Een snelle en efficiënte methode voor het zuiveren van Endoderm Cellen Generated van menselijke embryonale stamcellen

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier beschrijven we een werkwijze voor het zuiveren van gedifferentieerde menselijke embryonale stamcellen die zijn toegewijd aan de definitieve endoderm ter verbetering van downstreamtoepassingen en verdere onderverdelingen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De differentiatie mogelijkheden van pluripotente stamcellen zoals embryonale stamcellen (SER) maken voor een potentiële therapeutische toepassing voor celvervangingstherapieën. Terminaal gedifferentieerde celtypen kunnen worden gebruikt voor de behandeling van verschillende degeneratieve ziekten. In vitro differentiatie van deze cellen aan weefsels van de longen, lever en pancreas vereist in de eerste stap het genereren van definitieve endodermale cellen. Deze stap is snelheidsbepalend voor verdere differentiatie richting terminaal rijpte celtypes zoals insuline producerende beta-cellen, hepatocyten of andere endoderm afgeleide celtypen. Cellen die zich inzetten in de richting van de endoderm afstamming sterk drukken een veelheid van transcriptiefactoren zoals FOXA2, Sox17, HNF1B, leden van de familie GATA, en het oppervlak receptor CXCR4. Echter, differentiatie protocollen zelden 100% efficiënt. Hier beschrijven we een werkwijze voor het zuiveren van een CXCR4 + celpopulatie na differentiatiein het voorste via magnetische microkralen. Deze zuivering bovendien verwijdert cellen ongewenste lijnen. De zachte reiniging methode is snel en betrouwbaar en kunnen worden gebruikt om downstream-toepassingen en differentiaties te verbeteren.

Introduction

Pluripotente cellen zoals embryonale stamcellen (SER) hebben de mogelijkheid om te differentiëren in vrijwel elk type cel van het menselijk lichaam. Aldus kan in vitro differentiatie protocollen worden gebruikt om verschillende volwassen celtypes zoals cardiomyocyten 1, hepatocyten 2, 3 beta-cellen, long epitheelcellen 4 of 5 neuronale cellen te genereren. Dit maakt SER een waardevol instrument voor de mogelijke behandeling van verschillende degeneratieve ziekten 3.

De in vitro differentiatie van SER richting volwassen weefsels van de longen, lever en pancreas is een pseudo-gastrulatie in cellen die doet denken aan de definitieve endoderm (DE) 6. Aangezien stroomafwaarts differentiatie naar de genoemde somatische celtypen aanzienlijk minder efficiënt wordt een optimale endoderm differentiatie geacht snelheidsbepalende 7. Cellen die zich inzetten in de richting van de endoderm afstamming ondergaan characteristic veranderingen in hun expressie van genen profiel. Pluripotentie meester regulator genen worden naar beneden gereguleerd, terwijl de expressie van andere transcriptiefactoren zoals FOXA2, Sox17, HNF1B, leden van de familie GATA en het oppervlak receptor CXCR4 is sterk opgereguleerd 6, 8, 9. CXCR4 is bekend dat transactivated door SMAD2 / 3, stroomafwaarts van Nodal / TGF-β signalering en Sox17 gevolg van specifieke bindingsplaatsen in het promotorgebied 10. Aldus is een zeer geschikte marker gebruikt in een aantal rapporten 6, 8, 11-13. Deze uitdrukking veranderingen weerspiegelt een pseudo-gastrulatie event, waarbij SER eerste kenmerken van een primitieve streep-achtige celpopulatie te verwerven en vervolgens te plegen in de kiem endoderm laag 6.

Echter, differentiatie protocollen zelden 100% efficiënt als enkele cellen het differentiatieproces kan weerstaan ​​of differentiëren tot andere ongewenste lijnen 14. Deze cellen kunnen negatief Influenvu verdere differentiatie. Bovendien resterende ongedifferentieerde cellen herbergen grote risico's voor later transplantatie experimenten en kan aanleiding geven tot teratomas 15-17 te geven.

Om deze ongewenste cellen vroeg op het oppervlak marker CXCR4 kan worden gebruikt voor het zuiveren van cellen die zijn toegewijd aan het voorste 18 verwijderen. Hier beschrijven we een werkwijze voor de positieve selectie van CXCR4 + cellen uit DE differentiatie culturen. Hierbij wordt het oppervlak marker CXCR4 gebonden door een antilichaam dat dan op zijn beurt bindt aan magnetische microkralen. Anders dan de zware omstandigheden tijdens FACS-sortering, de magnetisch gemerkte DE-achtige cellen kunnen vervolgens eenvoudig worden gezuiverd in een benchtop formaat met behulp van een zachte zuiveringswerkwijze. Dit protocol verschaft een eenvoudige werkwijze voor het verwijderen van celpopulaties die het voorste differentiatieproces tegengegaan.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Differentiatie van Human ESC naar de Definitive Endoderm

  1. Cultiveren menselijke embryonale stamcellen (SER) in een incubator bij 37 ° C en 5% CO2.
  2. Bekleed een nieuwe 6-well celcultuur plaat met 1 ml van een basaalmembraan matrix en incubeer de kweek-ware gedurende ten minste 30 minuten bij kamertemperatuur. Voor specifieke informatie kunt u zich wenden tot de instructies van de desbetreffende fabrikant.
  3. Controleer of de gekweekte menselijke SER 80% -90% samenvloeiing onder de microscoop met behulp van een lage vergroting (bijvoorbeeld 4X) hebben bereikt. Zuig het medium van de holten te zuigen uit het medium met een steriele glazen Pasteur pipet. Was de cellen eenmaal met fosfaat- gebufferde zoutoplossing (PBS) oplossing. Voor deze, voeg 2 ml PBS aan elk putje zachtjes schudden de plaat en zuigen uit de oplossing om de dode cellen en celresten te verwijderen.
  4. Voeg 1 ml enzym-vrije passage reagens voor zachte dissociatie van celgroepen. Incubeer de cellen bij 37 ° C eend 5% CO2 totdat de cellen vertonen duidelijke tekenen van verstoring in kleine clusters.
    OPMERKING: De incubatietijd is afhankelijk van de gebruikte reagens. Voor de in de sectie materialen genoemd enzym-vrije passage oplossing incubatietijd is ongeveer 7 minuten.
  5. Voeg 1 ml DMEM / F-12 medium en verstoren de resterende celaggregaten in enkele cellen door op en neer pipetteren met een 1 ml pipet tip. Gebruik de cellen van het oppervlak te spoelen en breng de cellen in een centrifugebuis. Alle elementen ophalen, wassen elk putje met 1 ml DMEM / F-12 medium en voeg het medium aan de centrifugebuis.
  6. Centrifugeer de cellen gedurende 5 minuten bij 300 x g. Zuig het supernatant en resuspendeer de cellen in 5 ml ES celcultuur medium dat 10 uM Rho-kinase (ROCK) remmer.
  7. Tel de cellen onder de microscoop met een hemocytometer en zaden 150.000 - 400.000 cellen per 6 putjes of andere plaatindeling, afhankelijk van de ES cellijn. gebruik cultuur medium dat 10 pM ROCK inhibitor apoptose en kweek bij 37 ° C en 5% CO 2 voorkomen dat de cellen in een incubator.
  8. Ongeveer 24 uur na het zaaien aspireren het medium met een steriele glazen Pasteur pipet en voeg 2 ml primitieve streep inductie medium.
    LET OP: Dit medium bevat finale concentraties van 1% glutamine, 0,2% FCS, 5 uM CHIR-99021 en 50 ng / ml activine A in Advanced RPMI-1640-medium. Gewoonlijk gebruiken 2 ml medium voor kweken in 6-well platen.
  9. 48 uur na het zaaien, vervang dan de middellange tot inductie medium endoderm. Cultiveren van de cellen in dit medium een ​​48 uur dagelijkse mediumverversing.
    LET OP: Dit medium bestaat uit 1% glutamine, 0,2% FCS en 50 ng / ml activine A in Advanced RPMI-1640-medium. Cellen die zich inzetten in de richting van de definitieve endoderm drukken de oppervlakte marker CXCR4. De kleuring van CXCR4 kan worden gebruikt om het aantal DE-voorbestemde cellen te kwantificeren.
  1. Voor de laatste 24 uur, maar ten minste 1 uur vóór het verzamelen van cellen toe 10 pM ROCK inhibitor aan het kweekmedium.
  2. Coat de celkweek-software die wordt gebruikt voor het opnieuw enten met een basaalmembraan matrix, dat wil zeggen 12-well platen voor qPCR analyse of kamer objectglaasjes voor immunofluorescentie kleuring. Incubeer de platen of dia gedurende ten minste 30 minuten bij kamertemperatuur.
  3. Zuig het medium met een steriele glazen Pasteur pipet uit de putjes van de gedifferentieerde cellen gebruikt voor het kleuren en / of sorteren.
  4. Voeg 1 ml enzym-vrije passage reagens voor de zachte dissociatie van celgroepen. Incubeer de cellen bij 37 ° C en 5% CO2 totdat de cellen vertonen duidelijke tekenen van verstoring in kleine clusters.
    OPMERKING: De incubatietijd is afhankelijk van de gebruikte reagens. Voor de in de genoemde materialen enzymvrije passages oplossingALS Sectie, incubatietijd is ongeveer 7 min.
  5. Voeg 1 ml DMEM / F-12 medium en verstoren overige celaggregaten in enkele cellen door op en neer pipetteren met een 1 ml tip. Gebruik de cellen van het oppervlak te spoelen en breng de cellen in een centrifugebuis. Alle elementen ophalen, wassen elk putje met 1 ml DMEM / F-12 medium w / o FCS en voeg het medium aan de centrifugebuis.
  6. Tel de cellen onder de microscoop met een hemocytometer. Cellen van drie putjes van een 6-wells plaat zou leiden tot 10-15 x 10 6 cellen na drie dagen van differentiatie. Centrifugeer de cellen gedurende 5 minuten bij 300 x g.
    Opmerking: Het exacte aantal verkregen cellen zal afhangen van de pluripotente cellijn die voor de differentiatie.
  7. Zuig het supernatant en resuspendeer de cellen in PEB-buffer die 10 uM ROCK inhibitor. Met 100 ul van deze buffer tot 10 7 cellen. Voeg de 10 pM ROCK-remmer op de dag van staining. Gebruik deze buffer voor alle downstream-toepassingen (aangeduid als PEB buffer + RI).
    OPMERKING: PEB buffer bevat 0,5% BSA en 2 mM EDTA in PBS. Als er meer cellen worden gekleurd, aan te passen aan de buffer volume dienovereenkomstig.
  8. Voeg 10 ul van een CXCR4-APC antilichaam per 10 7 cellen in 100 ul, dit komt ongeveer overeen met een verdunning van 1:10.
    Opmerking: het gebruik van een APC-gekoppelde antilichaam niet verplicht. In plaats daarvan kan worden vervangen, afhankelijk van de gebruikte microkralen. Als er meer cellen worden gekleurd dienovereenkomstig aan te passen het volume antilichaam.
  9. Meng door voorzichtig omkeren van de buis met de vingers en incuberen bij 4 ° C in een koelkast gedurende 15 minuten. Resuspendeer de cellen met 1-2 ml PEB-buffer. Centrifugeer de cellen gedurende 5 minuten bij 300 x g.
  10. Zuig het supernatant met een steriele glazen Pasteur pipet en resuspendeer de celpellet in 80 pi per PEB 10 7 cellen en voeg 20 ul anti-APC microbolletjes.
    NOTITIE:
  11. Meng door voorzichtig omkeren van de buis met de vingers en incuberen bij 4 ° C in een koelkast gedurende 15 minuten. Resuspendeer de cellen met 1-2 ml PEB buffer + RI. Centrifugeer de cellen gedurende 5 minuten bij 300 x g. Zuig de buffer. Resuspendeer in 500 ui PEB buffer + RI.

3. Magnetische scheiding van CXCR4 + cellen

  1. Plaats een middelgrote magnetische kolom in een magnetisch veld volgens vervaardiging instructies. Pre-spoel de kolom met 500 pi PEB buffer + RI. Breng de gehele celsuspensie op de kolom. Verzamel de stroom door aangezien niet alle cellen zullen binden aan de kolom. Zorg ervoor dat niet om de kolommen te storen voor een optimale ophalen van CXCR4 + cellen.
  2. Was de kolom driemaal met 500 ul buffer PEB + RI. Het verzamelen van de eerste stroom door en deze combineren met de verzamelde cellen uit stap 3.1. Verwijder de magnetische kolom uit het magnetische veld en plaats het in eengeschikt collectie buis. Voeg 1 ml PEB buffer + RI op de kolom. Om elueren de cellen stevig druk de zuiger in de kolom.
  3. Optioneel: Verzamel alle stroming door monsters afzonderlijk gebruiken 20 pi elk van het aantal CXCR4 + cellen met flowcytometrie geanalyseerd. Hun aantal moet afnemen bij iedere wasstap.
    LET OP: Minstens 2 x 10 4 levensvatbare, gated cellen moeten worden geteld voor betrouwbare resultaten.
  4. Herhaal stap 3,1-3,3 met de verzamelde-doorstroming monster uit stap 3.1 en de eerste stroom door monster van stap 3.2 met behulp van een nieuwe kolom. Niet opnieuw gebruik maken van de vorige kolom. Via de plunjer lucht wordt geperst in de kolom, die blokkeert.
  5. Tel de cellen onder de microscoop met een hemocytometer. Afhankelijk van de efficiëntie van de differentiatie tot 6 x 10 6 cellen kunnen eerst worden gesorteerd en een 1 x 10 6 cellen door een tweede kolom bij gebruik 10 7 cellen voor de procedure. Centrifugeer de cellen bij 300 g gedurende 5 min. Zuig het supernatant en van een steriele glazen Pasteur pipet en resuspendeer de cellen in 1 ml endoderm inductie medium uit stap 1.9 met extra 10 pM ROCK inhibitor.
  6. Tel de cellen onder de microscoop met een hemocytometer. Zaad van de cellen met een geschikte dichtheid, dat wil zeggen, ~ 4 x 10 5 cellen per putje van een 12-well plaat (ong. 3,6 cm2 oppervlak) of ~ 1,5 x 10 5 cellen per putje van een 8-well kamer-slide.

4. Optioneel: Analyse van gezuiverde Definitive Endoderm Bevolking

  1. Voor immunofluorescentiekleuring zet de gezuiverde cellen uit stap 3,7 ongeveer 24 uur na enten met 4% paraformaldehyde en vlekken definitieve endoderm (DE) en / of pluripotentie marker eiwitten.
    LET OP: Veelgebruikte DE merkers omvatten FOXA2 en Sox17, vaak gebruikt pluripotentie markers omvatten Oct3 / 4, NANOG en SOX2 6, 8.
  2. for RT-qPCR analyse, de oogst van de gezuiverde cellen direct of 24 uur na het zaaien, te extraheren totaal-RNA en reverse transcriberen cDNA uit de uitgepakte totaal-RNA-monsters. Met 10 ng cDNA als matrijs per RT-qPCR reactie (triplo's) bij de expressie van DE en pluripotentie markergenen 6, 8 analyseren.
    LET OP: Veel gebruikte merkergenen worden vermeld in stap 4.1. Cyclusomstandigheden zijn 5 min bij 95 ° C en 40 cycli van 15 sec bij 95 ° C en 1 minuut bij 60 ° C, gevolgd door smeltcurve analyse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

na differentiatie SER ondergaan drastische veranderingen in gen- en eiwitexpressie. Figuur 1 toont typische merkergenen die kan worden gebruikt om een succesvolle endoderm differentiatie verifiëren. Prime doelstellingen voor een genexpressie analyse GSC, FOXA2 en Sox17. In een relatieve genexpressie analyse vooral FOXA2 en Sox17 worden verhoogd met> 2.000-voudig in vergelijking met ongedifferentieerde SER. GSC is al heel vroeg binnen de 24 uur die tijdens primitieve streep vorming maar het is niettemin geïnduceerd> 100 maal op dag vier. De expressie van deze genen wordt derhalve verhoogd na sortering met de CXCR4 oppervlaktemarker 6. Pluripotentie meester regulators zoals Oct3 / 4 (POU5F1) en NANOG aanzienlijk downgereguleerde hoewel de expressie van deze genen nog steeds wordt waargenomen na vier dagen. deze indicates dat sommige cellen niet adequaat te reageren op de behandeling regime met CHIR-99021 en activine A. SOX7 genexpressie wordt meestal gericht aan extra-embryonaal endoderm formatie tegen DE discrimineren. In het eerste geval is Sox17 gecoëxpresseerde met SOX7 en in het laatste geval Sox17 co-expressie met FOXA2. De resultaten in figuur 1 blijkt dat naast DE extra-embryonale cellen gedurende differentiatie gevormd, hoewel we nog niet kunnen SOX7 + cellen te kleuren zijn.

Figuur 2 illustreert de verschillende celpopulaties die aanwezig is na de differentiatie van de SER in het voorste zijn. In Stap 1 SER worden gezaaid als enkele cellen en vervolgens gedifferentieerd door behandeling met CHIR-99021 en activine A voor vier dagen. De IF kleuring van het voorste markers Sox17 en FOXA2 (Figuur 2A) blijkt dat beide markers uniform co-expressed in de kernen. Dit wordt beschouwd als een kenmerk van DE engagement. Sommige cellen weerstaan ​​het differentiatieproces en drukken geen van beide DE marker proteïnen (Figuur 2A). In feite zijn twee verschillende celpopulaties waargenomen na vier dagen differentiatie. Terwijl veel cellen drukken de DE marker FOXA2 zijn er nog cellen die overblijven die de pluripotentie marker SOX2 (Figuur 2B) uit te drukken. Deze twee eiwitten zijn uitgedrukt in twee verschillende populaties en geen co-expressie kan worden waargenomen (figuur 2B).

Op dag drie of vier van de differentiatie oppervlakte-eiwit CXCR4 wordt gebruikt om het voorste geëngageerde CXCR4 + populatie sorteren en daardoor de resterende pluripotente cellen en andere ongewenste geslachten verwijderen. Afhankelijk van de differentiatie efficiëntie van de gebruikte cellijn> 80% CXCR4 + cellen kunnen worden verkregen met de differentiatie protocol beschreven in Stap 1 8 Figuur 3 beeldt doorstroomcytometrie gegevens na kleuring en MACS zuivering van CXCR4 + cellen na differentiatie richting DE en toont de expressie van gemeenschappelijke dE en pluripotentie marker eiwitten middels immunofluorescentie (IF) kleuring voor en na MACS zuivering. Op dag drie van differentiatie ongeveer 60% CXCR4 + cellen met behulp van de immunofluorescentie kleuring voor CXCR4 in stap 2 beschreven werden verkregen (Figuur 3A, middelste paneel). CXCR4 + cellen verplaatsen van Q4 Q1 na kleuring met APC geconjugeerd anti-CXCR4 antilichaam. Na de MACS zuivering in stap 3 beschreven de CXCR4 + populatie is verrijkt tot 85%. Het zuiveringsproces is echter niet elimineren alle ongewenste lijnen van het kweken (figuur 3A, rechter paneel).

Na de MACS zuiveringde CXCR4 + cellen worden gezaaid voor verdere analyse of eventueel een tweede ronde van sortering kan worden uitgevoerd hogere zuiverheden maar verminderde levensvatbaarheid opleveren. Voorafgaand aan de wijdverbreide expressie van de pluripotentie marker SOX2 (gekleurd in groen) differentiatie wordt gedetecteerd door IF kleuring. Daarentegen kan het voorste marker FOXA2 (rood gekleurd) niet detecteerbaar (Figuur 3B). In figuur 3C CXCR4 + cellen worden gekleurd met antilichamen voor FOXA2 (groen) en zijn co-gekleurd voor de pluripotentie marker SOX2 (rood). Na enten van de gezuiverde CXCR4 + cellen slechts enkele SOX2 + cellen worden gedetecteerd. De meerderheid van de gezaaide cellen zijn positief voor de marker DE FOXA2.

Figuur 1
Figuur 1. Representatieve veranderingen in genexpressie van verschillende pluripotentie en endoderm merkergenen gedurende vier dagen endoderm differentiatie. (EEN) 7, een behandeling met activine A alleen, en CA-A (CHIR-99.021 en activine A) het protocol, dat wordt gebruikt voor MACS sortering (zie details in 8). De in het CA-A protocol media worden hier aangeduid als primitieve streep inductiemedium en endoderm inductiemedium. (B) Afgebeeld is de genexpressie gemeten met RT-qPCR SGR, Sox17 en FOXA2, die bij de definitieve endoderm inzet worden uitgedrukt zonder verder MACS sortering. POU5F1 (Oct3 / 4) en NANOG zijn pluripotentie toezichthouders en typisch omlaag gereguleerd na differentiatie, terwijl SOX7 wordt uitgedrukt in extra-embryonaal endoderm. Genexpressie werd genormaliseerd tegen drie stabiel tot expressie housekeeping genen (<em> TBP, TUBA1A, G6PD) wat resulteert in CNRQ waarden. De expressie van de genoemde genen in ongedifferentieerde cellen werd ingesteld op 1 en veranderingen worden uitgezet als factor van verandering van genexpressie. Waarden zijn gemiddelden ± SEM, n = 4-5. ANOVA plus Bonferroni's post hoc-test. ** P ≤ 0,01 in vergelijking met Random en #P ≤ 0,05, ## P ≤ 0,01, vergeleken met RP (alle gegevens in dit cijfer zijn onlangs gepubliceerd in 8). Klik hier om een grotere versie van deze figuur te bekijken.

figuur 2
Figuur 2. Verschillende celpopulaties na endoderm differentiatie. (A) Kleuring van het voorste markers Sox17 en FOXA2 met onderscheidenlijke antilichamen op d4 differentiatie openbaart hun homogene co-lokalisatie. Sommigecellen weerstond de differentiatie proces en hebben deze markers niet uitdrukken (alleen blauwe kern kleuring). Het samenvoegen van de groene en rode kleuring wordt getoond in het geel. (B) Na DE differentiatie er twee verschillende celpopulaties. DE-achtige cellen brengen FOXA2 terwijl cellen die de differentiatie proces verzet nog steeds de pluripotentie marker SOX2 uiten. (AB) Kernen werden tegengekleurd met DAPI (blauw). Schaalbalk in paneel (A) is 50 urn en in paneel (B) is 100 uM. Beeldvorming werd uitgevoerd bij 670 nm (rood, Cy5), 520 nm (groen, FITC) en 433 nm (blauw, DAPI) uitgevoerd, respectievelijk. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3. MACS sortering van gedifferentieerde DE celpopulaties en representatieve staining na sortering. (A) CXCR4 + gekleurde cellen (Q1) worden verrijkt na MACS sortering. Het aantal CXCR4 cellen (Q4) wordt verminderd. Afhankelijk van de cellijn wordt gebruikt differentiatie protocol rendement> 80% CXCR4-positieve cellen 8 en MACS kan worden gebruikt om deze verder te verrijken. (B) ongedifferentieerde cellen brengen de pluripotentie marker SOX2 (groen) maar niet het voorste marker FOXA2 (red ). (C) Na de MACS sortering slechts zeer weinig ongedifferentieerde SOX2 + cellen blijven (rood), terwijl de gesorteerde populatie bijna uniform drukt de dE marker FOXA2 (groen). (BC) Kernen werden tegengekleurd met DAPI (blauw). Schaalbalk in panel (C) is 100 urn en geldt voor alle panelen. Beeldvorming werd uitgevoerd bij 670 nm (rood, Cy5), 520 nm (groen, FITC) en 433 nm (blauw, DAPI) uitgevoerd, respectievelijk. Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Op dit moment gebruikt differentiatie protocollen zelden tot 100% gedifferentieerde cellen. Om redenen die nog moeten worden aangepakt sommige cellen weerstaan ​​aan de differentiatie proces. Afhankelijk van de efficiëntie van de gebruikte differentiatie protocol en de neiging van het ESC lijn een aantal residuele pluripotente cellen worden vaak waargenomen, zelfs na differentiatie in de definitieve endoderm. Deze resterende cellen kunnen stroomafwaarts differentiaties of verdere analyse, zoals transcriptomics, proteomics, en miRNA expressie analyse aantasten. Residuele pluripotente cellen of andere ongewenste lijnen ook paracriene effecten die kunnen interfereren met de doelen differentiatie vertonen. Bijgevolg kan het verwijderen van deze cellen leiden tot een betere reproduceerbaarheid.

De zuivering van tot expressie CXCR4 + endoderm cellen na differentiatie kan worden gebruikt om deze populaties te verrijken en cellen die het differentiatieproces weerstand te verwijderen.Het oppervlak DE markerproteïne CXCR4 kan worden gebruikt voor de specifieke zuivering van endoderm cellen. De MACS zuivering protocol bij de hand kan in minder dan 2 uur worden voltooid en kan worden uitgevoerd in een eenvoudige bench top-formaat in elke celkweek lab zonder dure laboratorium apparatuur en apparaten. FACS zuivering is een veel gebruikte techniek, maar maakt gebruik van zware omstandigheden. Tijdens FACS zuiveringen cellen worden gewoonlijk in suspensie gedurende een langere tijd en de cellen worden onderworpen aan andere uitdagende factoren, bijvoorbeeld hoge druk in het mondstuk van het apparaat FACS. Ter vergelijking: de MACS procedure is snel en zacht. Dit verbetert het vermogen van de cellen om weer vast tijdens reseeding na het zuiveringsproces. Deze herbevestiging verder vergemakkelijkt een ROCK inhibitor wordt toegevoegd aan het kweekmedium na en voorafgaande aan de zuivering apoptose voorkomen. Een andere belangrijke factor die hernieuwde hechting beïnvloedt de dichtheid waar cellen reseeded. Deze sterk afhankeds van de gebruikte cellijn. De celaantallen voor zaaien in deze studie zijn representatief celaantallen die goed in de hand. Er kunnen worden moeten deze nummers aanpassen aan verschillende cellijnen. Beide maatregelen, de toevoeging van een remmer ROCK en de evaluatie van de celaantallen voor opnieuw plannen zijn essentieel voor het succes van de verdere celkweek na het sorteren.

Met de gebruikte DE differentiatie protocol typisch> 70% CXCR4 + cellen kunnen worden verkregen zonder sortering 8. De prestatie van het protocol voor DE generatie consequentially beïnvloedt de efficiëntie van de daaropvolgende MACS zuiveringsprotocol. In het algemeen efficiënt differentiatie (> 80% CXCR4 + cellen) levert een hogere zuiverheid na MACS sortering (tot 95%). Dus het gebruik van deze zuiveringswerkwijze vermindert het aantal ongedifferentieerde cellen maar nagenoeg 100% zuiverheid niet worden verkregen. In de toekomst kan lineage specifieke oppervlakte merkers worden gedefinieerd tpet de zuivering van meer terminaal gedifferentieerde cellen mogelijk. De MACS sorting procedure is het belangrijkste voor dit doel.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

De bekwame technische bijstand van Jasmin Kresse is dankbaar erkend.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics