Um método rápido e eficiente para a purificação de células da endoderme Gerado de células estaminais embrionárias humanas

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, descrevemos um método para a purificação de células-tronco embrionárias humanas diferenciadas que estão comprometidos para a endoderme definitiva para a melhoria das aplicações a jusante e outras diferenciações.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

As capacidades de diferenciação de células estaminais pluripotentes, tais como células estaminais embrionárias (CES) permitem uma aplicação terapêutica potencial para terapias de substituição de células. Terminalmente tipos de células diferenciadas pode ser utilizado para o tratamento de várias doenças degenerativas. Diferenciação in vitro destas células no sentido de tecidos do pulmão, fígado e pâncreas requer como um primeiro passo na geração de células da endoderme definitivas. Este passo é para a posterior diferenciação em direcção tipos de células terminalmente maturados tais como células beta produtoras de insulina, hepatócitos, ou outros tipos de células derivadas de endoderme limitante da velocidade. As células que são comprometidas com a linhagem endoderme altamente expressar uma grande variedade de factores de transcrição, tais como Foxa2, Sox17, HNF1B, membros da família GATA, e o receptor da superfície CXCR4. No entanto, os protocolos de diferenciação são raramente de 100% eficiente. Aqui, nós descrevemos um método para a purificação de uma população de células CXCR4 + após a diferenciaçãona DE usando microesferas magnéticas. Esta purificação remove adicionalmente células de linhagens indesejados. O método de purificação suave é rápido e fiável e pode ser usado para melhorar as aplicações a jusante e diferenciações.

Introduction

As células estaminais pluripotentes, tais como células estaminais embrionárias (CES) têm a capacidade de se diferenciar em virtualmente qualquer tipo de células do corpo humano. Assim, os protocolos in vitro de diferenciação podem ser usadas para gerar numerosos tipos de células, tais como adultos cardiomiócitos 1, 2 hepatócitos, células beta 3, 4 ou epitelial de pulmão de células neuronais 5. Isso faz com que os CES uma ferramenta valiosa para o tratamento potencial de várias doenças degenerativas 3.

A diferenciação in vitro dos CES no sentido de tecidos adultos do pulmão, fígado e pâncreas requer um pseudo-gastrulação em células reminiscentes da endoderme definitivo (DE) 6. Uma vez que a diferenciação em direcção a jusante dos tipos de células somáticas atrás referidos é significativamente menos eficiente, uma endoderme diferenciação óptima é considerada como a taxa de limitação 7. As células que estão comprometidos para com a linhagem endoderme submeter chamudanças racteristic em seu perfil de expressão gênica. Genes reguladores mestre pluripotência são regulados negativamente, enquanto que a expressão de outros factores de transcrição tais como Foxa2, Sox17, HNF1B, membros da família GATA e o receptor da superfície CXCR4 é altamente regulada positivamente 6, 8, 9. CXCR4 é conhecido por ser transactivado por Smad2 / 3, a jusante de sinalização Nodal / TGF-β e Sox17 devido a locais de ligação específicos na sua região promotora 10. Assim, é um marcador muito adequado utilizado num certo número de relatórios de 6, 8, 11-13. Estas mudanças de expressão reflete um evento pseudo-gastrulação, em que os CES primeiro adquirir características de uma população de células streak-like primitivo e posteriormente comprometer na camada germinativa endoderme 6.

No entanto, os protocolos de diferenciação são raramente de 100% eficiente como algumas células podem resistir ao processo de diferenciação ou diferenciar em relação a outras linhagens não intencionais 14. Estas células podem Influe negativamentemaior diferenciação nce. Além disso, as células indiferenciadas residuais abrigar grandes riscos para experiências de transplante mais tarde e pode dar origem a teratomas 15-17.

Para remover estas células indesejadas cedo-CXCR4 na superfície marcador pode ser utilizado para a purificação de células que estão comprometidos para a DE 18. Aqui, nós descrevemos um método para a selecção positiva de células CXCR4 + a partir de culturas de diferenciação de ED. Para isso, o CXCR4 marcador de superfície está ligada por um anticorpo o qual, em seguida, por sua vez, liga-se a microesferas magnéticas. Ao contrário das condições adversas durante a separação por FACS, as células como DE-magneticamente marcadas podem então ser facilmente purificadas em um formato de bancada utilizando um método de purificação suave. Este protocolo proporciona um método simples para a remoção das populações de células que resistiram ao processo de diferenciação DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Diferenciação de ESC Humano para o Endoderma Definitive

  1. Cultivar as células estaminais embrionárias humanas (CES) em uma incubadora a 37 ° C e 5% de CO 2.
  2. Revestimento um novo 6 poços da placa de cultura de células com 1 ml de uma matriz de membrana basal e incubar a cultura-louças durante pelo menos 30 min à temperatura ambiente. Para obter detalhes específicos por favor, ligue com as instruções dos respectivos fabricantes.
  3. Confirmar que os CES humanas cultivadas atingiram 80% -90% de confluência ao microscópio utilizando uma ampliação baixa (por exemplo, 4X). Aspirar o meio das cavidades por sucção fora o meio com uma pipeta de Pasteur de vidro estéril. Lavar as células uma vez com solução salina tamponada com fosfato (PBS). Por isso, adicionar 2 ml de PBS a cada poço suavemente agitar a placa e chupam a solução para remover as células mortas e detritos celulares.
  4. Adicionar 1 ml de reagente solução passaging livre de enzima para a dissociação suave de grupos de células. Incubar as células a 37 ° C, umd 5% de CO 2 até que as células apresentam sinais claros de perturbações de agregados de pequenas.
    NOTA: O tempo de incubação depende do reagente utilizado. Para a solução Passaging isento de enzimas mencionados na secção de materiais, o tempo de incubação é de cerca de 7 minutos.
  5. Adicionar 1 ml de DMEM meio F-12 / e perturbar os agregados de células remanescentes em células individuais pipetando para cima e para baixo usando uma pipeta de 1 ml de ponta. Utilizar esta para lavar as células a partir da superfície e transferência das células para um tubo de centrifugação. Para obter todas as células, lavagem de cada poço com 1 ml de meio DMEM / F-12 e adicionar o meio ao tubo de centrifugação.
  6. Centrifugar as células durante 5 min a 300 x g. Aspirar o sobrenadante e ressuspender as células em 5 ml de meio de cultura de células ES contendo 10 uM de inibidor a Rho-cinase (ROCHA).
  7. Contar as células ao microscópio usando um hemocitómetro e sementes 150.000 - 400.000 células por 6 poços ou em outra disposição de placa, dependendo da linha de células ES utilizadas. Use culture meio contendo inibidor ROCHA 10 uM para evitar apoptose e cultivar as células em uma incubadora a 37 ° C e 5% de CO 2.
  8. Aproximadamente 24 horas após a sementeira Aspirar o meio com uma pipeta de Pasteur de vidro estéril e adicionar 2 ml de meio de indução linha primitiva.
    NOTA: Este meio contém concentrações finais de 1% de glutamina, 0,2% de FCS, 5 uM e CHIR-99021 50 ng / ml de activina A em meio RPMI-1640 avançada. Geralmente, utilizar 2 ml de meio de cultura em placas de 6 poços.
  9. 48 horas após a semeadura, substitua a médio e endoderme meio de indução. Cultivar as células neste meio durante mais 48 horas com troca de meio por dia.
    NOTA: Este meio contém 1% de glutamina, 0,2% de FCS e 50 ng / ml de activina A em meio RPMI-1640 avançada. As células que estão comprometidos para a endoderme definitiva expressam o marcador de superfície CXCR4. A coloração de CXCR4 pode ser utilizado para quantificar o número de células anuladas.
  1. Para o final de 24 horas, mas, pelo menos, 1 hora antes da colheita das células adicionar inibidor ROCHA 10 uM para o meio de cultura.
  2. Revestir a cultura de células-louças que vai ser utilizado para re-sementeira com uma matriz de membrana basal, ou seja, placas de 12 poços para análise ou câmara de lâminas qPCR para coloração por imunofluorescência. Incubar as placas ou lâminas durante pelo menos 30 min à temperatura ambiente.
  3. Aspirar o meio com uma pipeta de Pasteur de vidro estéril a partir dos poços das células diferenciadas utilizados para a coloração e / ou classificação.
  4. Adicionar 1 ml de reagente solução passaging livre de enzima para a dissociação suave de grupos de células. Incubar as células a 37 ° C e 5% de CO 2 até que as células apresentam sinais claros de ruptura em pequenos aglomerados.
    NOTA: O tempo de incubação depende do reagente utilizado. Para a solução Passaging livre de enzima mencionada no materiseção de als, o tempo de incubação é de cerca de 7 min.
  5. Adicione 1 ml meio DMEM / F-12 e perturbar restantes agregados de células em células individuais pipetando cima e para baixo usando uma ponta de 1 ml. Utilizar esta para lavar as células a partir da superfície e transferência das células para um tubo de centrifugação. Para obter todas as células, lavar cada cavidade com 1 mL de meio DMEM / F-12 w / o FCS e adicionar o meio ao tubo de centrifugação.
  6. Contar as células ao microscópio utilizando um hemocitômetro. As células a partir de três cavidades de uma placa de 6 poços deve resultar em 10-15 x 10 6 células após três dias de diferenciação. Centrifugar as células durante 5 min a 300 x g.
    NOTA: O número exato de células obtidas dependerá da linha de células pluripotentes utilizado para a diferenciação.
  7. Aspirar o sobrenadante e ressuspender as células em tampão de PEB contendo 10 uM de inibidor ROCHA. Utilizar 100 ul desta tampão durante até 10 7 células. Adicionar o inibidor ROCHA 10 pM no dia da staining. Utilize este tampão para todas as aplicações a jusante (referido como tampão PEB + RI).
    NOTA: PEB tampão contém 0,5% de BSA e EDTA a 2 mM em PBS. Se mais células são para ser corado, ajustar o volume de tampão em conformidade.
  8. Adicionar 10 uL de um anticorpo CXCR4-APC por 10 7 células em 100 ul, isto representa aproximadamente uma diluição de 1:10.
    Nota: O uso de um anticorpo de APC-ligado não é obrigatória. Em vez disso, pode ser substituído de acordo com as micropérolas usadas. Se mais células são para ser coradas ajustar o volume de anticorpo em conformidade.
  9. Misturar suavemente invertendo o tubo com os dedos e incubar a 4 ° C num frigorífico durante 15 min. Ressuspender as células com 1-2 ml de tampão de PEB. Centrifugar as células durante 5 min a 300 x g.
  10. Aspirar o sobrenadante com uma pipeta Pasteur de vidro estéril e ressuspender o sedimento celular em 80 ul de PEB por 10 7 células e adicionar 20 ul microesferas anti-APC.
    NOTA:
  11. Misturar suavemente invertendo o tubo com os dedos e incubar a 4 ° C num frigorífico durante 15 min. Volte a suspender as células com 1-2 ml de tampão PEB + RI. Centrifugar as células durante 5 min a 300 x g. Aspirar o tampão. Ressuspender em 500 ul de tampão PEB + RI.

3. Separação Magnética de CXCR4 + Células

  1. Coloque uma coluna magnética tamanho médio em um campo magnético, conforme as instruções de fabricação. Pré-lavar a coluna com tampão de 500 ul PEB + RI. Aplicar a suspensão de célula inteira para a coluna. Recolhe-se o fluxo através de células uma vez que nem todos se ligam à coluna. Certifique-se para não perturbar as colunas para a recuperação ideal de células CXCR4 +.
  2. Lava-se a coluna três vezes com tampão de PEB 500 ul + RI. Recolher o primeiro fluxo através de e combiná-lo com as células coletadas de Passo 3.1. Retirar a coluna magnético do campo magnético e coloca-se numatubo de recolha adequado. Adicionar 1 ml de tampão de PEB + RI na coluna. Para eluir as células firmemente pressionar para baixo o êmbolo para dentro da coluna.
  3. Opcional: Recolha todo o fluxo através de amostras separadamente e usar 20 l cada, para analisar o número de células CXCR4 + utilizando citometria de fluxo. Seu número deve diminuir com cada etapa de lavagem.
    NOTA: Pelo menos 2 x 10 4 viável, células fechadas deve ser contado para resultados confiáveis.
  4. Repita os passos 3,1-3,3 com o fluxo coletados por meio de amostra do Passo 3.1 e o primeiro fluxo através da amostra a partir do passo 3.2 utilizando uma nova coluna. Não re-utilizar a coluna anterior. Ao utilizar o ar êmbolo é pressionado para a coluna, o que bloqueia.
  5. Contar as células ao microscópio utilizando um hemocitômetro. Dependendo da eficiência da diferenciação até 6 x 10 6 células podem ser classificados inicialmente e mais 1 x 10 6 células, utilizando uma segunda coluna ao utilizar 10 7 células para o procedimento. Centrifugar as células a 300 xg durante 5 min. Aspirar o sobrenadante e com uma pipeta de Pasteur de vidro estéril e ressuspender as células em 1 ml de meio de indução endoderme do Passo 1.9, com inibidor adicional ROCHA 10 uM.
  6. Contar as células ao microscópio utilizando um hemocitômetro. Semear as células a uma densidade adequada, isto é, ~ 4 x 10 5 células por poço de uma placa de 12 poços (app. 3,6 cm2 de superfície) ou ~ 1,5 x 10 5 células por poço de um de 8 poços câmara de corrediça.

4. Opcional: Análise de Purificada População Endoderma Definitive

  1. Para coloração por imunofluorescência fixar as células purificada do passo 3.7 aproximadamente 24 horas após a sementeira com paraformaldeído a 4% e de manchas de endoderme definitivo (DE) e / ou proteínas marcadoras pluripotência.
    NOTA: normalmente usado DE marcadores incluem Foxa2 e Sox17, marcadores de pluripotência comumente usados ​​incluem OCT3 / 4, NANOG e SOX2 6, 8.
  2. foR análise de RT-qPCR, a colheita das células purificadas directamente ou 24 horas após a sementeira, extrato total de ARN e a transcrição reversa de ADNc a partir das amostras de ARN total de-extraídos. Use 10 cDNA ng como modelo por reacção RT-qPCR (triplicado) para analisar a expressão de DE e genes pluripotência marcador 6, 8.
    NOTA: genes marcadores comumente usados ​​são mencionados no Passo 4.1. As condições de ciclo são 5 min a 95 ° C e 40 ciclos de 15 seg a 95 ° C e 1 min a 60 ° C, seguido de análise da curva de fusão.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Após a diferenciação CES sofrer alterações drásticas no gene e a expressão da proteína. A Figura 1 representa genes marcadores típicos que podem ser utilizados para verificar uma diferenciação endoderme bem sucedida. Alvos principais para a análise de expressão gênica são GSC, Foxa2 e Sox17. Em uma análise de expressão gênica relativa especialmente Foxa2 e Sox17 são aumentados em> 2.000 vezes quando comparado com os CES indiferenciadas. GSC já está expresso muito cedo dentro de 24 horas durante a formação linha primitiva mas é todavia induzida> 100 vezes no dia quatro. A expressão destes genes é, consequentemente, aumentado por classificação usando o marcador de superfície 6 CXCR4. Reguladores, tais como mestre pluripotência OCT3 / 4 (POU5F1) e NANOG são significativamente regulada negativamente, embora a expressão destes genes é ainda detectável, depois de quatro dias. Isto indicates que algumas células não respondem adequadamente ao regime de tratamento com CHIR-99021 e activina A. expressão do gene SOX7 é tipicamente dirigida para discriminar formação endoderme extra-embrionárias contra a DE. No primeiro caso Sox17 é co-expressa com SOX7 e, neste último caso Sox17 é co-expressa com Foxa2. Os resultados na Figura 1 indicam que, juntamente com DE algumas células extra-embrionárias podem ter se formado durante a diferenciação, embora ainda não tenha sido capaz de corar as células SOX7 +.

A Figura 2 ilustra as diferentes populações de células que estão presentes após a diferenciação dos CES na DE. No passo 1 CES são semeadas como células individuais e, em seguida, diferenciadas por tratamento com CHIR-99021 e activina A para quatro dias. A coloração IF da DE marcadores Sox17 e Foxa2 (Figura 2A) mostra que ambos os marcadores são uniformemente o co-expressed dentro dos núcleos. Isto é considerado como uma indicação de compromisso DE. No entanto, algumas células de resistir ao processo de diferenciação e expressar nenhuma das duas proteínas marcadoras DE (Figura 2A). Na verdade, duas populações de células distintas são observados após a diferenciação quatro dias. Enquanto muitas células expressam o marcador Foxa2 DE existem ainda restantes células que expressam o marcador de pluripotência SOX2 (Figura 2B). Estas duas proteínas são expressas em duas populações distintas e não co-expressão pode ser observado (Figura 2B).

No dia três ou quatro de diferenciação do CXCR4 proteína de superfície é utilizada para classificar a população CXCR4 + anuladas e, assim, remover as restantes células pluripotentes e outras linhagens indesejados. Dependendo da eficiência de diferenciação da linha celular utilizada> 80% CXCR4 + células pode ser obtida utilizando o protocolo delineado na Fase diferenciação 1 8 A figura 3 ilustra a citometria de fluxo de dados depois de coloração e purificação MACS de CXCR4 + células após a diferenciação em direcção DE e mostra a expressão de proteínas comuns dE e marcadores pluripotência imunofluorescência usando coloração (SE) antes e depois da purificação MACS. No terceiro dia de diferenciação cerca de 60% ​​de células CXCR4 +, utilizando a coloração de imunofluorescência para CXCR4 descrito no Passo 2 foram obtidos (Figura 3A, painel do meio). células CXCR4 + mover de P4 para P1 após coloração com um anticorpo anti-CXCR4 conjugado APC. Após a purificação MACS descrito no Passo 3 da população CXCR4 + é enriquecido a 85%. O processo de purificação, contudo, não elimina todas as linhagens não desejados a partir de culturas (Figura 3A, painel da direita).

Após a purificação MACS,as células CXCR4 + podem ser semeadas para análise posterior ou, opcionalmente, um segundo ciclo de triagem pode ser realizada para se obter purezas mais elevadas, mas a viabilidade reduzida. Antes de diferenciação a expressão generalizada do SOX2 pluripotência marcador (com detalhes em verde) é detectada por coloração IF. Em contraste, o marcador Foxa2 DE (manchado de vermelho) não pode ser detectado (Figura 3B). Na Figura 3C CXCR4 + células são coradas com anticorpos para Foxa2 (verde) e são co-coradas para o marcador de pluripotência SOX2 (vermelho). Após sementeira das células purificadas CXCR4 + células muito poucos SOX2 + são detectados. A maioria das células inoculadas são positivas para o marcador Foxa2 DE.

figura 1
Figura 1. Mudanças representativos na expressão de genes de diferentes genes de pluripotência e marcador endoderme durante uma diferenciação endoderme quatro dias. (UMA) 7, um tratamento com Activina A sozinho, e CA-A (CHIR-99021 e activina A) o protocolo, o qual é utilizado para MACS triagem (ver detalhes no 8). Os meios usados ​​na CA-A do protocolo são aqui referido como meio de indução linha primitiva e meio de indução endoderme. (B) Descrito é a expressão do gene medida por RT-qPCR da GSC, Sox17 e Foxa2, que são expressos no compromisso endoderme definitiva, sem mais MACS classificação. POU5F1 (OCT3 / 4) e NANOG são reguladores de pluripotência e, normalmente, regulada negativamente na diferenciação, enquanto SOX7 é expressa em endoderme extra-embrionário. A expressão do gene foi normalizado contra três genes housekeeping expressos de forma estável (<em> TBP, TUBA1A, G6PD), resultando em valores CNRQ. A expressão dos genes acima mencionados em células indiferenciadas foi definido como 1 e as alterações são representados graficamente como a mudança de dobragem da expressão do gene. Os valores são médias ± SEM, n = 4-5. Teste post hoc de ANOVA além de Bonferroni. ** P ≤ 0,01 em comparação com a Random e #P ≤ 0,05, ## P ≤ 0,01 em comparação com RP (todos os dados dentro deste valor ter sido publicado recentemente no 8). Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Diferentes populações de células após a diferenciação endoderme. (A) Coloração do DE marcadores Sox17 e Foxa2 com os respectivos anticorpos no d4 de diferenciação revela sua co-localização homogénea. No entanto, algunscélulas resistiu ao processo de diferenciação e não expressam estes marcadores (somente coloração núcleo azul). A fusão de coloração verde e vermelho é mostrado em amarelo. (B) Após DE diferenciação existem duas populações celulares distintas. células DE-como expressar Foxa2 enquanto que as células que resistiram ao processo de diferenciação ainda expressar a SOX2 pluripotência marcador. (AB) Núcleos foram contrastadas com DAPI (azul). A barra de escala no painel (A) é de 50 ^ m e no painel (B) é de 100 uM. Imagiologia foi realizada a 670 nm (vermelho, Cy5), 520 nm (verde, FITC) e 433 nm (azul, DAPI), respectivamente. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. MACS triagem de populações de células DE diferenciados e st representanteaining após separação. (A) células coradas (Q1) CXCR4 + são enriquecidas após MACS classificação. O número de células CXCR4 (Q4) é diminuída. Dependendo da linhagem de células a ser usados ​​os rendimentos de protocolo diferenciação> 80% de células CXCR4-positivo 8 e MACS podem ser utilizados para enriquecer ainda mais deles. (B) células indiferenciadas expressam o SOX2 pluripotência marcador (verde), mas não o marcador Foxa2 DE (vermelho ). (C) Após o MACS triagem células muito poucos SOX2 indiferenciado + permanecem (vermelho), enquanto a população classificada expressa quase uniformemente a Foxa2 marcador DE (verde). (BC) Núcleos foram contrastadas com DAPI (azul). A barra de escala no painel (C) é de 100 ^ m e aplica-se a todos os painéis. Imagiologia foi realizada a 670 nm (vermelho, Cy5), 520 nm (verde, FITC) e 433 nm (azul, DAPI), respectivamente. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

protocolos de diferenciação utilizados actualmente raramente resultam em células diferenciadas 100%. Por razões que ainda têm de ser abordadas algumas células resistir ao processo de diferenciação. Dependendo da eficiência do protocolo utilizado diferenciação e a propensão do CES alinhar um certo número de células pluripotentes residuais são vulgarmente observadas mesmo após a diferenciação em endoderme definitiva. Estas células residuais pode prejudicar diferenciações a jusante ou uma análise mais aprofundada, como transcriptomics, proteômica e análise de expressão miRNA. células pluripotentes residual ou outras linhagens indesejadas podem também exibir efeitos parácrinos que podem interferir com as metas de diferenciação. Por conseguinte, a remoção destas células pode resultar em melhor reprodutibilidade.

A purificação de células que expressam o CXCR4 + endoderme após a diferenciação podem ser usadas para enriquecer estas populações e para remover as células que resistiram ao processo de diferenciação.A proteína marcadora de surface CXCR4 pode ser utilizado para a purificação específico de células da endoderme. O protocolo de purificação MACS na mão pode ser concluída em menos de 2 horas e pode ser executado em um formato de bancada simples em cada laboratório de cultura de células, sem equipamentos de laboratório caros e dispositivos. purificação FACS é uma técnica comumente usada, mas emprega condições adversas. Durante FACS células purificações são geralmente mantidos em suspensão durante um período prolongado de tempo e as células são sujeitas a outros factores, por exemplo desafiantes, alta pressão no bocal do dispositivo FACS. Em comparação o procedimento MACS é rápido e suave. Isto melhora a capacidade das células para recolocar durante sementeiras após o processo de purificação. Para facilitar ainda mais esta religação um inibidor ROCHA é adicionado ao meio de cultura após e antes da purificação a fim de impedir a apoptose. Outro fator importante que influencia a religação é a densidade em que as células são replantadas. Este fortemente depenDS na linha celular utilizada. Os números de células utilizadas para semear neste estudo são o número de células representativos que funcionam bem em nossas mãos. No entanto, pode ser necessário ajustar esses números de linhas de células diferentes. Ambas as medidas, a adição de um inibidor de ROCK e a avaliação dos números de células por repropagação, são críticos para o sucesso da cultura de células ainda mais após a triagem.

Com o protocolo de diferenciação DE usado tipicamente> 70% de células CXCR4 + pode ser obtido sem a triagem 8. O desempenho do protocolo usado para a geração DE consequentemente influencia a eficiência do protocolo subsequente purificação MACS. Na diferenciação geral, eficiente (> 80% de células CXCR4 +) produz um grau de pureza mais elevado após a triagem MACS (até 95%). Assim, a utilização deste método de purificação reduz o número de células indiferenciadas mas substancialmente 100% de pureza tal não pode ser alcançado. No futuro, marcadores de superfície específicos de linhagem pode ser definido tchapéu irá permitir a purificação de células mais diferenciadas terminalmente. O procedimento de triagem MACS é a selecção preferencial para este propósito.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

A assistência técnica hábil de Jasmin Kresse é reconhecido agradecimento.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics