוץ. השתמש 10 cDNA ng כתבנית לכל תגובה RT-qPCR (triplicates) לנתח את הביטוי של DE וגנים סמן pluripotency 6, 8.
    הערה: גני סמן מקובלים הם שהוזכרו בשלב 4.1. תנאי מחזור 5 דקות ב 95 ° C ו 40 מחזורים של 15 שניות על 95 מעלות צלזיוס ו 1 דקות ב 60 מעלות צלזיוס, ואחריו נמס ניתוח עקום.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

עם בידול ESCs לעבור שינויים דרסטיים גנים ביטוי חלבון. איור 1 מתאר גנים סמן טיפוסי שניתן להשתמש בהם כדי לאמת בידול האנדודרם מוצלח. מטרות הממשלה עבור ניתוח ביטוי גנים הם GSC, FOXA2, ו SOX17. בניתוח ביטוי גנים ביחס במיוחד FOXA2 ו SOX17 הם עלו ב> 2,000 לקפל בהשוואה ESCs מובחן. GSC כבר מתבטא מאוד מוקדם בתוך 24 שעות במהלך היווצרות פס פרימיטיבי אבל זה בכל זאת מושרה> 100 לקפל ביום ארבע. הביטוי של גנים אלה וכתוצאה מכך הוא גדל על מיון באמצעות סמן משטח CXCR4 6. רגולטורים pluripotency כגון OCT3 / 4 (POU5F1) ו NANOG הם למטה מוסדר באופן משמעותי למרות ההתבטאות שלהם עדיין לזיהוי לאחר ארבעה ימים. אינדיקה זהtes שתאים מסוימים אינם מגיבים במידה מספקת כדי משטר הטיפול עם ביטוי גני SOX7 א CHIR-99,021 ו Activin בדרך כלל מופנה להפלות היווצרות endoderm חוץ עוברית נגד DE. במקרה הראשון SOX17 הוא הביע שיתוף עם SOX7 ובמקרה האחרון SOX17 הוא שיתוף הביע עם FOXA2. התוצאות באיור 1 מצביעות על כך יחד עם DE כמה תאי חוץ עובריים נוצרו במהלך התמיינות, למרות שאנחנו עדיין לא הצלחנו להכתים תאי SOX7 +.

איור 2 מדגים את אוכלוסיות תאים השונות שנמצאות לאחר ההתמיינות של ESCs לתוך DE. בשלב 1 ESCs הם זורעים כמו תאים בודדים ולאחר מכן הנבדלים טיפול עם CHIR-99,021 ו Activin במשך ארבעה ימים. מכתים IF של DE סמנים SOX17 ו FOXA2 (איור 2 א) עולה כי שני סמנים הם אחיד שיתוף מביעיםד בתוך גרעיני. זה נחשב סימן היכר של מחויבות DE. עם זאת, תאים מסוימים להתנגד לתהליך הבידול ולהביע אף אחד החלבונים שני סמן DE (איור 2 א). למעשה, שתי אוכלוסיות תאים מובחנים הם נצפו לאחר בידול ארבעה ימים. בעוד תאים רבים מבטאים את FOXA2 סמן DE יש עדיין תאי נותרים המבטאים את Sox2 סמן pluripotency (איור 2 ב). חלבונים שני אלה באים לידי ביטוי בשתי אוכלוסיות נפרדות ואין שיתוף ביטוי ניתן לצפות (איור 2 ב).

ביום שלושה או ארבעה הבדלה בין CXCR4 חלבון משטח משמש כדי למיין את האוכלוסייה DE-מחויב CXCR4 + ובכך להסיר את התאים pluripotent הנותרים השושלות לא רצויות אחרות. בהתאם יעיל הבידול של הקו הסלולרי משמש> 80% CXCR4 + תאים ניתן להשיג באמצעות פרוטוקול הבידול מפורט שלב 1 8 איור 3 מתאר cytometry זרימה נתונים לאחר מכתים וטיהור MACS של CXCR4 + תאים לאחר בידול כלפי DE ו מראה את הביטוי של חלבונים נפוצים DE סמן pluripotency באמצעות immunofluorescence (IF) מכתים לפני ואחרי טיהור MACS. ביום השלישי של בידול בערך 60% CXCR4 + תאים באמצעות מכתים immunofluorescence עבור CXCR4 המתואר בשלב 2 התקבלו (איור 3 א, פאנל באמצע). תאים CXCR4 + לעבור Q4 כדי Q1 על צביעה עם נוגדן אנטי CXCR4 מצומדות APC. לאחר טיהור MACS המתואר בשלב 3 האוכלוסייה CXCR4 + מועשר ל -85%. תהליך הטיהור, לעומת זאת, אינו פותר את כל השושלות הרצויות מן התרבויות (איור 3 א, פנל מימין).

לאחר טיהור MACS,ניתן וזרע CXCR4 + התאים לניתוח נוסף או סיבוב שני אופציונאלי של מיון עשויה להתבצע להניב purities גבוהה אך כדאיות מופחתת. לפני בידול הביטוי רחב התפשט של Sox2 סמן pluripotency (מוכתם בירוק) הוא זוהה על ידי מכתים IF. לעומת זאת, FOXA2 סמן DE (מוכתם באדום) לא ניתן לאתר (איור 3B). באיור 3C CXCR4 + תאים מגואלות נוגדנים FOXA2 (ירוק) הם שיתוף מוכתם עבור Sox2 סמן pluripotency (אדום). לאחר זריעה של תאי CXCR4 + מטוהרים רק כמה Sox2 + תאים מזוהים. רוב תאי הזרע הם חיוביים עבור FOXA2 סמן DE.

איור 1
איור 1. שינויים נציג בביטוי הגנים של גנים סמן pluripotency ו endoderm שונים במהלך בידול האנדודרם ארבעה ימים. (א) 7, טיפול עם Activin לבד, and-A CA (CHIR-99,021 ו- A Activin) פרוטוקול, אשר משמש MACS מיון (ראה פירוט 8). התקשורת המשמשת את CA-פרוטוקול מכונית כאן כמדיום אינדוקצית פס פרימיטיווי ובינוני אינדוקציה האנדודרם. (ב) המתואר היא ביטוי הגנים נמדד על ידי RT-qPCR של GSC, SOX17 ו FOXA2, אשר באים לידי ביטוי על התחייבות האנדודרם סופית ללא MACS נוסף מיון. POU5F1 (OCT3 / 4) ו NANOG הם רגולטורי pluripotency ובדרך כלל למטה מוסדר על בידול, ואילו SOX7 מתבטא endoderm חוץ עוברי. את ביטוי הגנים היה מנורמל נגד שלושה גני משק לידי ביטוי ביציבות (<em> TBP, TUBA1A, G6PD) וכתוצאה מכך ערך CNRQ. הביטוי של הגנים הנ"ל תאים שלא עברו התמיינות נקבע ל -1 ושינויים הם זממו כמו שינוי הקיפול של ביטוי גנים. ערכים הם אמצעי ± SEM, n = 4-5. ANOVA ובמבדקים פוסט הוק של Bonferroni. ** P ≤ 0.01 לעומת אקראיות #P ≤ 0.05, ## P ≤ 0.01 לעומת RP (כל הנתונים בתוך נתון זה פורסמו לאחרונה ב 8). נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. אוכלוסיות תאים שונות לאחר בידול האנדודרם. (א) מכתים של DE סמנים SOX17 ו FOXA2 עם נוגדנים המתאימים על D4 של בידול חושף שיתוף לוקליזציה הומוגנית שלהם. עם זאת, חלקתאים התנגדו תהליך הבידול אינם מבטאים סמנים אלה (גרעין כתמים כחולים בלבד). המיזוג של מכתים ירוק ואדום מוצג בצהוב. (ב) לאחר התמיינות DE יש שתי אוכלוסיות תאים נפרדים. DE דמויי תאים להביע FOXA2 ואילו תאי המגן מפני תהליך ההתמיינות עדיין לבטא את Sox2 סמן pluripotency. (AB) גרעינים היו counterstained עם DAPI (כחול). סרגל קנה מידה בלוח (א) הוא 50 מיקרומטר בלוח (B) הוא 100 מיקרומטר. הדמיה בוצעה ב- 670 ננומטר (אדום, Cy5), 520 ננומטר (ירוק, FITC) ו 433 ננומטר (כחול, DAPI), בהתאמה. לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. MACS המיון של אוכלוסיות תאים DE מבודל נציג staining לאחר מיון. (א) CXCR4 + תאים מוכתמים (Q1) מועשרים לאחר MACS מיון. מספר תאי CXCR4- (Q4) הוא ירד. בהתאם לקו התא בשימוש התשואות פרוטוקול בידול> 80% תאים חיוביים CXCR4 8 ו MACS ניתן להשתמש כדי להעשיר אותם עוד יותר. (ב) תאים שלא עברו התמיינות לבטא את Sox2 סמן pluripotency (ירוק), אך לא את FOXA2 סמן DE (אדום ). (ג) לאחר MACS המיון להישאר (אדום), ואילו אוכלוסיית מיון Sox2 + תאים מעט מאוד מובחן רק כמעט אחיד מבטא את FOXA2 סמן DE (ירוק). (בי סי) גרעינים היו counterstained עם DAPI (כחול). סרגל קנה מידה בלוח (C) הוא 100 מיקרומטר והוא חל על כל הלוחות. הדמיה בוצעה ב- 670 ננומטר (אדום, Cy5), 520 ננומטר (ירוק, FITC) ו 433 ננומטר (כחול, DAPI), בהתאמה. לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

נכון לעכשיו פרוטוקולי בידול לעתים נדירות לגרום תאים מובחנים 100%. מסיבות שעדיין יש לטפל תאים מסוימים להתנגד לתהליך הבידול. בהתאם את היעילות של פרוטוקול בידול המשמשים ואת הנטייה של ESC קו מספר מסוים של תאים פלוריפוטנטיים שיורית הם נצפו גם בכינויו לאחר בידול לתוך האנדודרם סופי. תאים שיורית אלו עלולים לפגוע differentiations במורד הזרם או ניתוח נוסף כגון transcriptomics, פרוטאומיקה, וניתוח ביטוי מירנה. תאים פלוריפוטנטיים שיורים או שושלות רצויות אחרות עשויים גם להפגין תופעות paracrine שעשוי להפריע מטרות הבידול. כתוצאה מכך, הסרת תאים אלה עלולות לגרום שחזור משופר.

הטיהור של CXCR4 + לבטא בתאי endoderm לאחר בידול ניתן להשתמש כדי להעשיר אוכלוסיות אלה כדי להסיר תאי מגן מפני תהליך ההתמיינות.החלבון סמן DE המשטח CXCR4 יכול לשמש עבור הטיהור הספציפית של תאים האנדודרם. פרוטוקול טיהור MACS בהישג יד יכול להסתיים בתוך פחות מ 2 שעות וניתן להורג במתכונת גבי ספסל פשוט בכל מעבדה תרבית תאים ללא מכשירים וציוד מעבדה יקר. טיהור FACS היא טכניקה נפוצה אבל מעסיקה בתנאים קשים. במהלך FACS תאי purifications בדרך כלל נשמרים השעיה לתקופה ממושכת של זמן התאים כפופים גורמים אחרים אתגרים, למשל, בלחץ גבוה של הפייה של מכשיר FACS. לשם השוואה ההליך MACS הוא מהיר ועדין. זה משפר את יכולת התאים לצרף במהלך זריעה מחדש לאחר תהליך הטיהור. כדי להמשיך ולהקל שחיבור זה מעכב ROCK מתווסף התקשורת והתרבות לאחר ולפני הטיהור כדי למנוע אפופטוזיס. גורם חשוב נוסף המשפיע שחיבור הוא הצפיפות שבו תאי reseeded. זה depen בחוםDS על שורת תאים בשימוש. מספרי התא המשמש זריעה במחקר זה הם מספר נציג תא שפועלים היטב בידינו. עם זאת, ייתכנו צריך לשנות מספרים אלה עבור שורות תאים שונות. שני הצעדים, התוספת של מעכב ROCK ואת ההערכה של המספרים הסלולריים עבור זריעה מחודשת, הם קריטיים להצלחת תרבות תא הנוספת לאחר המיון.

עם פרוטוקול בידול DE המשמש בדרך כלל> 70% CXCR4 + תאים ניתן להשיג ללא מיון 8. המופע של הפרוטוקול המשמש לייצור DE consequentially משפיע על היעילות של פרוטוקול טיהור MACS שלאחר מכן. באופן כללי, בידול יעיל (> 80% CXCR4 + תאים) מניב טוהר גבוה לאחר מיון MACS (עד 95%). לפיכך, השימוש של שיטת טיהור זה מפחית את מספר תאים שלא עברו התמיינות משמעותית אבל 100 טוהר% לא יכול להיות מושגת. בעתיד, סמני משטח ספציפיים שושלת ניתן להגדיר tכובע יאפשר טיהור של תאים מובחנים סופני יותר. הליך מיון MACS הוא בחירת הממשלה למטרה זו.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

הסיוע הטכני המיומן של יסמין Kresse היא הודתה בהכרת תודה.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics