النخابية ثمرة ثقافة الفحص و

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

طبقة واحدة من خطوط الخلايا النخابية قلب، وتوفير عوامل نظير الصماوي التي تحفز انتشار cardiomyocyte والمساهمة مباشرة الأسلاف القلب والأوعية الدموية خلال تطوير والمرض. في حين أن عددا من العوامل قد تورطت في الخلية (EPDC) تعبئة المستمدة النخاب، والآليات التي تحكم هجرتهم اللاحقة والتمايز وغير مفهومة. هنا، نقدم في المختبر والمجراة سابقا استراتيجيات لدراسة EPDC الحركة والتمايز. أولا، نحن تصف طريقة للحصول على خلايا النخابية الأولية من خلال ثقافة ثمرة من قلب فأر الجنينية. نحن أيضا إدخال بروتوكول مفصلة لتقييم الهجرة ثلاثية الأبعاد من EPDC وصفت في نظام الثقافة الجهاز. ونحن نقدم أدلة استخدام هذه التقنيات التي الحذف الوراثي للعوامل النسخ المتعلقة myocardin في النخاب خفف الهجرة EPDC. يخدم هذا النهج كمنصة لتقييم معدلات مرشح EPDCويمكن استخدام البيولوجيا وتطوير شاشات الوراثية والكيميائية لتحديد المنظمين رواية من تعبئة EPDC التي قد تكون مفيدة للإصلاح القلب.

Introduction

والنخاب هو عبارة عن طبقة واحدة من الخلايا الظهارية التي خطوط القلب وتأثيرات القلب التنمية، النضج والإصلاح. من خلال التبادل المنسق للغاية من إشارات نظير الصماوي، والحوار الحميم بين عضلة القلب والنخاب أمر لا غنى عنه لنمو القلب وتشكيل غير العضلية-الأنساب القلب 1. الخلايا المشتقة النخابية (EPDC) الخروج من مجموعة فرعية من الخلايا النخابية من خلال الظهارة إلى الوسيطة الانتقالية (EMT) وغزو الفضاء تحت النخاب وعضلة القلب الأساسي، وتفرق إلى حد كبير إلى خلايا جدارية الأوعية الدموية التاجية والخلايا الليفية القلب، ول بدرجة أقل، والخلايا البطانية والعضلية 3-9.

وقد نسبت آليات تنظيم EMT النخابية والغزو EPDC إلى اتخاذ إجراءات منسقة من مختلف الجزيئات بما في ذلك بروابط يفرز 10-13، مستقبلات سطح الخلية والجزيئات التصاق 14،15، regulators من قمية-القاعدية القطبية 16،17، GTPases صغيرة 18،19، والنسخ عوامل 2،20،21. في حين أن العديد من المؤثرات الجزيئية للهجرة EPDC تم تعريفها، فهم أفضل من الإشارات الفيزيولوجية التي تحفز تعبئة EPDC في الجنين قد تسريع عملية تطوير استراتيجيات لمعالجة هذه العملية عند البالغين لتحسين إصلاح القلب.

الدراسات التي تهدف إلى تحديد المنظمين جديدة للتعبئة EPDC تعتمد على تنقية هذه الفئة من السكان خلية أو تتبع هجرة الخلايا النخابية الفردية. واحد أو مجموعة من الجينات علامة، بما في ذلك WT1، Tcf21، Tbx18، و / أو Aldh1a2، ويستخدم عادة لتحديد النخاب الجنين 1. ومع ذلك، فإن استخدام هذه العلامات لتتبع هجرة EPDC ليس الأمثل كتعبير عن علامات النخابية يتراجع على مسار التنمية القلب، وغالبا ما فقدت عندما تمر خلايا النخابية transdifferentiation إلى خلايا اللحمة المتوسطة.

تطبيق نظام لجنة المساواة العرقية / loxP، بالتزامن مع الصحفيين لتعقب النسب وكان ومفيدة في وضع العلامات بشكل دائم النخاب ونسله خلال تطوير القلب، وبعد الإصابة الدماغية عند البالغين 7،22،23. تم إنشاء عدة خطوط لجنة المساواة العرقية المقيدة النخابية وتستخدم على نطاق واسع لتسمية EPDC واستراتيجيات حذف الجينات المشروط 1. وقد أدت هذه الدراسات إلى توصيف مختلف الأنساب النخابية، وتحديد وسطاء الحرجة من EPDC الحركة والتمايز. ومع ذلك، تشير الأدلة المتراكمة أيضا النخاب هو عدد السكان غير متجانسة من الخلايا الاصلية 4،24،25. وهكذا، فقط مجموعة فرعية من الخلايا النخابية سوف تستهدف استخدام برنامج تشغيل لجنة المساواة العرقية معين.

من أجل تسمية النخاب كامل بغض النظر عن لجنة المساواة العرقية خصوصية، وقد استخدمت عددا من المختبرات طريق مسدود ثمرةأنظمة البنية أو خارج الجسم الحي أساليب الثقافة الجهاز لعزل بأمانة أو تسمية الخلايا النخابية دون الاعتماد على التعبير عن النسب الجيني علامات 26-28. لدراسات الهجرة خارج الجسم، يتم عزل قلوب الأجنة قبل EMT النخابية ومثقف في المتوسط ​​تستكمل مع بروتين الفلورية الخضراء (GFP) -expressing اتش (إعلان / GFP) 9،18. يسمح هذا النهج لوضع العلامات الفعال للالنخاب بأكمله بدلا من مجموعة فرعية من الخلايا عن طريق إعادة التركيب بوساطة لجنة المساواة العرقية. ويتعرض الثقافات القلب في وقت لاحق إلى محرضات معروفة من EMT لتحفيز تعبئة EPDC 28،29. فيفو السابقين والحية التحليلات تكملها في المختبر الثقافات يزدرع النخابية، والتي هي نهج مفيد بشكل خاص لاستكشاف آليات مفصلة القيادة الهجرة EPDC.

هنا، نحن تصف طرق لعزل خلايا النخابية الأولية للدراسات في المختبر من epicardiآل EMT، وكذلك نظام الجهاز ثقافة للخارج الحي تحليلات EPDC الحركة. لقد أثبتنا مؤخرا فائدة ومتانة هذه الطريقة عن طريق تحوير وراثيا عامل المتعلقة myocardin النسخ (MRTF) / مصل عامل استجابة (SRF) مما يشير إلى محور للتلاعب الهجرة على أساس الأكتين من EPDC 9. بينما النتائج التي توصلنا إليها تبرز واحدة مسار الإشارات اللازمة لتنظيم الهجرة EPDC، وهذه الأساليب هي مناسبة لكشف الآليات التي تنسق بشكل جماعي EPDC الهجرة والتمايز. وعلاوة على ذلك، يمكن تنفيذ يزدرع والسابقين نظم الاستزراع المجراة في الشاشات وظيفية لتحديد المنظمين جديدة للتعبئة EPDC للتطبيقات العلاجية في تجديد القلب.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

ملاحظة: تمت الموافقة على جميع التجارب مع الفئران عن طريق لجنة جامعة على الثروة الحيوانية في جامعة روتشستر.

1. النخابية ثمرة ثقافة الفحص (الشكل 1A)

  1. الاستعدادات
    1. إعداد 5 مل المتوسطة ولعزل الخلايا النخابية الأساسية من خلال استكمال المتوسطة 199 (M199) مع 5٪ مصل بقري جنيني (FBS) و 1٪ البنسلين / الستربتوميسين (القلم / بكتيريا).
    2. قبل دافئة المتوسطة A و 100 مل هانكس المتوازن محلول الملح (HBSS) في 37 ° C حمام الماء.
    3. تسمح الشرائح غرفة المغلفة الكولاجين لتسخين إلى درجة حرارة الغرفة لمدة 30 دقيقة.
    4. إضافة 100 ميكرولتر المتوسطة وإلى كل بئر من الشريحة غرفة وتناوب بلطف إلى بالتساوي معطف سطح الكولاجين. كرر 8-12 الآبار. إزالة وسائل الاعلام بعد غرف الطلاء.
    5. قسامة قبل تحسنت HBSS في كل منهما 10 سم 2 لوحات تحتوي على 50 مل كل من HBSS.
  2. عزل الجنينية قلوب من سد الحوامل في 11.5 يوم تال للجماع (DPC).30
    1. تخدير الفأر مع 0.5 مل من 13 ملغ / مل الكيتامين / 0.88 ملغ / كوكتيل زيلازين مل في 1X Dulbecco والفوسفات مخزنة المالحة (DPBS) عن طريق الحقن داخل الصفاق. تأكيد التخدير المناسبة باستخدام اختبار قرصة أخمص قدميه. ألف قرص لطيف كافية لتحديد ما إذا كان الفأر هو استجابة. أي حركة أو مخلب سحب تشير الحيوان لا تخدير بما فيه الكفاية للقيام الجراحة. الموت ببطء عن طريق خلع عنق الرحم.
    2. وضع الماوس التي تواجه الجانب بطني حتى ورذاذ البطن مع الايثانول 70٪ للحد من التلوث الشعر.
    3. قرصة الجلد مع ملقط وقطع شق الجانبي في البطن مع مقص جراحي. عقد الجلد بحزم وثم مزق في معارضة الاتجاهات نحو الرأس والذيل.
    4. قرصة الصفاق مع ملقط وقطع مع مقص لفضح تجويف البطن.
    5. إزالة بعناية الساقط عن طريق قطع على طول مسراق الرحم. نقل الساقط تشريح ما قبل تحسنت HBSS في الأول10 سم 2 لوحة.
    6. فصل الساقط عن طريق قطع بين الأجنة.
    7. نقل الجنين إلى الثانية 10 سم 2 لوحة مع HBSS قبل تحسنت تحت المجهر تشريح. إزالة بعناية خارج الجنين الأنسجة والكيس المحي، ثم قطع رأس الجنين.
    8. قرصة جدار الصدر مع ملقط وتمزيق النسيج بعيدا في خط الوسط، وفضح تجويف الصدر.
    9. وضع ملقط وراء القلب. فهم المسالك تدفق وسحب القلب بعيدا عن الجنين. فصل الجهاز الرئوي والرئتين من القلب، إذا لا تزال تعلق.
  3. نقل القلب إلى بئر واحدة من الشرائح المغلفة الكولاجين ووضعه الجانب الظهري أسفل (الشكل 1B). كرر الخطوات 1.2.7-1.3 لكل جنين.
  4. مرة واحدة وقد تم نقل كل القلوب إلى الآبار الفردية، واحتضان الشريحة الغرفة لمدة 30 دقيقة عند 37 درجة مئوية، و 5٪ CO 2 للسماح للالتزام كافية لمصفوفة الكولاجين.
  5. إضافة بعناية20-50 ميكرولتر من قبل تحسنت يزدرع المتوسطة وحول كل قلب. هام: لا تقم بإضافة المتوسطة بسرعة كبيرة جدا أو إلى مستوى فوق القلب، وإلا قلوب قد فصل من الركيزة الكولاجين.
  6. ثقافة قلوب عند 37 درجة مئوية، و 5٪ CO 2 لحوالي 24 ساعة للسماح ثمرة النخابية. ملاحظة: الامتداد ويمكن ملاحظة في وقت مبكر من 3-4 ساعة من ثقافة (الشكل 1C) ويتكون أساسا من الخلايا الظهارية التي تظهر التشكل بالحصاة، مع الحد الأدنى من تلوث الخلية الوسيطة (أرقام 1D، E). تم الحصول على نتائج ممثلة باستخدام مجهر تشريح مجهزة بكاميرا.

2. الاجتثاث الوراثية وتحريض EMT في النخابية الامتداد

تحذير: التعامل مع الفيروسات الغدية مع الرعاية وفقا للمبادئ التوجيهية المعتمدة للسلامة الأحيائية.

  1. إعداد 15 مل المتوسطة ب (M199 تستكمل مع 1٪ FBS و 1٪ من ركلة جزاء / بكتيريا) وقبل الدافئة إلى 37 درجة مئوية في حمام مائي.
  2. لاستئصالالأليلات floxed، وإعداد يزدرع المتوسطة ب تستكمل مع 2.5 × 10 4 PFU / مل من اتش معربا عن لجنة المساواة العرقية recombinase (إعلان / لجنة المساواة العرقية) أو فيروس السيطرة.
    ملاحظة: يمكن أيضا أن يتم overexpression بوساطة الفيروسة الغدانية من الجينات المرشحة لتقييم ربح من الظواهر وظيفة. وينبغي تحديد التتر الفيروسية من قبل المستخدم النهائي.
  3. إزالة بعناية قلوب المنضب النخاب من الثقافات ثمرة باستخدام ملقط. قلوب نقل إلى 1.5 مل الأنابيب مع 800 ميكرولتر Trizol ومخزن في -80 درجة مئوية لمدة لاحقة عزل الحمض النووي الريبي وتحليل التعبير الجيني.
  4. يغسل كل جيدا مع DPBS لإزالة خلايا الدم والحطام الخلوي الزائد.
  5. إضافة 500 ميكرولتر يزدرع المتوسطة ب تستكمل مع (عناوين) اتش لكل ثقافة ثمرة واحتضان لمدة 24 ساعة على 37 درجة مئوية، 5٪ CO 2.
  6. لEMT التعريفي، وإزالة وسائل الإعلام وتجديد 37 ° C يزدرع المتوسط ​​ب تستكمل مع المؤتلف عامل النمو التحويلي (TGF) -β1 [10 نانوغرام / مل] أو مركبة (4 ملي ححمض ydrochloric (حمض الهيدروكلوريك) التي تحتوي على 1 ملغ / مل ألبومين المصل البقري (BSA)). إإكسبلنتس الثقافة ل24 ساعة إضافية عند 37 درجة مئوية، و 5٪ CO 2. المضي قدما في الجين / بروتين يحلل التعبير أو مناعية على النحو المفصل في البروتوكولات اللاحقة.
    ملاحظة: لقد تم تحفيز تحريض EMT النخابية مع تركيزات مختلفة من TGF-β1 تتراوح بين 0.5 نانوغرام / مل - 10 نانوغرام / مل 26،31-33. تركيزات أعلى من يجند قد يؤدي في غير محددة ملزمة لجميع مستقبلات عامل النمو التحويلي بيتا. يجب أن تعكس تركيز TGF-β1 أهداف تجريبية محددة.

3. جين تحليل التعبير عن النخابية الامتداد

  1. ذوبان الجليد قلوب المنضب النخاب المخزنة مسبقا في Trizol (2.2).
  2. وسائل الإعلام نضح من الثقافات EPDC وغسل مرتين مع DPBS.
  3. إضافة 800 ميكرولتر Trizol درجة حرارة الغرفة ليزدرع الثقافات.
  4. احتضان المنضب النخاب القلوب والثقافات EPDC في Trizol لمدة 5 دقائق في غرفة من درجات الحرارة إعادة. ماصة صعودا وهبوطا عشر مرات لتجانس العينة هي lysed.
    ملاحظة: قلوب قد يتطلب مزيدا من pipetting للتجانس تماما.
  5. نقل لست] إلى 1.5 مل أنابيب والمضي قدما إجمالي عزل الحمض النووي الريبي في تعليمات الشركة الصانعة. إضافة 10 ميكروغرام الجليكوجين قبل هطول الأمطار لزيادة العائد الحمض النووي الريبي. وسوف يزدرع نظرا تسفر حوالي 0.5-1.0 ميكروغرام الحمض النووي الريبي.
  6. إزالة تلويث الحمض النووي مع الدناز الأول وعكس نسخ 0.5 ميكروغرام مرنا في تعليمات الشركة الصانعة.
  7. التحقق من صحة نقاء إإكسبلنتس النخابية و / أو تحريض EMT مع النسخ العكسي الكمي (QRT) -PCR 34 باستخدام SYBR الأخضر وعلامات وصفها في الجدول 1. مستويات تطبيع مرنا لغليسيرألدهيد 3-فوسفات نازعة (GAPDH) وحساب التعبير النسبية باستخدام 2 - طريقة ΔΔCt 35. وأظهرت نتائج نموذجية في الشكل 2A.
عنوان "> 4. تحليل البروتين من النخابية الامتداد

  1. وسائل الإعلام نضح من الثقافات EPDC وغسل مرتين مع DPBS.
  2. إضافة 10 ميكرولتر العازلة البروتين تحلل الجليد الباردة (50 ملي تريس درجة الحموضة 7.5، 150 مم كلوريد الصوديوم، 1 ملم ثنائي أمين الإيثيلين رباعي حمض الخل ودرجة الحموضة 8.0، 1٪ تريتون X-100، 1X مثبط البروتياز كوكتيل) لكل غرفة البئر ووضع الشريحة الغرفة على جليد. قطع ما يقرب من ربع أسفل على P200 ماصة واستخدام قطعة المتبقية لتتخلص من خلايا الخروج من الشريحة. ماصة صعودا وهبوطا لخلايا النخابية ليز ونقل إلى أنبوب 1.5 مل.
  3. يصوتن إإكسبلنتس هي lysed على منخفضة (160 W) لمدة 5 دقائق في حمام ماء مثلج مع 30 ثانية وإيقاف دورات.
  4. لست] الطرد المركزي لمدة 10 دقيقة في 10000 x ج، 4 درجات مئوية. نقل طاف لأنبوب جديد وتحديد تركيز البروتين باستخدام فحص البروتين 36.
    ملاحظة: سوف يزدرع نظرا تسفر تصل إلى 1.5 ميكروغرام البروتين الكلي. لقد وجدنا أن تجميع إإكسبلنتس من اثنين من قلوب لد تحميل بروتين 2 ميكروغرام لكل بئر كافية للكشف عن العضلات الملساء α أكتين (ACTA2) وGAPDH 9. الكشف عن البروتينات المستهدفة الأخرى قد يتطلب تجميع العديد من عينات يزدرع كما هو محدد من قبل المستخدم النهائي.

5. سيتولوجية مناعية من النخابية الامتداد

  1. إزالة وسائل الاعلام من ثقافات يزدرع ويغسل مرتين مع DPBS.
  2. إضافة بلطف 500 ميكرولتر من 4٪ (ت / ت) لامتصاص العرق أو الميثانول الجليد الباردة إلى كل بئر وإصلاح إإكسبلنتس لمدة 5 دقائق في درجة حرارة الغرفة أو 10 دقيقة عند درجة حرارة -20 درجة مئوية، على التوالي. الإصلاح وفقا لمواصفات الأجسام المضادة على النحو الموصى به من قبل الشركة المصنعة.
  3. إزالة تثبيتي، وشطف كل جيدا مع DPBS ثلاث مرات لمدة 5 دقائق.
  4. Permeabilize الخلايا مع 500 ميكرولتر من 0.1٪ (ت / ت) تريتون X-100 في DPBS لمدة 5 دقائق.
  5. إزالة حل permeabilization وشطف مع DPBS ثلاث مرات لمدة 5 دقائق.
  6. منع الخلايا مع 10٪ مصل في DPBS لمدة 30 دقيقة في غرفة من درجات الحرارةإعادة.
  7. المضي قدما في تلطيخ الأجسام المضادة الأولية في توصيات الشركة الصانعة والظروف المثلى كما هو محدد من قبل المستخدم النهائي.
  8. إزالة حل الأجسام المضادة وشطف مع DPBS ثلاث مرات لمدة 5 دقائق.
  9. تطبيق الضد الثانوية في تعليمات الشركة الصانعة ومباين مع صبغ النووي المناسب.
  10. إزالة حل الأجسام المضادة وشطف مع DPBS ثلاث مرات لمدة 5 دقائق.
  11. إزالة جدران الغرفة الشرائح في تعليمات الشركة الصانعة وإضافة المتوسطة تصاعد مائي مباشرة إلى الخلايا. وضع ساترة على الخلايا وختم بطلاء الأظافر. وتظهر نتائج نموذجية في الشكل 2B - 2D باستخدام مقلوب المجهر متحد البؤر المسح الضوئي.

6. فيفو السابقين الثقافة الفحص (الشكل 3A)

  1. الاستعدادات
    1. إعداد 12 مل فيفو السابقين الثقافة المتوسطة باستخدام (1: 1) خليط من Dulbecco لتعديل النسر متوسطة (DMEM): M199 تستكمل مع 10٪FBS و 1٪ من ركلة جزاء / بكتيريا.
    2. في 37 ° C حمام الماء، قبل الدافئ فيفو السابقين الثقافة المتوسطة، و 100 مل HBSS.
    3. قسامة 1 مل المتوسط ​​قبل تحسنت إلى 8-12 الآبار من 24 لوحة جيدا.
    4. نقل قبل تحسنت HBSS لمدة 10 سم 2 لوحات، وتحتوي على 50 مل لكل منهما.
  2. عزل الماوس قلوب الجنينية في HBSS (كما هو موضح في 1.2) من السدود الحوامل 12.5 في شركة ظفار.
  3. نقل كل قلب لبئر واحدة من 24 لوحة جيدا تحتوي على فيفو السابقين الثقافة المتوسطة. احتضان لوحة عند 37 درجة مئوية، و 5٪ CO 2 مع هزاز لطيف يدويا أو باستخدام منصة هزاز لمنع الالتزام. الشروع فورا في خطوة 7.1.

7. النخابية وصفها وEMT التعريفي في الثقافات فيفو السابقين

  1. لتسمية النخاب، وإعداد 12 مل من 37 درجة مئوية خارج الحي مستنبت تستكمل مع 3.0 × 10 6 PFU / مل من الإعلان / GFP. لالاجتثاث المستهدفة من الأليلات floxed، ونقل 6 مل مند / GFP تستكمل مستنبت إلى 15 مل أنبوب مخروطي الشكل الجديد. إضافة إعلان / لجنة المساواة العرقية أو السيطرة اتش إلى تركيز النهائي من 1.5 × 10 6 PFU / مل.
    ملاحظة: تحليلات ويمكن أيضا أن يتم كسب وظيفة خارج مع الفيروسة الغدانية المناسبة توصيل الجينات بوساطة.
  2. بعناية إزالة مستنبت من كل بئر من 24 لوحة جيدا باستخدام تلميح P1،000 ماصة.
  3. إضافة بلطف مستنبت تستكمل مع اتش (عناوين) كل بئر.
  4. احتضان لوحة عند 37 درجة مئوية، و 5٪ CO 2 لمدة 24 ساعة مع هزاز لطيف.
  5. لEMT الاستقراء، وإعداد 12 مل من 37 درجة مئوية خارج الحي مستنبت تحتوي على 10 نانوغرام / مل TGF-β1 و 20 نانوغرام / مل صفائح المستمدة عامل النمو (PDGF) -BB أو مركبة (4 ملم حمض الهيدروكلوريك تحتوي على 1 ملغ / مل BSA ).
  6. إزالة بعناية مستنبت من كل بئر من 24 لوحة جيدا باستخدام تلميح P1،000 ماصة. شطف بلطف قلوب مع 1 مل DPBS.
  7. إزالة DPBS وتجديد قلوب مع الثقافة فيفو السابقين ليdium التي تحتوي على عامل النمو التحويلي β1 وPDGF-BB أو مركبة.
  8. احتضان لمدة 24 ساعة على 37 درجة مئوية، 5٪ CO 2 مع هزاز لطيف.

8. الحفظ بالتبريد والمناعية للثقافات فيفو السابقين

  1. إعداد القلوب لالحفظ بالتبريد.
    1. إزالة مستنبت وغسل قلوب مرتين مع DPBS الجليد الباردة.
    2. إضافة 1 مل من 4٪ (V / V) لامتصاص العرق إلى كل قلب وإصلاح لمدة 2 ساعة في 4 درجات مئوية مع هزاز لطيف.
    3. إزالة تثبيتي، وغسل قلوب مرتين مع DPBS. نقل القلوب إلى آبار جديدة مع 1 مل 10٪ (ث / ت) السكروز أعد DPBS. احتضان لوحة بين عشية وضحاها في 4 درجات مئوية مع هزاز لطيف.
    4. نقل بعناية قلوب لآبار جديدة مع 18٪ (ث / ت) السكروز أعد DPBS. احتضان لوحة بين عشية وضحاها في 4 درجات مئوية مع هزاز لطيف.
    5. نقل كل قلب لcryomold تحتوي على الأنسجة تجميد المتوسطة. على الفور تجميد كتل باستخدام النيتروجين السائل وتخزينه في -80 & #176؛ ج.
  2. قلوب القسم في 5 ميكرون باستخدام ناظم البرد ومكان أقسام الأنسجة على شرائح المجهر موجبة الشحنة. تخزين الشرائح في -80 درجة مئوية حتى تلطيخ.
  3. أداء المناعية على أقسام للكشف عن الغشاء القاعدي دون النخابية.
    1. ذوبان الجليد الشرائح لمدة 30 دقيقة على الأقل في درجة حرارة الغرفة.
    2. ترطيب أقسام عن طريق غسل مرتين في DPBS لمدة 5 دقائق مع هزاز لطيف.
    3. قسم Permeabilize مع 0.1٪ (ت / ت) تريتون X-100 في برنامج تلفزيوني لمدة 5 دقائق في درجة حرارة الغرفة.
    4. تغسل الشرائح مرتين في DPBS لمدة 5 دقائق مع هزاز لطيف.
    5. وصمة عار قبالة DPBS الزائدة وتحديد المنطقة تلطيخ مع مسعور وسم القلم. أقسام كتلة مع 10٪ مصل في DPBS لمدة 30 دقيقة في درجة حرارة الغرفة.
    6. إزالة كتلة وتطبيق نوع الكولاجين الرابع الأضداد (ColIV، 1: 200) المخفف في كتلة. احتضان بين عشية وضحاها في 4 درجات مئوية في غرفة الرطوبة التي تسيطر عليها.
    7. غسل الشرائح ثلاث مرات في DPBS ل5 دقائق مع هزاز لطيف.
    8. تمييع fluorescently الأجسام المضادة مترافق الثانوية (1: 500) ودابي (1: 5000) في DPBS وتطبيق على الشرائح. احتضان لمدة 1 ساعة في درجة حرارة الغرفة. اختر الضد الثانوية المناسب مع الانبعاثات والطول الموجي الإثارة واضح من GFP.
    9. غسل الشرائح ثلاث مرات في برنامج تلفزيوني لمدة 5 دقائق مع هزاز لطيف. جبل الشرائح مع تصاعد المتوسطة.

9. التصوير والكمي للثقافات فيفو السابقين

  1. هل لديك صورة المستخدم أعمى وتحديد أقسام الملون. صورة لا يقل عن خمسة أقسام الأنسجة غير متتالية من قلب الواردة في 4-5 مواقع التعسفية على طول النخاب (حافة القلب) باستخدام مجهر فلوري أو متحد البؤر في 40X التكبير. وتظهر نتائج نموذجية في الشكل 3B باستخدام مقلوب المجهر متحد البؤر المسح الضوئي.
  2. العد يدويا العدد الكلي للخلايا إيجابية GFP في صورة معينة. تحديد المهاجرة EPDC كما GFP صخلايا sitive تقع داخل أو خارج ColIV الغشاء القاعدي تحت النخاب. تحديد المئة من GFP الخلايا المهاجرة حيث بلغ عدد المهاجرين GFP خلايا إيجابية على العدد الكلي للخلايا إيجابية GFP في صورة معينة. وتظهر نتائج نموذجية في الشكل 3C-D باستخدام مقلوب المجهر متحد البؤر المسح الضوئي.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

والنخاب يمكن عزل بكفاءة باستخدام ثقافة الفحص ثمرة من خلال الاستفادة من موقعها الخارجي واستغلال اللدونة التنموية وسلوك الهجرة لا يتجزأ من EPDC. يتم عزل قلوب الجنينية الفئران في E11.5 قبل EMT النخابية والجانب الظهري مثقف أسفل على الشرائح غرفة المغلفة الكولاجين 26 (الشكل 1A، B). وسوف تستمر قلوب Explanted للتعاقد. ومع ذلك، فإن النخاب التمسك مصفوفة الكولاجين والهجرة الخروج من عضلة القلب خلال 24 ساعة من ثقافة (الشكل 1C). ويمكن ملاحظة الخلايا النخابية المنبثقة بعيدا عن القلب مع مثل حصاة كبيرة في التشكل، مما يدل على هوية الظهارية (أرقام 1C-E). بعد 24 ساعة من الثقافة، وإزالة قلوب المنضب النخاب لتحليل الجينات أو البروتين التعبير.

بالإضافة إلى مراقبة epitheliآل التشكل، ونقاء من مزارع الخلايا النخابية يمكن مواصلة التحقق من صحتها عن طريق التعبير عن الجينات والبروتينات علامات المقيدة النخابية. إإكسبلنتس خلية النخابية عرض تعبير قوي من علامات النخابية والظهارية (Aldh1a2، Tcf21، وWT1) وانخفاض التعبير عن الجينات cardiomyocyte (Nkx2-5 وMyh7) مقارنة قلوب المنضب النخاب (الشكل 2A). لمزيد من التحقق من هوية، يتم إصلاح الثقافات خلية النخابية 48 ساعة بعد إزالة القلب وشارك الملون مع الأجسام المضادة ضد الورم WILM في 1 (WT1) وزونا النطيقة بروتين 1 (ZO1) لتسمية الخلايا الظهارية ومنعطفات ضيقة بين الخلايا، على التوالي 37،38 ( الشكل 2B). هذه الطريقة ثقافة ثمرة غلة عالية النقاء نسبيا من الخلايا الظهارية. ومع ذلك، يمكن للمستخدمين مراقبة نسبة صغيرة من تلوث الخلية. الخلايا الليفية وخلايا العضلات الملساء يحمل النمط الظاهري الوسيطة ممدود مع غياب ملحوظ من nucleع WT1 ومنعطفات ضيقة تنظيم (الشكل 2C). استكشاف تقنيات للحد من يتم توسيع كمية من تلوث الخلية غير النخابية في المناقشة.

فحص يزدرع ثمرة هو نظام الثقافة مفيد لاستجواب البيولوجيا النخابية في المختبر. لإظهار ليونة الخلية النخابية، وحفز إإكسبلنتس مع TGF-β1 [10 نانوغرام / مل] للحث على transdifferentiation إلى خلايا اللحمة المتوسطة 26،28. بعد 24 ساعة من التحفيز، EPDC تبني النمط الظاهري الوسيطة مع انخفاض تلطيخ ZO1 وقوية دي نوفو تشكيل العضلات ألياف إيجابية-α أكتين السلس الإجهاد (ACTA2 أو SMA)، وخاصة في محيط الثقافة 39 (الشكل 2D، أحمر). في المقابل التأكيد على تجميع الألياف في محيط إإكسبلنتس، خلايا النخابية متموجة مع جهات الاتصال بين الخلايا أكثر تحديدا (ZO1 والأخضر) في وسط monolayeعرض ص تعبير البروتين ACTA2 في الأكتين القشرية.

بالإضافة إلى خضوعه EMT، سوف EPDC غزو عضلة القلب والتفريق، مما يشكل نسبة كبيرة من السكان غير cardiomyocyte. ويمكن تقييم حركية من EPDC باستخدام المجراة سابقا نظام الجهاز ثقافة المحددة سابقا حيث وصفت الخارج من قلوب E12.5 مع اتش معربا عن GFP 9،18 (الشكل 3A). قلوب صفت هي مزيد من تربيتها لمدة ثلاثة أيام بحضور TGF-β1 [10 نانوغرام / مل] وPDGF-BB [20 نانوغرام / مل] إلى تشجيع الهجرة EPDC. يتم تناوب الثقافات الجهاز بشكل دوري لمنع التصاق خارج الحي القلوب إلى السطح لوحات الثقافة. يسمح هذا النظام لوضع العلامات الفعال للالنخاب وتقييم EPDC الحركة بالكامل في نموذج ثلاثي الأبعاد بدلا من الهجرة الاتجاه مع فحوصات في المختبر الصفر. هجرة EPDC هي obserفيد كما غزو GFP خلايا النخابية الإيجابية داخل أو خارج ColIV (الأحمر) تحت النخاب الطابق السفلي غشاء 16 (أرقام 3B، C). لتوضيح فائدة هذا النظام، ونحن في الآونة الأخيرة أنه التلاعب في محور يشير MRTF / SRF يمكن أن تؤثر على الحركة من EPDC 9. حذف Mrtfa وMrtfb عن طريق الاستئصال بوساطة لجنة المساواة العرقية الأليلات floxed (MRTFdKO) خفف هجرة EPDC في الفضاء تحت النخاب. على العكس من ذلك، التعبير عن MRTF-A (إعلان / MRTF-A) في C57BL / 6 قلوب النتائج في زيادة الهجرة EPDC واضطراب الغشاء ColIV الطابق السفلي (أرقام 3C، D) القسري.

جينة إلى الأمام عكسي NCBI الانضمام
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

الجدول 1: متواليات من الامام وعكس الاشعال المستخدمة للتأكد من صحة النخابية ثمرة ثقافة الطهارة من تحليل النخاب وعضلة القلب مقيدة التعبير الجيني يتحدد التعبير الجيني عن طريق واي QRT-PCR.المعلمات التالية عشر: تفسد على 95 درجة مئوية لمدة 10 ثانية؛ يصلب في 60 درجة مئوية لمدة 30 ثانية؛ تكرار 50X دورات.

الشكل 1
الشكل 1: عزل الخلايا الأولية النخابية باستخدام ثقافة الفحص ثمرة (أ) تمثيل تخطيطي للالنخابية فحص ثمرة يزدرع مع جدول زمني الموصى بها لتعديل النخابية والتحليل. (B - E) التمثيلية الصور brightfield من نقاط زمنية مختلفة خلال فحص يزدرع. توضع (ب) الجنينية يوم E11.5 قلوب الفئران الجانب الظهري أسفل على الركيزة الكولاجين. والخلايا (C) النخابية (السهام البيضاء) تبدأ في الهجرة خارج قلبية في غضون 3-4 ساعة من ثقافة. خلايا الدم (الأسهم السوداء) قد تتراكم قريب أو تغطية إإكسبلنتس أثناء ثمرة النخابية. (D، E) بعدما يقرب من 24 ساعة من الثقافة، وإزالة القلوب وتبقى الطبقات الوحيدة النخابية انضمت إلى الشريحة الغرفة. الامتداد الخلوية عرض التشكل الظهارية مع ترتيب مثل حصاة كبيرة من الخلايا. الحانات النطاق = 250 ميكرون (BD) أو 50 ميكرون (C، E). H = القلب، LA = الأذين الأيسر، والوقف = البطين الأيسر، أفت = تدفق المسالك، RA = الأذين الأيمن، RV = الأيمن البطين. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: تقييم النخابية ثمرة خلية الطهارة (أ) التحقق من صحة QRT-PCR من النخابية تقييد علامات (Tcf21، Aldh1a2، وWT1) في الثقافات ثمرة مقارنة التعبير الجيني عضلة القلب (Nkx2-5 وMyh7) في المنضب النخاب E11. 5 القلوب. تمثيلا والبياناتر يعني ± SEM = 8 في كل مجموعة). النجمة دلالة إحصائيا باستخدام الطالب تي اختبار مع **** P <0.0001. (ب) الممثل المشترك مناعي تلطيخ من الامتداد unstimulated للتعبير النخابية (WT1 والأحمر)، منعطفات ضيقة بين الخلايا (ZO1 والأخضر)، والنوى (دابي، الأزرق). (C) مثال على تلوث الخلية في ثقافة ثمرة. ويلاحظ خلايا النخابية (النجمة) على يمين لوحة مع هوية مميزة الظهارية (WT1 النووي، الحمراء)، وتنظيم تقاطعات الظهارية ضيقة (ZO1 والأخضر). الخلايا المجاورة في مركز (السهام البيضاء) يحمل على التشكل الوسيطة ممدود، كما هو موضح من قبل فرق التصوير التدخل النقيض (DIC)، مع الحد الأدنى من البروتين WT1 النووي وغير المنظم تلطيخ ZO1. وحفز (D) مزارع الخلايا النخابية مع مركبة (4 ملم حمض الهيدروكلوريك في 1mg / مل BSA) أو TGF-β1 [10 نانوغرام / مل] للحث على النخابيةEMT. التحفيز TGF-β1 يعزز التعبير القوي من ACTA2 (الحمراء) في المناطق القشرية الخلايا متموجة في مركز إإكسبلنتس أو في ألياف الإجهاد من الخلايا المهاجرة على حافة أو محيط أحادي الطبقة. وصفت التصاقات خلية ZO1 (الخضراء). على نطاق والحانات = 25 ميكرون (BD). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل (3): تحويلة تقييم فيفو من EPDC على الحركة (A) والجدول الزمني التخطيطي للخارج الحي القلب فحص الثقافة. (ب) ممثل 5 ميكرون قسم من C57BL / 6 E12.5 القلب transduced مع الإعلان / GFP (الأخضر) لمدة 24 ساعة لتسمية الخارج من القلب. كانت خارج الحي قلوب في وقت لاحق مثقف لمدة 48 ساعة إضافية مع TGF- β1 [10 نانوغرام / مل]وPDGF-BB [20 نانوغرام / مل] إلى تحفيز الهجرة EPDC. أقسام اشتركت فى ملطخة للColIV (أحمر) لتسمية الغشاء القاعدي تحت النخاب والنوى (دابي، الأزرق). ويرد خارج الحي قلب الثقافة التشكل من مدينة دبي للإنترنت. LV = البطين الأيسر، RV = البطين الأيمن، RA = الأذين الأيمن. (C، D) تطبيق مثال خارج الحي فحص الهجرة عن طريق تحوير محور تنظيمي MRTF / SRF. تم تعديل هذا الرقم من [9]. تم عزل قلوب E12.5 من Mrtfa - / Mrtfb فلوريدا / فلوريدا الأجنة وtransduced مع الإعلان / GFP وفيروس السيطرة أو اتش معربا عن لجنة المساواة العرقية recombinase لمدة 24 ساعة وخارج الحي الثقافات ثم حفز مع TGF-β1 [10 نانوغرام / مل] وPDGF-BB [20 نانوغرام / مل] لمدة 48 ساعة إضافية. لوحظ EPDC الحركة (السهام البيضاء)، وهجرة GFP خلايا إيجابية (الخضراء) داخل أو خارج ColIV (الحمراء). حذف Mrtfb لجنة المساواة العرقية بوساطة في <م> Mrtfa - / - الخلفية (MRTFdKO) النتائج في تخفيف الهجرة EPDC مقارنة للسيطرة على القلوب. على العكس من ذلك، اضطر تعبير عن MRTF-A (إعلان / MRTF-A) في E12.5 C57BL / 6 قلوب يعزز الهجرة EPDC. (D) الكمي ل٪ GFP هجرة الخلايا إيجابية. وتعرض البيانات كمتوسط ​​± SEM = 4 قلوب لكل حالة). تم تحليل البيانات باستخدام اتجاه واحد أنوفا مع النجمة تدل دلالة إحصائية عن طريق اختبارات خاصة بعد توكي مع **** P <0.0001. الحانات النطاق = 200 ميكرون (B) أو 25 ميكرون (C). تم الحصول عليها عن الصور باستخدام مقلوب ليزر متحد البؤر المسح المجهري. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

نحن هنا الخطوط العريضة طرق مفصلة لعزل الخلايا النخابية الأولية التي كتبها ثمرة وتتبع هجرة EPDC في فيفو السابقين الثقافات القلب. للثقافات ثمرة، والوقت المناسب لإزالة القلب المنضب النخاب يختلف قليلا بين التجارب. ينصح الرصد الدوري لإإكسبلنتس بعد الحضانة بين عشية وضحاها لقياس مدى نمو النخابية واستخراج القلب قبل أن تظهر الخلايا الليفية. لضمان نقاء، يجب إزالة قلوب خلال 24 ساعة من explanting لمنع تراكم الأنساب غير النخابية. تقليم بعيدا المسالك تدفق وكل من الأذينين السابقة لنقل القلب إلى شريحة الغرفة يمكن أن تقلل أيضا من أنواع الخلايا تلويث 27،40. منذ يتم عزل قلوب الجنين من القمامة الماوس خلال نافذة ضيقة من الوقت وتربيتها تحت نفس الظروف، والوقت لالامتداد لتظهر مشابه نسبيا من قلب واحد إلى آخر في تجربة. ولذلك، يجب على جميع قلوب بالبريد إزالتها عند غالبية إإكسبلنتس يحمل الامتداد النخابية. في بعض الحالات، وخلايا النخابية لا تهاجر بكفاءة من القلب الذي هو التعاقد بقوة أكثر من الآخرين، وفي هذه الحالة هذا يزدرع يجب استبعادها من التجربة.

يمكن تراكم خلايا الدم غالبا ما تخفي أحادي الطبقة مسطحة الخلايا النخابية (الأسهم، الشكل 1C)، مما يجعل من الصعب تصور الامتداد. لتجنب الإفراط مساهمة خلايا الدم، ويمكن قلوب تبقى في HBSS لبضع دقائق على تشريح من الجنين. هذا يتيح وقتا كافيا لقلب الجنين إلى ضخ الدم المتبقي في حجرات القلب قبل نقله إلى شريحة الغرفة. بدلا من ذلك، المكمل لالثقافات مع يزدرع المتوسطة وبعد أول حضانة بين عشية وضحاها سوف تساعد على طرد بعيدا بعض الدم الزائد وتكشف عن الامتداد. ومع ذلك، لا ينبغي أن يرتفع مستوى وسائل الاعلام فوق القلب والتوتر السطحي يمكن أن تتسبب في القلبلسحب بعيدا عن الركيزة. ويلاحظ الامتداد النخابية قوية باستخدام الكولاجين النوع الأول والركيزة الثقافة؛ ومع ذلك، فقد تم الإبلاغ عن ركائز أخرى تبعا للكائن و / أو تطبيق 27،40-42. باستخدام هذا البروتوكول، يمكن خلايا النخابية الجنين الأولية تزدهر لمدة 4 أيام بعد إزالة القلب وتجديد المتوسط ​​اليومي؛ ومع ذلك، والتصميمات التجريبية التي تتطلب فترات أطول من ثقافة ينبغي أن تحدد من قبل المستخدم النهائي. منذ يتم تنشيط EMT النخابية بقوة أثناء التطور الجنيني، وهذه التقنية الثقافة ثمرة تقتصر على تخصيب الخلايا النخابية الجنين. وقد وصفت جماعات غيرها من وسائل لعزل الكبار الخلايا النخابية 43،44.

لخارج الجسم الحي المقايسات الهجرة، واستخراج القلب ووضع العلامات خلية النخابية ينصح في E12.5 لسببين. أولا، قلوب معزولة بعد E12.5 أكبر، وبالتالي تتطلب المزيد من نضح لدعم قدرتها على البقاء. نشر بسيطة من المواد الغذائيةالصورة ليست كافية للحفاظ على الثقافات الجهاز من قلوب أكبر. ثانيا، EMT النخابية والهجرة EPDC تحدث حول E12.5. لذلك، يجب أن يكون المسمى النخاب مع اتش معربا عن بروتين فلوري مباشرة بعد استخراج القلب لتحقيق أقصى قدر من الكشف عن EPDC. بدلا من ذلك، تم الإبلاغ عن ثنائي الأسيتات carboxyfluorescein succinimidyl استر (CFSE) سابقا لتسمية الخارجي للقلب وتتبع EPDC الهجرة 10،45.

وعلى النقيض من المقايسات ثمرة، ينبغي هزت خارج الحي الثقافات بشكل دوري لتجنب التعلق القلب وثمرة خلية النخابية. الثقافات ويمكن أيضا أن يكون تحريكها باستمرار في حاضنة مجهزة الروك على وضع أدنى سرعة. سيلاحظ المستخدمين التغييرات في مورفولوجية القلب في غضون بضعة أيام من الثقافة الجهاز ويجب تجنب التحليلات وراء 72 ساعة من العزلة القلب. باستخدام هذا الاختبار، لوحظ غزو EPDC ضمن 48 إلى 72 ساعة من ثقافة. في حين أن نظام لجنة المساواة العرقية، loxPوقد استخدم في الجسم الحي لرسم خريطة للتوطين EPDC إلى الأوعية الدموية التاجية، الخلالي عضلة القلب، والحاجز بين البطينين 7،22، ويقتصر هذا الأسلوب فيفو السابقين إلى الهجرة EPDC في غضون بضع طبقات الخلايا للفضاء شبه النخابية. وهكذا، وهذا الأسلوب هو أكثر ملاءمة لتحديد المنظمين من EPDC الحركة والغزو بدلا من تحديد الوجهة النهائية للهجرة EPDC.

العزلة خلية النخابية وخارج الجسم الحي المقايسات الهجرة، بالاشتراك مع ربح أو خسارة من النهج وظيفة، وقد ثبت بالفعل مفيدة لتقييم الجينات المرشحة التي قد تؤثر EPDC البيولوجيا 9،18،46. كما توفر هذه الأساليب منصة لتحقيق مكاسب من وظيفة أو شاشات الخسارة من وظيفة لتحديد الجهات التنظيمية الجديدة للهجرة EPDC. هذه الاستراتيجية، بالتزامن مع مضان تنشيط فرز الخلايا أو وحيد الخلية RNA التسلسل، يمكن أن توفر أيضا فرصة لتحقيق التجانس النخابيةوالتمايز EPDC بمزيد من التفصيل. وأخيرا، يمكن أن تستخدم إدخال تعديلات على هذه الإجراءات من أجل تطوير شاشات للجزيئات الصغيرة التي تؤثر على الخلايا النخابية والبيولوجيا EPDC لغرض الطب التجديدي القلب.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgements

وأيد EMS من المنح المقدمة من المعاهد الوطنية للصحة (NIH) [رقم منحة R01HL120919]. جمعية القلب الأمريكية [عدد المنح 10SDG4350046]. جامعة روتشستر جائزة CTSA من المعاهد الوطنية للصحة [عدد المنح UL1 TR000042]. وأموال بدء التشغيل من االعاب CVRI. وأيد MAT في جزء من منحة إلى جامعة روتشستر مدرسة الطب وطب الأسنان من مبادرة معهد هوارد هيوز الطبي ميد حيز غراد. وجائزة المؤسسي روث L. كيرشتاين القومي للبحوث الخدمة من المعاهد الوطنية للصحة [رقم منحة GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics