Un método rápido y eficiente para la purificación de células del endodermo generada a partir de células madre embrionarias humanas

1Institute of Clinical Biochemistry, Hannover Medical School
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

A continuación, se describe un método para la purificación de células madre embrionarias humanas diferenciadas que están comprometidas hacia el endodermo definitivo para la mejora de las aplicaciones posteriores y otras diferenciaciones.

Cite this Article

Copy Citation | Download Citations

Davenport, C., Diekmann, U., Naujok, O. A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells. J. Vis. Exp. (109), e53655, doi:10.3791/53655 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las capacidades de diferenciación de las células madre pluripotentes tales como células madre embrionarias (CES) permiten que una aplicación terapéutica potencial para las terapias de reemplazo celular. Terminal tipos de células diferenciadas se podrían utilizar para el tratamiento de diversas enfermedades degenerativas. Diferenciación in vitro de estas células hacia los tejidos del pulmón, hígado y páncreas requiere como primera etapa de la generación de células endodérmicas definitivas. Este paso es limitante de la velocidad para su posterior diferenciación hacia tipos de células maduras terminal tales como las células beta productoras de insulina, hepatocitos u otros tipos celulares derivados del endodermo. Las células que se han comprometido hacia el linaje endodermo altamente expresan una multitud de factores de transcripción como FOXA2, SOX17, HNF1B, los miembros de la familia GATA, y el receptor CXCR4 superficie. Sin embargo, rara vez son protocolos de diferenciación 100% de eficiencia. A continuación, describimos un método para la purificación de una población de células CXCR4 + después de la diferenciaciónen la DE mediante el uso de microperlas magnéticas. Esta purificación elimina, además, las células de los linajes no deseados. El método de purificación suave es rápido y fiable, y puede ser utilizado para mejorar las aplicaciones posteriores y diferenciaciones.

Introduction

Las células madre pluripotentes tales como células madre embrionarias (CES) tienen la capacidad de diferenciarse en casi cualquier tipo de célula del cuerpo humano. Por lo tanto, los protocolos de diferenciación in vitro se pueden utilizar para generar numerosos tipos de células de adultos, tales como cardiomiocitos, hepatocitos 1 2, las células beta 3, epitelial de pulmón 4 o células neuronales 5. Esto hace que los CES una herramienta valiosa para el tratamiento potencial de diversas enfermedades degenerativas 3.

La diferenciación in vitro de los CES hacia tejidos adultos del pulmón, hígado y páncreas requiere un pseudo-gastrulación en células que recuerdan el endodermo definitivo (DE) 6. Puesto que la diferenciación de aguas abajo hacia los tipos de células somáticas antes mencionados es significativamente menos eficiente, una diferenciación endodermo óptima se considera como limitante de la velocidad 7. Las células que se han comprometido hacia el linaje endodermo se someten chacaracterísti- cambios en su perfil de expresión génica. Regulador de los genes maestros pluripotencia están regulados hacia abajo, mientras que la expresión de otros factores de transcripción como FOXA2, SOX17, HNF1B, los miembros de la familia GATA y el receptor de la superficie CXCR4 está altamente regulada positivamente 6, 8, 9. CXCR4 es conocido por estar transactivated por SMAD2 / 3, aguas abajo de la señalización nodal / TGF-β y SOX17 debido a los sitios de unión específicos en su región promotora 10. Por lo tanto es un marcador muy adecuado usado en una serie de informes 6, 8, 11-13. Estos cambios en la expresión refleja un evento pseudo-gastrulación, en el que los CES primera adquieren características de una población de células racha similar primitiva y, posteriormente, se comprometen en la capa de germen de endodermo 6.

Sin embargo, los protocolos de diferenciación rara vez son 100% de eficiencia como algunas células pueden resistir el proceso de diferenciación o diferenciar hacia otros linajes no deseados 14. Estas células pueden INFLUE negativamentena vez mayor diferenciación. Además, las células indiferenciadas residuales albergan grandes riesgos para posteriores experimentos de trasplante y pueden dar lugar a teratomas 15-17.

Para eliminar estas células no deseadas se pueden utilizar para la purificación de las células que se han comprometido hacia la DE 18 temprano en el CXCR4 marcador de superficie. A continuación, describimos un método para la selección positiva de células CXCR4 + a partir de cultivos de diferenciación DE. Para ello, el CXCR4 marcador de superficie se une por un anticuerpo que luego a su vez se une a las microperlas magnéticas. A diferencia de las duras condiciones durante FACS clasificación, las células marcadas magnéticamente DE-como pueden ser fácilmente purificados en un formato de sobremesa usando un método de purificación suave. Este protocolo proporciona un método sencillo para la eliminación de poblaciones de células que resistió el proceso de diferenciación DE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. La diferenciación de ESC humana hacia el endodermo definitivo

  1. Cultivar células madre embrionarias humanas (CES) en una incubadora a 37 ° C y 5% de CO2.
  2. Escudo una nueva placa de cultivo celular de 6 pocillos con 1 ml de una matriz de membrana basal e incubar la cultura-ware durante al menos 30 minutos a temperatura ambiente. Para obtener detalles específicos, por favor dirigirse a las instrucciones del fabricante respectivo.
  3. Confirman que las CME humanas cultivadas han alcanzado el 80% -90% de confluencia en el microscopio utilizando una magnificación baja (por ejemplo, 4X). Aspirar el medio de las cavidades chupando el medio con una pipeta Pasteur de vidrio estéril. Lavar las células una vez con solución salina (PBS) tamponada con fosfato. Para ello, agregar 2 ml de PBS a cada pocillo suavemente sacudir la placa y chupar la solución para eliminar las células muertas y restos celulares.
  4. Añadir 1 ml de reactivo de solución pases libre de enzimas para la disociación suave de grupos de células. Se incuban las células a 37 ° C unad CO2 al 5% hasta que las células muestran claros signos de perturbación en pequeños racimos.
    NOTA: El tiempo de incubación depende del reactivo utilizado. Para la solución pases libre de enzima se menciona en la sección de materiales, el tiempo de incubación es de aproximadamente 7 min.
  5. Añadir 1 ml de medio DMEM / F-12 e interrumpir los agregados de células restantes en células individuales mediante la pipeta hacia arriba y hacia abajo usando una punta de pipeta de 1 ml. Utilice esta para eliminar las células de la superficie y transferir las células a un tubo de centrifugación. Para recuperar todas las células, lavar cada pocillo con 1 ml de medio DMEM / F-12 y añadir el medio al tubo de centrifugación.
  6. Centrifugar las células durante 5 min a 300 x g. Aspirar el sobrenadante y resuspender las células en 5 ml de medio de cultivo de células ES que contienen Rho-quinasa inhibidor 10 mM (ROCK).
  7. Contar las células bajo el microscopio utilizando un hemocitómetro y sembrar 150.000 - 400.000 células por 6 pocillos o en otra disposición de la placa, dependiendo de la línea de células ES utilizado. uso cultura medio que contiene inhibidor de Rock 10 mM para evitar la apoptosis y cultivar las células en una incubadora a 37 ° C y 5% de CO 2.
  8. Aproximadamente 24 horas después de la siembra aspirado el medio con una pipeta Pasteur de vidrio estéril y añadir 2 ml de medio de inducción línea primitiva.
    NOTA: Este medio contiene concentraciones finales de 1% de glutamina, 0,2% de FCS, 5 mM CHIR-99021 y 50 ng / ml de activina A en Avanzada medio RPMI-1640. Comúnmente, utilizar 2 ml de medio para el cultivo en placas de 6 pocillos.
  9. 48 horas después de la siembra, vuelva a colocar el medio de endodermo medio de inducción. Cultivar las células en este medio durante otras 48 horas con cambio de medio día.
    NOTA: Este medio contiene 1% de glutamina, 0,2% de FCS y 50 ng / ml de activina A en Avanzada medio RPMI-1640. Las células que se han comprometido hacia el endodermo definitivo expresan el marcador de superficie CXCR4. La tinción de CXCR4 se puede usar para cuantificar el número de células comprometidas-DE.
  1. Para el final de 24 hr, pero al menos 1 hora antes de recoger las células añaden inhibidor Rock 10 mM al medio de cultivo.
  2. Escudo del cultivo de células-ware que será utilizado para la re-siembra con una matriz de membrana basal, es decir, placas de 12 pocillos para análisis qPCR o cámara de diapositivas para la tinción de inmunofluorescencia. Incubar las placas o los portaobjetos durante al menos 30 min a TA.
  3. Aspirar el medio con una pipeta Pasteur de vidrio estéril de los pocillos de las células diferenciadas usadas para la coloración y / o de clasificación.
  4. Añadir 1 ml de reactivo de solución pases libre de enzimas para la disociación suave de grupos de células. Se incuban las células a 37 ° C y 5% de CO2 hasta que las células muestran claros signos de perturbación en pequeños racimos.
    NOTA: El tiempo de incubación depende del reactivo utilizado. Para la solución pases libre de enzimas mencionado en la materisección del als, tiempo de incubación es de aproximadamente 7 min.
  5. Añadir 1 ml de medio DMEM / F-12 e interrumpir restante agregados de células en células individuales mediante la pipeta hacia arriba y hacia abajo usando una punta de 1 ml. Utilice esta para eliminar las células de la superficie y transferir las células a un tubo de centrifugación. Para recuperar todas las células, lavar cada pocillo con 1 ml de DMEM / F-12 medio w / o FCS y añadir el medio al tubo de centrifugación.
  6. Contar las células bajo el microscopio utilizando un hemocitómetro. Las células de tres pocillos de una placa de 6 pocillos deben dar lugar a 10-15 x 10 6 células después de tres días de diferenciación. Centrifugar las células durante 5 min a 300 x g.
    NOTA: El número exacto de células obtenidas dependerá de la línea de células pluripotentes utilizado para la diferenciación.
  7. Aspirar el sobrenadante y resuspender las células en tampón PEB que contiene inhibidor de Rock 10 mM. Utilice 100 l de este tampón durante hasta 10 7 células. Añadir el inhibidor Rock 10 M en el día de staining. Usar este tampón para todas las aplicaciones aguas abajo (que se refiere como tampón PEB + RI).
    NOTA: tampón PEB contiene BSA al 0,5% y EDTA 2 mM en PBS. Si más células deben ser de colores, ajustar el volumen de compensación en consecuencia.
  8. Añadir 10 l de un anticuerpo CXCR4-APC por 10 7 células en 100 l, esto representa más o menos una dilución de 1:10.
    NOTA: El uso de un anticuerpo ligado a APC no es obligatorio. En su lugar, puede ser sustituido en función de las microperlas utilizados. Si más células han de ser manchada ajustar el volumen del anticuerpo en consecuencia.
  9. Mezclar por voltear suavemente el tubo con los dedos y se incuba a 4 ° C en un refrigerador durante 15 min. Resuspender las células con 1-2 ml de tampón PEB. Centrifugar las células durante 5 min a 300 x g.
  10. Aspirar el sobrenadante con una pipeta Pasteur de vidrio estéril y resuspender el sedimento celular en 80 l PEB por 10 7 células y añadir 20 l microperlas anti-APC.
    NOTA:
  11. Mezclar por voltear suavemente el tubo con los dedos y se incuba a 4 ° C en un refrigerador durante 15 min. Resuspender las células con 1-2 ml de tampón PEB + RI. Centrifugar las células durante 5 min a 300 x g. Aspirar el buffer. Volver a suspender en 500 l de tampón PEB + RI.

3. Separación Magnética de CXCR4 + células

  1. Colocar una columna magnética de tamaño medio en un campo magnético como por las instrucciones del fabricante. Pre-enjuagar la columna con tampón PEB 500 l + RI. Aplicar toda la suspensión de células a la columna. Recoger el flujo a través de las células ya que no todos se unirá a la columna. Asegúrese de no molestar a las columnas para la recuperación óptima de células CXCR4 +.
  2. Lavar la columna tres veces con 500 l de tampón PEB + RI. Recoger el primer flujo a través y combinarlo con las células recogidas del Paso 3.1. Retire la columna magnética del campo magnético y colocarlo en unatubo de recogida adecuado. Añadir tampón PEB 1 ml + RI en la columna. Para eluir las células que presiona hacia abajo el émbolo en la columna.
  3. Opcional: Recoger todo el flujo a través de muestras por separado y el uso de 20 l cada uno para analizar el número de células CXCR4 + mediante citometría de flujo. Su número debería disminuir con cada etapa de lavado.
    NOTA: Al menos 2 x 10 4 viables, células cerradas deben contarse para obtener resultados fiables.
  4. Repita los pasos 3.1-3.3 con el flujo de recogida a través de la muestra a partir del paso 3.1 y la primera muestra de flujo a través del paso 3.2 utilizando una nueva columna. No vuelva a utilizar la columna anterior. Al utilizar el aire del émbolo se presiona en la columna, que lo bloquea.
  5. Contar las células bajo el microscopio utilizando un hemocitómetro. Dependiendo de la eficiencia de la diferenciación hasta 6 x 10 6 células se pueden clasificar inicialmente y otro 1 x 10 6 células mediante el uso de una segunda columna utilizando 10 7 células para el procedimiento. Centrifugar las células a 300 xg durante 5 min. Aspirar el sobrenadante y con una pipeta Pasteur de vidrio estéril y resuspender las células en medio de inducción de endodermo 1 ml de la Etapa 1.9 con inhibidor adicional Rock 10 mM.
  6. Contar las células bajo el microscopio utilizando un hemocitómetro. Sembrar las células a una densidad apropiada, es decir, ~ 4 x 10 5 células por pocillo de una placa de 12 pocillos (aprox. 3,6 cm2 de superficie) o ~ 1,5 x 10 5 células por pocillo de 8 plantas, así cámara de diapositivas.

4. Opcional: Análisis de la Población purificada endodermo definitivo

  1. Para la tinción de inmunofluorescencia fijar las células purificada de la etapa 3.7 más o menos 24 horas después de la siembra con 4% de paraformaldehído y manchas para endodermo definitivo (DE) y / o proteínas marcadoras pluripotencia.
    NOTA: se suele utilizar DE marcadores incluyen FOXA2 y SOX17, marcadores de pluripotencia de uso general incluyen OCT3 / 4, Sox2 y NANOG 6, 8.
  2. for análisis RT-qPCR, cosechar las células purificadas directa o 24 horas después de la siembra, extracto total-ARN y la transcripción reversa cDNA a partir de las muestras de ARN total extraído. Utilice 10 ng de cDNA como plantilla por reacción de RT-qPCR (por triplicado) para analizar la expresión de genes marcadores de DE y pluripotencia 6, 8.
    NOTA: Los genes marcadores usados ​​comúnmente se mencionan en el paso 4.1. Las condiciones del ciclo son 5 min a 95 ° C y 40 ciclos de 15 segundos a 95 ° C y 1 min a 60 ° C, seguido por la fusión de análisis de la curva.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

la diferenciación CES se someten a cambios drásticos en la expresión de genes y proteínas. La Figura 1 representa los genes marcadores típicos que se pueden utilizar para verificar el éxito de la diferenciación del endodermo. Los principales objetivos de un análisis de la expresión génica son GSC, FOXA2, y SOX17. En un análisis de la expresión génica relativa en especial FOXA2 y SOX17 se incrementan en> 2.000 veces en comparación con las CME no diferenciadas. GSC se expresa ya muy temprana dentro de las 24 horas durante la formación de línea primitiva pero no obstante es inducido> 100 veces en el cuarto día. La expresión de estos genes se aumentó en consecuencia sobre la clasificación usando el marcador de superficie CXCR4 6. Reguladores maestros pluripotencia como OCT3 / 4 (POU5F1) y NANOG son significativamente regulados hacia abajo aunque la expresión de estos genes es todavía detectable después de cuatro días. esto indicates que algunas células no responden adecuadamente al régimen de tratamiento con CHIR-99021 y activina A. expresión génica SOX7 se suelen dirigirse a discriminar la formación endodermo extraembrionario contra la DE. En el primer caso SOX17 es co-expresada con SOX7 y en el último caso SOX17 es co-expresada con FOXA2. Los resultados de la Figura 1 indican que junto con algunas células DE extra-embrionarias pueden haberse formado durante la diferenciación, aunque todavía no hemos sido capaces de teñir las células SOX7 +.

Figura 2 ilustra las diferentes poblaciones de células que están presentes después de la diferenciación de los CES en el DE. En el paso 1 CES se siembran como células individuales y luego diferencian por el tratamiento con CHIR-99021 y la activina A durante cuatro días. La tinción de la IF DE marcadores SOX17 y FOXA2 (Figura 2A) muestra que ambos marcadores son uniformemente co-explícitod dentro de los núcleos. Esto se considera como una característica de la DE compromiso. Sin embargo, algunas células resisten el proceso de diferenciación y expresan ninguna de las dos proteínas DE marcador (Figura 2A). De hecho, dos poblaciones de células distintas se observan después de la diferenciación de cuatro días. Mientras que muchas células expresan el marcador de FOXA2 DE todavía hay células restantes que expresan el marcador de pluripotencia SOX2 (Figura 2B). Estas dos proteínas se expresan en dos poblaciones separadas y no co-expresión pueden ser observadas (Figura 2B).

El día tres o cuatro de la diferenciación de la proteína CXCR4 superficie se utiliza para ordenar la población CXCR4 + cometido-DE y por lo tanto eliminar las células pluripotentes restantes y los otros linajes no deseados. En función de la eficiencia de diferenciación de la línea celular utilizada> 80% de células CXCR4 + se pueden obtener utilizando el protocolo de diferenciación descrito en el Paso 1 8 La Figura 3 representa la citometría de flujo de datos después de la tinción y la purificación MACS de CXCR4 + células después de la diferenciación hacia DE y muestra la expresión de marcadores comunes dE y pluripotencia proteínas usando la tinción de inmunofluorescencia (IF) antes y después de la purificación MACS. En el tercer día de la diferenciación se obtuvieron aproximadamente 60% ​​de células CXCR4 + utilizando el tinción de inmunofluorescencia para el CXCR4 se describe en el paso 2 (Figura 3A, panel central). células CXCR4 + mueven de Q4 a Q1 a tinción con un anticuerpo anti-CXCR4 conjugado APC. Después de la MACS de purificación descrito en el paso 3 la población CXCR4 + se enriquece a 85%. El proceso de purificación, sin embargo, no elimina todos los linajes no deseados de los cultivos (Figura 3A, panel derecho).

Después de la purificación MACS,las células CXCR4 + se pueden sembrar para su posterior análisis o opcionalmente una segunda ronda de clasificación se puede realizar para obtener el grado de pureza más altos, pero reducción de la viabilidad. Antes de la diferenciación de la expresión de toda la extensión de la SOX2 marcador de pluripotencia (teñido en verde) se detecta mediante tinción con IF. Por el contrario, el marcador FOXA2 DE (teñido en rojo) no se puede detectar (Figura 3B). En la Figura 3C CXCR4 + células se tiñeron con anticuerpos para FOXA2 (verde) y se co-tiñeron para el marcador de pluripotencia SOX2 (rojo). Después de la siembra de las células purificadas CXCR4 + se detectaron células sólo unos pocos SOX2 +. La mayoría de las células sembradas son positivas para el marcador FOXA2 DE.

Figura 1
Figura 1. Los cambios en la expresión génica representativos de diferentes genes marcadores de pluripotencia y endodermo durante una diferenciación del endodermo de cuatro días. (UN) 7, A un tratamiento con activina A solo, y CA-A (CHIR-99021 y la activina A) el protocolo, que se utiliza para MACS clasificación (ver detalles en 8). Los medios utilizados en la CA-Un protocolo se hace referencia aquí como medio de inducción línea primitiva y el medio de inducción endodermo. (B) representado es la expresión génica medido por RT-qPCR de GSC, SOX17 y FOXA2, que se expresan en el compromiso endodermo definitivo y sin más MACS clasificación. POU5F1 (OCT3 / 4) y NANOG son reguladores de pluripotencia y por lo general las reguladas en la diferenciación, mientras que SOX7 se expresa en endodermo extraembrionario. La expresión génica se normalizó en contra de tres genes de mantenimiento expresados ​​de manera estable (<em> TBP, TUBA1A, G6PD), resultando en valores CNRQ. La expresión de los genes anteriormente mencionados en las células no diferenciadas se establece en 1 y cambios se representan como factor de cambio de la expresión génica. Los valores son medias ± SEM, n = 4-5. Test post hoc de Bonferroni más ANOVA. ** P ≤ 0,01 en comparación con Random y # P ≤ 0,05, ## P ≤ 0,01 en comparación con RP (todos los datos dentro de esta cifra han sido publicados recientemente en 8). Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Diferentes poblaciones de células después de la diferenciación del endodermo. (A) La tinción de la DE marcadores SOX17 y FOXA2 con anticuerpos respectivos en d4 de diferenciación revela su homogénea co-localización. Sin embargo, algunoscélulas resistieron el proceso de diferenciación y no expresan estos marcadores (sólo tinción con azul de núcleo). La combinación de la tinción de verde y rojo se muestra en amarillo. (B) después de la diferenciación hay dos poblaciones de células distintas. DE-células expresan como FOXA2 mientras que las células que resistieron el proceso de diferenciación todavía expresan el marcador de pluripotencia Sox2. (AB) Los núcleos se counterstained con DAPI (azul). La barra de escala en el panel (A) es de 50 micras y en el panel (B) es de 100 mM. Imaging se realizó a 670 nm (rojo, Cy5), 520 nm (verde, FITC) y 433 nm (azul, DAPI), respectivamente. Por favor, haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. MACS clasificación de poblaciones de células diferenciadas y representativa DE staining después de la clasificación. (A) + CXCR4 células teñidas (Q1) se enriquecen después de MACS de clasificación. El número de células CXCR4- (Q4) se reduce. Dependiendo de la línea celular están utilizando los rendimientos protocolo de diferenciación> 80% de células CXCR4-positivo 8 y MACS se puede utilizar para enriquecer aún más. (B) Las células indiferenciadas expresan el Sox2 marcador de pluripotencia (verde), pero no el marcador FoxA2 DE (roja ). (C) Después de que las células de clasificación MACS sólo muy pocos SOX2 indiferenciada + permanecen (rojo), mientras que la población ordenada expresa casi uniformemente el marcador FOXA2 DE (verde). (BC) Los núcleos se counterstained con DAPI (azul). La barra de escala en el panel (C) es de 100 micras y se aplica a todos los paneles. Imaging se realizó a 670 nm (rojo, Cy5), 520 nm (verde, FITC) y 433 nm (azul, DAPI), respectivamente. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

protocolos de diferenciación Actualmente se utilizan rara vez resultan en células diferenciadas 100%. Por razones que aún no se han abordado algunas células resisten el proceso de diferenciación. Dependiendo de la eficiencia del protocolo de diferenciación usado y de la propensión de la ESC línea A cierto número de células pluripotentes residuales se observa con frecuencia, incluso después de la diferenciación en el endodermo definitivo. Estas células residuales pueden poner en peligro diferenciaciones aguas abajo o un análisis más detallado, como la transcriptómica, la proteómica y análisis de la expresión de los genes miARN. células pluripotentes residuales u otros linajes no deseadas también pueden presentar efectos paracrinos que pueden interferir con los objetivos de diferenciación. En consecuencia, la eliminación de estas células puede resultar en una mejor reproducibilidad.

La purificación de CXCR4 + células que expresan endodermo después de la diferenciación se puede usar para enriquecer estas poblaciones y para eliminar las células que resistieron el proceso de diferenciación.La proteína marcadora DE superficie CXCR4 se puede utilizar para la purificación específica de las células del endodermo. El protocolo de purificación MACS a la mano se puede completar en menos de 2 horas y se puede ejecutar en un formato simple para mesas de trabajo en cada laboratorio de cultivo celular sin equipo de laboratorio caro y dispositivos. purificación FACS es una técnica utilizada comúnmente, pero emplea condiciones muy duras. Durante FACS células purificaciones generalmente se mantienen en suspensión durante un período prolongado de tiempo y las células están sujetos a otros factores difíciles, por ejemplo, de alta presión en la boquilla del dispositivo de FACS. En comparación, el procedimiento de MACS es rápido y suave. Esto mejora la capacidad de las células para volver a unir durante la resiembra después del proceso de purificación. Para facilitar aún más este reacoplamiento un inhibidor de la roca se añadió al medio de cultivo después y antes de la purificación para evitar la apoptosis. Otro factor importante que influye en la reinserción es la densidad a la que se volvieron a sembrar las células. Esta fuerte DEPENds en la línea celular utilizada. El número de células utilizadas para la siembra en este estudio son el número de células representativas que funcionan bien en nuestras manos. Sin embargo, puede haber necesidad de ajustar estos números para diferentes líneas celulares. Ambas medidas, la adición de un inhibidor de la Roca y la evaluación de los números de células para la resiembra, son críticos para el éxito del cultivo de células aún más después de la clasificación.

Con el protocolo de diferenciación DE utilizan típicamente> 70% de células CXCR4 + pueden obtenerse sin clasificar 8. El rendimiento del protocolo utilizado para la generación DE influye en consecuencia la eficiencia del protocolo MACS posterior purificación. En, la diferenciación eficiente general (> 80% de células CXCR4 +) produce una mayor pureza después de MACS clasificación (hasta 95%). Por lo tanto, el uso de este método de purificación reduce el número de células no diferenciadas sustancialmente pero 100% de pureza no se puede lograr. En el futuro, los marcadores de superficie específicos de linaje pueden definirse tsombrero permitirá la purificación de las células más diferenciadas terminalmente. El procedimiento de clasificación MACS es la selección principal para este propósito.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

La habilidad de asistencia técnica de Jasmin Kresse se agradece.

Materials

Name Company Catalog Number Comments
Hues8 human embryonic stem cell line Harvard Department of stem cell & regenerative biology Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line ES Cell International Suitable and robust cell line for endoderm generation
mTeSR1 Stemcell Technologies 5850 ESC culture medium
FCS Biowest S1860
Advanced RPMI 1640 Life Technologies 12633012
CD184 (CXCR4)-APC, human Miltenyi Biotec 130-098-357
anti-APC MicroBeads Miltenyi Biotec 130-090-855 
OctoMACS Separator Miltenyi Biotec 130-042-109 magnetic field
Y-27632 Selleck Chemicals S1049 ROCK inhibitor
CHIR-99021 Tocris Bioscience 4423
Activin A Peprotech 120-14
Gentle Cell Dissociation Reagent Stemcell Technologies 7174 Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel* Corning 354277 basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS Columns Miltenyi Biotec 30-042-201
MACS Separator Miltenyi Biotec 130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life Technologies NA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assay Applied Biosystems Hs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2 Santa Cruz Biotechnology sc-17320
Anti-FOXA2 MerckMillipore 07-633
Anti-SOX17 R&D Systems AF1924

DOWNLOAD MATERIALS LIST

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13, (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19, (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21, (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4, (7), e6286 (2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10, (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24, (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24, (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36, (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138, (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61, (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56, (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21, (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2, (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29 (2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6, (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6, (3), 17536 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics