Eine schnelle und effiziente Methode zur Reinigung von Entodermzellen generiert aus humanen embryonalen Stammzellen

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier beschreiben wir ein Verfahren zur Reinigung von differenzierten humanen embryonalen Stammzellen, die in Richtung der endgültigen Endoderm zur Verbesserung der Downstream-Anwendungen und weitere Differenzierungen begangen werden.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die Differenzierung Fähigkeiten von pluripotenten Stammzellen wie embryonale Stammzellen (ES-Zellen) ermöglichen eine mögliche therapeutische Anwendung für Zell-Ersatz-Therapien. Ausdifferenzierten Zelltypen könnten für die Behandlung von verschiedenen degenerativen Krankheiten verwendet werden. In vitro Differenzierung dieser Zellen gegenüber Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert als ersten Schritt die Erzeugung von endgültigen endodermalen Zellen. Dieser Schritt ist geschwindigkeitsbestimmend für die weitere Differenzierung zu endständig gereiften Zelltypen, wie beispielsweise Insulin-produzierenden Beta-Zellen, Hepatozyten oder anderen Endoderm-abgeleiteten Zelltypen. Die Zellen, die in Richtung der endoderm Linie verpflichtet sind ausdrücken sehr eine Vielzahl von Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA-Familie, und der Oberflächenrezeptor CXCR4. Allerdings Differenzierungsprotokolle sind selten 100% effizient. Hier beschreiben wir ein Verfahren zur Reinigung eines CXCR4 + Zellpopulation nach der Differenzierungin der DE durch magnetische Mikrokugeln verwendet. Diese Reinigung entfernt zusätzlich Zellen von unerwünschten Linien. Die sanfte Reinigungsverfahren ist schnell und zuverlässig und kann verwendet werden, Downstream-Anwendungen und Differenzierungen zu verbessern.

Introduction

Pluripotente Stammzellen wie embryonale Stammzellen (ES-Zellen) haben die Fähigkeit, in nahezu jedem Zelltyp des menschlichen Körpers zu unterscheiden. Somit können in vitro Differenzierungsprotokollen verwendet werden , um zahlreiche adulten Zelltypen wie Kardiomyozyten 1, Hepatozyten 2, beta - Zellen 3, 4 oder Lungenepithelzellen neuronalen Zellen 5 erzeugen. Dies macht WSR ein wertvolles Werkzeug für die mögliche Behandlung von verschiedenen degenerativen Erkrankungen 3.

Die in vitro Differenzierung von ES- Zellen gegenüber adulten Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert eine pseudo-Gastrulation in Zellen erinnert an die definitive Endoderm (DE) 6. Da stromabwärts Differenzierung gegenüber den zuvor erwähnten Arten somatischer Zellen wesentlich weniger effizient ist, wird eine optimale Differenzierung Endoderm gilt als geschwindigkeitsbestimmender 7. Die Zellen, die in Richtung der endoderm Linie begangen werden laufen characteristic Veränderungen in ihrem Genexpressionsprofil. Pluripotenz Master - Regulator - Gene herunterreguliert, während die Expression von anderen Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA - Familie und der Oberflächenrezeptor CXCR4 hoch 6 hochreguliert wird, 8, 9. CXCR4 bekannt durch SMAD2 zu trans / 3, hinter Nodal / TGF-β - Signalisierung und SOX17 aufgrund der spezifischen Bindungsstellen in seiner Promotorregion 10. Somit ist es ein sehr geeignet in einer Reihe von Berichten verwendet Marker 6, 8, 11-13. Diese Expressions Änderungen spiegelt eine Pseudo-gastrulation Ereignis, bei dem WSR erste Merkmale eines primitiven streifenartige Zellpopulation zu erwerben und anschließend begehen in die endoderm Keimschicht 6.

Allerdings sind Differenzierungsprotokolle selten 100% effizient wie wenige Zellen den Differenzierungsprozess widerstehen kann oder Differenzierung gegenüber anderen unbeabsichtigten Linien 14. Diese Zellen können sich negativ auf Influence weitere Differenzierung. Darüber hinaus bergen Rest undifferenzierten Zellen große Risiken für spätere Experimente Transplantation und kann zu teratomas 15-17 geben.

So entfernen Sie können diese unerwünschten Zellen früh auf den Oberflächenmarker CXCR4 zur Reinigung von Zellen verwendet werden , die in Richtung der DE 18 verpflichtet sind. Hier beschreiben wir ein Verfahren für die positive Selektion von CXCR4 + -Zellen aus DE Differenzierungskulturen. Hierzu wird die Oberflächenmarker CXCR4 durch einen Antikörper gebunden, der dann wiederum mit magnetischen Microbeads bindet. Im Gegensatz zu den harten Bedingungen während FACS-Sortierung, die magnetisch markierten DE-ähnlichen Zellen können dann leicht in einem Benchtop-Format gereinigt werden, um eine sanfte Reinigungsverfahren verwendet wird. Dieses Protokoll stellt eine einfache Methode zur Entfernung von Zellpopulationen, die die DE Differenzierungsprozess widerstanden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Differenzierung humaner ESC in Richtung Definitive Endoderm

  1. Kultivieren humaner embryonaler Stammzellen ( ES- Zellen) in einem Inkubator bei 37 ° C und 5% CO 2.
  2. Mantel ein neues 6-Well-Zellkulturplatte mit 1 ml einer Basalmembranmatrix und brüten die Kultur-ware für mindestens 30 min bei RT. Für spezielle Informationen wenden Sie sich an die Anweisungen des jeweiligen Herstellers.
  3. Bestätigen Sie, dass die kultivierten menschlichen WSR 80% -90% Konfluenz unter dem Mikroskop erreicht haben eine geringe Vergrößerung (zB, 4X). Anzusaugen, das Medium aus den Hohlräumen durch das Medium mit einer sterilen Pasteur-Glaspipette Absaugen. Waschen Sie die Zellen einmal mit phosphatgepufferter Salzlösung (PBS) -Lösung. Dazu werden 2 ml PBS in jede Vertiefung sanft die Platte schütteln und die Lösung absaugen, um tote Zellen und Zelltrümmer zu entfernen.
  4. 1 ml der enzymfreien Passagierung Lösung Reagenz für sanfte Dissoziation von Zellclustern. Inkubieren der Zellen bei 37 ° C eind 5% CO 2 , bis die Zellen deutliche Anzeichen einer Störung in kleinen Clustern zeigen.
    HINWEIS: Die Inkubationszeit auf dem Reagenz hängt verwendet. Für die enzymfreie Passagierbarkeit Lösung in dem Materialien Abschnitt erwähnt, ist die Inkubationszeit etwa 7 min.
  5. 1 ml DMEM / F-12-Medium und stören die verbleibenden Zellaggregate in einzelne Zellen durch Pipettieren nach oben und unten eine 1 ml Pipettenspitze. Verwenden, die Zellen von der Oberfläche zu spülen und die Zellen in ein Zentrifugenröhrchen übertragen. Um alle Zellen abrufen, waschen Sie jede Vertiefung mit 1 ml DMEM / F-12-Medium und fügen Sie das Medium zu dem Zentrifugenröhrchen.
  6. Zentrifugation der Zellen 5 min bei 300 x g. Den Überstand aspirieren und resuspendieren Zellen in 5 ml ES-Zellkulturmedium 10 uM Rho-Kinase (ROCK) Inhibitor enthält.
  7. Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer und Samen 150.000 - 400.000 Zellen pro 6-well oder in einem anderen Plattenlayout, abhängig von der ES-Zelllinie verwendet. Verwenden culture - Medium , das 10 uM ROCK Inhibitor der Apoptose und Kultur der Zellen in einem Inkubator zu vermeiden , bei 37 ° C und 5% CO 2.
  8. Etwa 24 Stunden nach der absaugen das Medium mit einer sterilen Pasteur-Glaspipette Säen und 2 ml Primitivstreifen Induktionsmedium.
    Hinweis: Dieses Medium enthält Endkonzentrationen von 1% Glutamin, 0,2% FCS, 5 uM CHIR-99021 und 50 ng / ml Activin A in Advanced RPMI-1640 - Medium. Üblicherweise verwenden 2 ml Medium für den Anbau in 6-Well-Platten.
  9. 48 Stunden nach dem Aussäen, ersetzen Sie das Medium Induktionsmedium zu Entoderm. Pflegen Sie die Zellen in diesem Medium für weitere 48 Stunden mit täglicher Mediumwechsel.
    HINWEIS: Dieses Medium enthält 1% Glutamin, 0,2% FCS und 50 ng / ml Activin A in Advanced RPMI-1640 - Medium. Die Zellen, die in Richtung der endgültigen endoderm begangen werden, um die Oberflächenmarker CXCR4 exprimieren. Die Färbung von CXCR4 kann verwendet werden, um die Anzahl der DE-determinierten Zellen zu quantifizieren.
  1. Für den letzten 24 Stunden, aber mindestens 1 Stunde vor der Ernte die Zellen werden 10 & mgr; M ROCK-Inhibitor zu dem Kulturmedium.
  2. Bestreichen Sie die Zellkultur-ware, die zur Wiederverwendung Impfen mit einer Basalmembranmatrix verwendet werden, das heißt, 12-Well - Platten für die qPCR - Analyse oder eine Kammer Dias für Immunfluoreszenzanfärbung. Inkubieren der Platten oder Folien für mindestens 30 min bei RT.
  3. Anzusaugen, das Medium mit einer sterilen Pasteur-Glaspipette aus den Vertiefungen der differenzierten Zellen verwendet zum Färben und / oder sortiert werden.
  4. 1 ml enzymfreien Passagierung Lösung Reagens zur schonenden Spaltung von Zellclustern. Inkubieren Sie die Zellen bei 37 ° C und 5% CO 2 , bis die Zellen deutliche Anzeichen einer Störung in kleinen Clustern zeigen.
    HINWEIS: Die Inkubationszeit auf dem Reagenz hängt verwendet. Für die enzymfreien Passagierung Lösung im Materi erwähntals Abschnitt, ist die Inkubationszeit etwa 7 min.
  5. 1 ml DMEM / F-12-Medium und stören verbleibenden Zellaggregate in einzelne Zellen durch Pipettieren nach oben und unten eine 1 ml-Spitze mit. Verwenden, die Zellen von der Oberfläche zu spülen und die Zellen in ein Zentrifugenröhrchen übertragen. Um alle Zellen abrufen, waschen Sie jede Vertiefung mit 1 ml DMEM / F-12-Medium w / o FCS und fügen Sie das Medium zu dem Zentrifugenröhrchen.
  6. Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Zellen von drei Vertiefungen einer Platte mit 6 Vertiefungen in 10-15 x 10 6 Zellen nach drei Tagen der Differenzierung führen. Zentrifugation der Zellen 5 min bei 300 x g.
    HINWEIS: Die genaue Zahl der erhaltenen Zellen wird auf der pluripotenten Zelllinie für die Differenzierung verwendet abhängen.
  7. Den Überstand aspirieren und resuspendieren Zellen in PEB-Puffer 10 & mgr; M ROCK-Inhibitor enthält. Verwenden von 100 & mgr; l dieses Puffers für bis zu 10 7 Zellen. Fügen Sie die 10 & mgr; M ROCK-Inhibitor am Tag der staining. Verwenden Sie diesen Puffer für alle Downstream-Anwendungen (bezeichnet als PEB-Puffer + RI).
    HINWEIS: PEB - Puffer 0,5% BSA und 2 mM EDTA in PBS enthält. Wenn mehr Zellen werden gefärbt sind, justieren Sie entsprechend den Puffervolumen.
  8. In 10 ul eines CXCR4-APC - Antikörper pro 10 7 Zellen in 100 & mgr; l, das entspricht etwa einer Verdünnung von 1:10.
    HINWEIS: Die Verwendung eines APC-verknüpften Antikörper ist nicht zwingend. Stattdessen kann es verwendet in Abhängigkeit von den Mikrokugeln ersetzt werden. Wenn mehr Zellen entsprechend den Antikörper Volumen gefärbt werden sind einzustellen.
  9. Mischen Sie vorsichtig den Schlauch mit den Fingern blätterte und Inkubation bei 4 ° C im Kühlschrank für 15 min. Resuspendieren der Zellen mit 1-2 ml PEB-Puffer. Zentrifugation der Zellen 5 min bei 300 x g.
  10. Saugen Sie den Überstand mit einer sterilen Pasteur - Glaspipette und Zellpellet in 80 ul PEB pro 10 7 Zellen und fügen Sie 20 ul anti-APC - Mikrokügelchen.
    HINWEIS:
  11. Mischen Sie vorsichtig den Schlauch mit den Fingern blätterte und Inkubation bei 4 ° C im Kühlschrank für 15 min. Resuspendieren der Zellen mit 1-2 ml PEB-Puffer + RI. Zentrifugation der Zellen 5 min bei 300 x g. Absaugen den Puffer. Resuspendieren in 500 ul PEB-Puffer + RI.

3. Magnetische Trennung von CXCR4 + Zellen

  1. Legen Sie eine mittlere magnetische Säule in einem Magnetfeld nach Herstellung Anweisungen. Vorspülen der Säule mit 500 ul PEB-Puffer + RI. Tragen Sie die gesamte Zellsuspension auf die Säule. Sammeln Sie die Strömung durch, da nicht alle Zellen an die Säule binden. Achten Sie darauf, nicht die Spalten für eine optimale Wiedergewinnung von CXCR4 + Zellen zu stören.
  2. Die Säule wird dreimal mit 500 ul PEB-Puffer + RI. Sammeln Sie die erste Strömung durch und kombinieren es mit den gesammelten Zellen aus Schritt 3.1. Entfernen Sie die Magnetsäule aus dem Magnetfeld und legen Sie sie in eingeeignete Sammelröhrchen. 1 ml PEB-Puffer + RI auf die Säule. Zum Eluieren die Zellen drücken Sie fest um den Kolben in die Säule.
  3. Optional: Sammeln Sie alle Fluss durch Proben getrennt und verwenden 20 ul jeweils die Anzahl der CXCR4 + Zellen mittels Durchflusszytometrie analysiert. Ihre Zahl sollte mit jedem Waschschritt zurückgehen.
    HINWEIS: Mindestens 2 x 10 4 lebensfähig, sollte gated Zellen für zuverlässige Ergebnisse gezählt werden.
  4. Wiederholen Sie die Schritte 3,1-3,3 mit dem gesammelten Strom durch Probe aus Schritt 3.1 und der ersten Strömung durch Probe aus Schritt 3.2 eine neue Spalte. Sie nicht die vorherige Spalte wiederverwenden. Durch die Verwendung der Kolben Luft in die Säule gedrückt werden, es blockier.
  5. Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Abhängig von der Effizienz der Differenzierung von bis zu 6 x 10 6 Zellen kann zunächst und noch 1 x 10 6 Zellen sortiert werden , indem eine zweite Spalte bei 10 7 Zellen für das Verfahren. Zentrifugieren der Zellen bei 300 xg für 5 min. Absaugen und der Überstand wird mit einer sterilen Pasteur-Glaspipette und Resuspendieren der Zellen in 1 ml Endoderm Induktionsmedium aus Schritt 1.9 mit zusätzlichen 10 & mgr; M ROCK-Inhibitor.
  6. Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Seed die Zellen bei einer geeigneten Dichte, dh ~ 4 x 10 5 Zellen pro Vertiefung einer 12-Well - Platte (ca. 3,6 cm 2 Fläche) oder ~ 1,5 x 10 5 Zellen pro Vertiefung eines 8-Well - Kammer-Folie.

4. Optional: Analyse von gereinigtem Definitive Endoderm Bevölkerung

  1. Für Immunfluoreszenzanfärbung fixieren die gereinigten Zellen aus Schritt 3.7 in etwa 24 Stunden nach der mit 4% Paraformaldehyd und Beize für die endgültige Endoderm (DE) und / oder Pluripotenz Markerproteine ​​Aussaat.
    HINWEIS: Häufig verwendete DE Marker umfassen FOXA2 und SOX17, häufig verwendete Pluripotenz Marker umfassen OCT3 / 4, NANOG und SOX2 6, 8.
  2. for RT-qPCR-Analyse, ernten die gereinigten Zellen direkt oder 24 h nach dem Aussäen extrahieren Total-RNA und transkribieren Reverse-cDNA aus den extrahierten Gesamt-RNA-Proben. Verwenden , 10 ng cDNA als Matrize pro RT-qPCR - Reaktion (Triplikaten) 6, um die Expression von DE und Pluripotenz Markergene 8 zu analysieren.
    HINWEIS: Häufig verwendete Markergene werden in Schritt 4.1 erwähnt. Zyklusbedingungen sind 5 min bei 95 ° C und 40 Zyklen von 15 sec bei 95 ° C und 1 min bei 60 ° C, gefolgt von einer Schmelzkurvenanalyse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Bei der Differenzierung WSR laufen drastischen Veränderungen in der Gen und Proteinexpression. Figur 1 typische Markergene darstellt , die verwendet werden können , eine erfolgreiche Endoderm Differenzierung zu verifizieren. Prime Ziele für eine Genexpressionsanalyse sind GSC, FOXA2 und SOX17. In einer relativen Analyse der Genexpression insbesondere FOXA2 und SOX17 erhöht von> 2.000 - fache , wenn sie undifferenziert WSR verglichen. GSC ist bereits zum Ausdruck sehr früh innerhalb von 24 Stunden während der Primitivstreifen Bildung aber es ist dennoch induziert> 100-fach am Tag vier. Die Expression dieser Gene wird folglich erhöht auf die Sortierung der CXCR4 - Oberflächenmarker 6 verwendet wird . Pluripotenz Master Regler wie OCT3 / 4 (Pou5f1) und NANOG signifikant heruntergeregelt , obwohl die Expression dieser Gene nach vier Tagen noch nachweisbar ist. Diese indicates , dass einige Zellen mit CHIR-99021 und Activin A. SOX7 Genexpression nicht ausreichend auf die Behandlung Regime reagieren wird typischerweise gerichtet gegen DE außer embryonalen Endoderm Bildung zu unterscheiden. Im ersten Fall ist SOX17 coexprimiert mit SOX7 und im letzteren Fall ist SOX17 coexprimiert mit FOXA2. Die Ergebnisse sind in Abbildung 1 zeigen , dass zusammen mit DE einige zusätzliche embryonale Zellen bei der Differenzierung gebildet haben können, obwohl wir noch nicht gelungen, SOX7 + Zellen zu färben.

Abbildung 2 zeigt die verschiedenen Zellpopulationen , die nach der Differenzierung von ES- Zellen in der DE vorhanden sind. In Schritt 1 WSR werden als einzelne Zellen beimpft und dann durch Behandlung mit CHIR-99021 und Activin A für vier Tage differenziert. Die IF - Färbung der DE - Marker SOX17 und FOXA2 (2A) zeigt , dass beide Markierungen sind gleichmäßig Co-expressed innerhalb der Kerne. Dies wird als ein Markenzeichen der DE Verpflichtung angesehen. Allerdings wider einige Zellen die Differenzierung und Express keiner der beiden DE Markerproteine ​​(2A). In der Tat zwei unterschiedliche Zellpopulationen werden nach der viertägigen Differenzierung beobachtet. Während viele Zellen die DE Marker FOXA2 dort exprimieren , sind noch verbleibenden Zellen, die die Pluripotenz Marker SOX2 (2B) zum Ausdruck bringen. Diese beiden Proteine ​​werden in zwei getrennten Populationen exprimiert und kein Co-Expression kann (2B) beobachtet werden.

An Tag drei oder vier der Differenzierung wird das Oberflächenprotein CXCR4 verwendet, um den DE-committed CXCR4 + Bevölkerung zu sortieren und damit die verbleibenden pluripotenten Zellen und die andere unerwünschte Linien zu entfernen. In Abhängigkeit von der Differenzierung Effizienz der verwendeten Zelllinie> 80% CXCR4 + Zellen können die Differenzierung Protokoll in Schritt 1 8 skizziert erhalten werden unter Verwendung von Abbildung 3 - Zytometrie Daten zeigt fließen nach dem Färben und MACS Reinigung von CXCR4 + Zellen nach Differenzierung in Richtung DE und zeigt die Expression von Proteinen gemeinsam DE und pluripotenz Marker Immunofluoreszenz (IF) Färbung vor und nach der MACS Reinigung. Am dritten Tag der Differenzierung rund 60% CXCR4 + Zellen die Immunfluoreszenzfärbung für CXCR4 beschrieben in Schritt 2 erhalten wurden (3A, Mitte) mit. CXCR4 + Zellen von Q4 Q1 bewegen auf mit einer APC-konjugierter anti-CXCR4-Antikörper-Färbung. Nach der Reinigung in Schritt 3 beschrieben MACS ist die CXCR4 + Bevölkerung auf 85% angereichert. Der Reinigungsprozess, beseitigt jedoch nicht alle unerwünschten Linien aus den Kulturen (3A, rechts).

Nach der MACS Reinigung,die CXCR4 + Zellen können zur weiteren Analyse oder gegebenenfalls eine zweite Runde der Sortierung kann durchgeführt werden, um zu ergeben höhere Reinheiten aber eine verminderte Lebensfähigkeit ausgesät werden. Vor der weitverbreitete Expression des Pluripotenz Marker SOX2 (gefärbt in grün) zur Differenzierung wird durch IF-Färbung nachgewiesen. Im Gegensatz dazu kann der DE Marker FOXA2 (gefärbt in rot) nicht detektiert (3B) werden. In 3C CXCR4 + Zellen werden mit Antikörpern für FOXA2 (grün) gefärbt und für die Pluripotenz Marker SOX2 (rot) co-gefärbt. Nach dem Aussäen der gereinigten CXCR4 + -Zellen nur wenige SOX2 + Zellen werden erkannt. Die Mehrheit der ausgesäten Zellen sind positiv für die DE Marker FOXA2.

Abbildung 1
Abbildung 1. Repräsentative Veränderungen in der Genexpression verschiedener Pluripotenz und endoderm Markergene während einer 4 Tage endoderm Differenzierung. (EIN) 7 eine Referenz - Protokoll, A eine Behandlung mit einem allein Activin und CA-A (CHIR-99021 und Activin A) das Protokoll, das für MACS verwendet wird , Sortierung (Einzelheiten siehe 8). Die Medien in der CA-A - Protokoll verwendet , werden hier als Primitive Streak Induktionsmedium und endoderm Induktionsmedium bezeichnet. (B) Abgebildet ist die Genexpression gemessen mittels RT-qPCR von GSC, SOX17 und FOXA2, die ohne nach der endgültigen endoderm Engagement zum Ausdruck kommen weiter MACS zu sortieren. Pou5f1 (OCT3 / 4) und NANOG pluripotenz Regler sind und in der Regel nach unten auf Differenzierung geregelt, während SOX7 in außer embryonalen Endoderm exprimiert wird. Die Genexpression wurde normalisiert gegen drei stabil exprimiert Housekeeping-Gene (<em> TBP, TUBA1A, G6PD) , was zu CNRQ Werte. Die Expression der oben genannten Gene in undifferenzierten Zellen wurde auf 1 und Veränderungen eingestellt werden als fache Änderung der Genexpression aufgetragen. Werte sind Mittelwerte ± SEM, n = 4-5. ANOVA und Bonferroni post hoc Test. ** P ≤ 0,01 verglichen mit Zufalls und #P ≤ 0,05, ## P ≤ 0,01 , verglichen mit RP (alle Daten in dieser Figur sind in 8 kürzlich veröffentlicht). Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Verschiedene Zellpopulationen nach endoderm Differenzierung. (A) Die Färbung der DE - Marker SOX17 und FOXA2 mit entsprechenden Antikörpern auf d4 der Differenzierung ihrer homogenen Co-Lokalisierung zeigt. Doch einigeZellen widerstand dem Differenzierungsprozess und nicht exprimieren diese Marker (blau Kernfärbung nur). Die Zusammenführung von grünen und roten Färbung ist in gelb dargestellt. (B) Nach DE Differenzierung gibt es zwei verschiedene Zellpopulationen. DE-ähnlichen Zellen exprimieren FOXA2 während Zellen, die den Differenzierungsprozess widerstanden noch die Pluripotenz Marker SOX2 auszudrücken. (AB) Die Kerne wurden mit DAPI (blau) gegengefärbt. Maßstabsbalken in Platte (A) ist 50 & mgr; m und in der Platte (B) 100 & mgr; M. Imaging wurde bei 670 nm (rot, Cy5), 520 nm (grün, FITC) und 433 nm (blau, DAPI) ausgeführt sind. Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. MACS der Zelle unterschieden DE Sortier Populationen und Vertreter staining nach dem Sortieren. (A) CXCR4 + gefärbten Zellen (Q1) sortieren nach MACS angereichert. Die Anzahl der Zellen CXCR4- (Q4) verringert wird. In Abhängigkeit von der Zelllinie verwendet werden , um die Differenzierung Protokoll Ausbeuten> 80% CXCR4-positiven Zellen 8 und MACS verwendet werden können , um sie weiter zu bereichern. (B) undifferenzierte Zellen exprimieren die Pluripotenz Marker SOX2 (grün) , nicht aber die DE Marker FOXA2 (rot ). (C) Nach den MACS nur sehr wenige undifferenzierten SOX2 + Zellen Sortierung bleiben (rot), während die sortierten Bevölkerung zum Ausdruck bringt fast einheitlich die DE Marker FOXA2 (grün). (BC) Die Kerne wurden mit DAPI (blau) gegengefärbt. Maßstabsbalken in Platte (C) 100 & mgr; m und gilt für alle Platten. Imaging wurde bei 670 nm (rot, Cy5), 520 nm (grün, FITC) und 433 nm (blau, DAPI) ausgeführt sind. Bitte klicken Sie hier um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Derzeit verwendete Differenzierungsprotokolle ergeben sich selten 100% differenzierte Zellen. Aus Gründen, die noch einige Zellen angesprochen werden müssen widerstehen, den Differenzierungsprozess. Abhängig von der Effizienz der verwendeten Differenzierungsprotokoll und die Neigung des ESC Zeile eine bestimmte Anzahl von Rest pluripotenten Zellen häufig beobachtet werden, selbst nach der Differenzierung in die definitive Entoderm. Diese Restzellen können nachgeschaltete Differenzierungen beeinträchtigen oder weitere Analysen wie Transkriptomik, Proteomik und miRNA-Expressionsanalyse. Rest pluripotenten Zellen oder andere unerwünschte Linien können auch parakrine Wirkungen zeigen, die mit den Differenzierungs Ziele stören können. Folglich ist die Entfernung dieser Zellen zu einer verbesserten Reproduzierbarkeit führen kann.

Die Reinigung von CXCR4 + Entodermzellen nach der Differenzierung exprimieren, können verwendet werden, um diese Bevölkerung zu bereichern und die Zellen zu entfernen, die den Differenzierungsprozess widerstanden.Die Oberfläche DE Markerprotein CXCR4 kann für die spezielle Reinigung von Entodermzellen verwendet werden. Der MACS Reinigungsprotokoll zur Hand kann in weniger als 2 Stunden abgeschlossen sein und kann in einem einfachen bench top-Format in jedem Zellkulturlabor ohne teure Laborausrüstung und Geräte ausgeführt werden. FACS Reinigung ist eine häufig verwendete Technik, sondern beschäftigt harten Bedingungen. Während der FACS werden purifications Zellen üblicherweise in Suspension für einen längeren Zeitraum aufbewahrt und die Zellen unterliegen anderen herausfordernden Faktoren, beispielsweise Hochdruck in der Düse der FACS - Gerät. Im Vergleich ist die MACS Verfahren schnell und sanft. Dies verbessert die Fähigkeit der Zellen während der Einsaat nach dem Reinigungsprozess wieder zu befestigen. Um diesen Wiederanheftung erleichtern ein ROCK-Inhibitor wird dem Kulturmedium zugegeben, nachdem und vor der Reinigung Apoptose zu verhindern. Ein weiterer wichtiger Faktor, der das Wiederaufziehen beeinflusst, ist die Dichte, mit der Zellen reseeded sind. Diese stark DEPENds von der verwendeten Zelllinie. Die Zellzahlen verwendet für die in dieser Studie Impfen sind repräsentative Zellzahlen, die gut in der Hand arbeiten. Jedoch kann es brauchen werden, um diese Zahlen für verschiedene Zelllinien einzustellen. Beide Maßnahmen, die Zugabe eines ROCK-Inhibitor und die Auswertung der Zellzahlen für Nachsaat, sind entscheidend für den Erfolg der weiteren Zellkultur nach der Sortierung.

Mit dem Protokoll DE Differenzierung verwendet typischerweise> 70% CXCR4 + Zellen können ohne 8 Sortierung erhalten werden. Die Leistung des Protokolls für DE Generation verwendet konsequent beeinflusst die Effizienz des nachfolgenden MACS Reinigungsprotokoll. Im Allgemeinen effiziente Differenzierung (> 80% CXCR4 + Zellen) ergibt eine höhere Reinheit nach der MACS (bis zu 95%) zu sortieren. Somit verringert die Verwendung dieses Reinigungsverfahren die Anzahl von undifferenzierten Zellen im wesentlichen aber 100% Reinheit nicht erreicht werden kann. In Zukunft lineage spezifische Oberflächenmarker werden definiert tHut wird die Reinigung von mehr terminal differenzierten Zellen ermöglichen. Das MACS Sortierverfahren ist die wichtigste Wahl für diesen Zweck.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Die geschickte technische Unterstützung von Jasmin Kresse wird dankbar anerkannt.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics