एपिकार्डियल परिणाम संस्कृति परख और

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

epicardial कोशिकाओं लाइनों की एक एकल परत दिल, पैराक्राइन कारक है कि cardiomyocyte प्रसार को प्रोत्साहित प्रदान करने और सीधे विकास और बीमारी के दौरान हृदय progenitors योगदान दे। कारकों की एक संख्या epicardium व्युत्पन्न सेल (EPDC) जुटाने में फंसाया गया है, वहीं उनके बाद पलायन और भेदभाव गवर्निंग तंत्र खराब समझ रहे हैं। यहाँ, हम इन विट्रो और पूर्व vivo रणनीतियों में पेश EPDC गतिशीलता और भेदभाव का अध्ययन करने के लिए। सबसे पहले, हम भ्रूण माउस दिल से परिणाम संस्कृति से प्राथमिक epicardial कोशिकाओं को प्राप्त करने की एक विधि का वर्णन है। हम यह भी एक अंग संस्कृति प्रणाली में लेबल EPDC के तीन आयामी प्रवास का आकलन करने के लिए एक विस्तृत प्रोटोकॉल का परिचय। हम इन तकनीकों है कि epicardium में myocardin से संबंधित प्रतिलेखन कारक के आनुवंशिक विलोपन attenuates EPDC माइग्रेशन का उपयोग सबूत प्रदान करते हैं। यह दृष्टिकोण EPDC के उम्मीदवार संशोधक का मूल्यांकन करने के लिए एक मंच के रूप में कार्य करता हैजीव विज्ञान और कहा कि हृदय की मरम्मत के लिए उपयोगी हो सकता है EPDC लामबंदी के उपन्यास नियामकों की पहचान करने के लिए आनुवंशिक या रासायनिक स्क्रीन विकसित करने के लिए इस्तेमाल किया जा सकता है।

Introduction

epicardium mesothelial कोशिकाओं की एक परत है कि लाइनों दिल और प्रभावों हृदय विकास, परिपक्वता और मरम्मत। पैराक्राइन संकेतों के एक अत्यधिक समन्वित विनिमय के माध्यम से, मायोकार्डियम और epicardium के बीच अंतरंग बातचीत हृदय वृद्धि और गैर-myocyte हृदय प्रजातियों 1 के गठन के लिए अपरिहार्य है। एपिकार्डियल व्युत्पन्न कोशिकाओं (EPDC) एक उपकला करने वाली mesenchymal संक्रमण (EMT) 2 के माध्यम से epicardial कोशिकाओं के एक सबसेट से उभरने, subepicardial अंतरिक्ष और अंतर्निहित मायोकार्डियम पर आक्रमण, और काफी हद तक कोरोनरी संवहनी भित्ति कोशिकाओं और हृदय fibroblasts में अंतर है, और एक को हद तक कम करने, endothelial कोशिकाओं और cardiomyocytes 3-9।

Epicardial EMT और EPDC आक्रमण के विनियमन तंत्र स्रावित ligands 10-13, कोशिका की सतह रिसेप्टर्स और आसंजन अणुओं 14,15, नियमित सहित विभिन्न अणुओं के समन्वित कार्रवाई करने के लिए जिम्मेदार ठहराया गया हैशिखर-बेसल polarity 16,17, छोटे GTPases 18,19, और प्रतिलेखन के विधायकों 2,20,21 कारकों। जबकि EPDC प्रवास के आणविक प्रभावोत्पादक के कई परिभाषित किया गया है, शारीरिक संकेत है कि भ्रूण में EPDC लामबंदी को प्रोत्साहित रणनीतियों के विकास में तेजी लाने सकता है की एक बेहतर समझ में सुधार हृदय की मरम्मत के लिए वयस्क में इस प्रक्रिया में हेरफेर करने के लिए।

EPDC लामबंदी के उपन्यास नियामकों की पहचान करने के उद्देश्य से अध्ययन इस सेल की आबादी की शुद्धि या व्यक्तिगत epicardial कोशिकाओं के प्रवास ट्रेसिंग पर भरोसा करते हैं। एक या WT1, Tcf21, Tbx18, और / या Aldh1a2 सहित मार्कर जीन, का एक संयोजन, सामान्यतः भ्रूण epicardium 1 की पहचान के लिए प्रयोग किया जाता है। हालांकि, इन मार्कर के उपयोग पलायन के रूप में epicardial मार्करों की अभिव्यक्ति दिल के विकास के पाठ्यक्रम पर क्षीण हो जाती है और अक्सर खो दिया है जब epicardial कोशिकाओं transdif गुजरना EPDC इष्टतम नहीं है ट्रैक करने के लिएmesenchymal कोशिकाओं में ferentiation।

Cre / loxP प्रणाली के आवेदन, वंश अनुरेखण पत्रकारों के साथ संयोजन के रूप में, स्थायी रूप से दिल के विकास के दौरान epicardium और उसके वंश लेबलिंग और वयस्क 7,22,23 में इस्कीमिक चोट के बाद में उपयोगी हो गया है। कई epicardial-प्रतिबंधित Cre लाइनों उत्पन्न किया गया है और व्यापक रूप से EPDC लेबल और सशर्त जीन विलोपन रणनीतियों 1 के लिए किया जाता है। इन अध्ययनों से विभिन्न epicardial प्रजातियों के लक्षण, और EPDC गतिशीलता और भेदभाव की आलोचना मध्यस्थों की पहचान करने के लिए नेतृत्व किया है। हालांकि, जमते सबूत भी पता चलता है epicardium पूर्वज कोशिकाओं 4,24,25 की एक विषम आबादी है। इस प्रकार, केवल epicardial कोशिकाओं के एक सबसेट एक दिया Cre ड्राइवर का उपयोग लक्षित किया जाएगा।

आदेश रचनात्मक विशिष्टता के बावजूद पूरे epicardium लेबल करने में, प्रयोगशालाओं की संख्या परिणाम संस्कृति का उपयोग किया हैसंरचना सिस्टम या पूर्व vivo अंग संस्कृति तरीकों ईमानदारी से अलग करने या मार्कर 26-28 एक आनुवंशिक वंश की अभिव्यक्ति के आधार पर बिना epicardial कोशिकाओं लेबल। पूर्व vivo प्रवास के अध्ययन के लिए, भ्रूण दिल epicardial EMT से पहले और एक हरी फ्लोरोसेंट प्रोटीन (GFP) -expressing एडीनोवायरस (विज्ञापन / GFP) 9,18 के साथ पूरक माध्यम में सुसंस्कृत अलग कर रहे हैं। इस दृष्टिकोण के बजाय Cre की मध्यस्थता पुनर्संयोजन द्वारा कोशिकाओं के एक सबसेट पूरे epicardium के कुशल लेबलिंग के लिए अनुमति देता है। दिल संस्कृतियों बाद में EMT के नाम से जाना जाता inducers को उजागर कर रहे EPDC 28,29 की लामबंदी को प्रोत्साहित करने के लिए। पूर्व vivo और इन विवो विश्लेषण में इन विट्रो epicardial explant संस्कृतियों, जो EPDC प्रवास ड्राइविंग विस्तृत तंत्र की खोज के लिए एक विशेष रूप से उपयोगी तरीका है द्वारा पूरित कर रहे हैं।

यहाँ, हम epicardi की इन विट्रो अध्ययन के लिए प्राथमिक epicardial कोशिकाओं को अलग करने के लिए विधियों का वर्णनअल EMT, साथ ही पूर्व vivo के लिए एक अंग संस्कृति प्रणाली EPDC गतिशीलता का विश्लेषण करती है। हमने हाल ही में आनुवंशिक रूप से myocardin से संबंधित प्रतिलेखन कारक (MRTF) / सीरम प्रतिक्रिया कारक (एसआरएफ) अक्ष संकेत EPDC 9 के actin आधारित प्रवास हेरफेर करने के लिए नियमन द्वारा उपयोगिता और इस विधि की मजबूती का प्रदर्शन किया है। जबकि हमारे निष्कर्ष एक संकेतन मार्ग EPDC प्रवास को विनियमित करने के लिए आवश्यक प्रकाश डाला, इन तरीकों तंत्र है कि सामूहिक रूप से EPDC प्रवास और भेदभाव आर्केस्ट्रा unraveling के लिए उपयुक्त हैं। इसके अलावा, explant और पूर्व vivo संस्कृति प्रणालियों हृदय उत्थान में चिकित्सीय अनुप्रयोगों के लिए EPDC लामबंदी के उपन्यास नियामकों की पहचान करने के लिए कार्यात्मक स्क्रीन में लागू किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

नोट: चूहों के साथ सभी प्रयोगों के रोचेस्टर विश्वविद्यालय में विश्वविद्यालय समिति पशु संसाधन पर द्वारा अनुमोदित किया गया।

1. एपिकार्डियल परिणाम संस्कृति परख (चित्रा 1 ए)

  1. तैयारी
    1. 5% भ्रूण गोजातीय सीरम (FBS) और 1% पेनिसिलिन / स्ट्रेप्टोमाइसिन (पेन / Strep) के साथ मध्यम 199 (M199) सप्लीमेंट द्वारा प्राथमिक epicardial सेल अलगाव के लिए 5 मिलीलीटर मध्यम एक तैयार करें।
    2. पूर्व गर्म मध्यम ए और 100 मिलीलीटर हैंक्स बैलेंस्ड नमक एक 37 डिग्री सेल्सियस पानी के स्नान में समाधान (HBSS)।
    3. कोलेजन लेपित कक्ष स्लाइड 30 मिनट के लिए कमरे के तापमान को गर्म करने के लिए अनुमति दें।
    4. चैम्बर स्लाइड के प्रत्येक अच्छी तरह से 100 μl मध्यम एक जोड़ें और धीरे समान रूप से कोट कोलेजन की सतह के लिए बारी बारी से। 8-12 कुओं के लिए दोहराएँ। कोटिंग कक्षों के बाद मीडिया निकालें।
    5. अशेष 50 मिलीलीटर HBSS के प्रत्येक युक्त दो 10 सेमी 2 प्लेटों में पूर्व गरम HBSS।
  2. 11.5 दिनों के बाद Coitum (डीपीसी) में गर्भवती बांध से भ्रूण दिल अलग।30
    1. intraperitoneal इंजेक्शन के माध्यम से 13 मिलीग्राम / एमएल ketamine / 0.88 मिलीग्राम / 1x Dulbecco फास्फेट buffered खारा (DPBS) में मिलीलीटर xylazine कॉकटेल के 0.5 मिलीलीटर के साथ माउस anesthetize। एक पैर की अंगुली चुटकी परीक्षण का उपयोग कर उचित anesthetization की पुष्टि करें। एक सज्जन चुटकी अगर माउस से संवेदनशील है यह निर्धारित करने के लिए पर्याप्त है। किसी भी आंदोलन या पंजा वापस लेने को इंगित करता है पशु पर्याप्त सर्जरी करने के लिए anesthetized नहीं है। ग्रीवा अव्यवस्था से euthanize।
    2. माउस निर्धारित करना उदर पक्ष का सामना करना पड़ और पेट स्प्रे 70% इथेनॉल के साथ बालों से प्रदूषण को कम करने के लिए।
    3. संदंश के साथ त्वचा चुटकी और शल्य कैंची के साथ पेट में एक पार्श्व चीरा काट दिया। त्वचा मजबूती से पकड़ और फिर सिर और पूंछ की ओर दिशाओं विरोध में अलग खींच।
    4. संदंश के साथ पेरिटोनियम चुटकी और कैंची से काट उदर गुहा का पर्दाफाश करने के लिए।
    5. ध्यान से mesometrium के साथ काटने से पत्या को हटा दें। विच्छेदित पत्या स्थानांतरण करने के लिए पहली बार में HBSS पूर्व गरम10 सेमी 2 थाली।
    6. भ्रूण के बीच काटने से पत्या अलग करें।
    7. एक विदारक माइक्रोस्कोप के तहत पूर्व गर्म HBSS के साथ दूसरे नंबर पर 10 सेमी 2 थाली करने के लिए एक भ्रूण स्थानांतरण। ध्यान से extraembryonic ऊतक और जर्दी थैली को हटा दें, तो भ्रूण सिर काटना।
    8. संदंश के साथ वक्ष दीवार चुटकी और midline पर अलग ऊतक आंसू, छाती गुहा को उजागर।
    9. दिल के पीछे संदंश रखें। बहिर्वाह पथ समझ और दिल भ्रूण से दूर खींच। दिल से फेफड़े के पथ और फेफड़ों को अलग करें, अगर अभी भी जुड़ी।
  3. कोलेजन लेपित स्लाइड का एक भी अच्छी तरह से करने के लिए दिल के स्थानांतरण और नीचे जगह यह पृष्ठीय पक्ष (चित्रा 1 बी)। दोहराएँ कदम 1.2.7-1.3 प्रत्येक भ्रूण के लिए।
  4. एक बार सभी दिलों व्यक्तिगत कुओं के लिए स्थानांतरित कर दिया गया है, 37 डिग्री सेल्सियस पर 30 मिनट के लिए चैम्बर स्लाइड सेते हैं, 5% सीओ 2 कोलेजन मैट्रिक्स के लिए पर्याप्त पालन की अनुमति है।
  5. ध्यान से जोड़नेहर दिल के आसपास पूर्व गर्म explant मध्यम एक के 20-50 μl। महत्वपूर्ण: भी जल्दी या दिल के ऊपर एक स्तर को मध्यम जोड़ नहीं है, अन्यथा दिलों कोलेजन सब्सट्रेट से अलग हो सकती है।
  6. संस्कृति लगभग 24 घंटे के लिए 37 डिग्री सेल्सियस, 5% सीओ 2 पर दिल epicardial परिणाम की अनुमति है। नोट: outgrowths संस्कृति के मानव संसाधन (चित्रा 1 सी) के रूप में जल्दी 3-4 के रूप में मनाया जा सकता है और मुख्य रूप से cobblestoned आकृति विज्ञान, कम से कम mesenchymal सेल संदूषण (आंकड़े -1 डी, ई) के साथ प्रदर्शित mesothelial कोशिकाओं के होते हैं। प्रतिनिधि परिणाम एक विच्छेदन एक कैमरा से लैस माइक्रोस्कोप का उपयोग कर हासिल किया गया।

2. जेनेटिक पृथक और EMT की प्रेरण एपिकार्डियल outgrowths में

सावधानी: अनुमोदित जैव सुरक्षा के दिशा-निर्देशों के अनुसार देखभाल के साथ adenoviruses संभाल लेना।

  1. 15 मिलीलीटर की तैयारी मध्यम बी और 37 डिग्री सेल्सियस के लिए पूर्व गर्म पानी के स्नान में (M199 1% FBS और 1% पेन / Strep के साथ पूरक)।
  2. के छांटना के लिएfloxed alleles, explant मध्यम बी (विज्ञापन / सीआरई) Cre recombinase व्यक्त 2.5 x 10 4 pfu / adenovirus के मिलीलीटर या नियंत्रण वायरस के साथ पूरक तैयार करते हैं।
    नोट: उम्मीदवार जीन की adenoviral मध्यस्थता overexpression भी समारोह phenotypes के लाभ का मूल्यांकन करने के लिए किया जा सकता है। वायरल titers अंत उपयोगकर्ता द्वारा निर्धारित किया जाना चाहिए।
  3. ध्यान से संदंश का उपयोग कर परिणाम संस्कृतियों से epicardium समाप्त दिलों को हटा दें। बाद में शाही सेना के अलगाव और जीन अभिव्यक्ति के विश्लेषण के लिए -80 डिग्री सेल्सियस पर 800 μl Trizol के साथ 1.5 मिलीलीटर ट्यूब और स्टोर करने के लिए स्थानांतरण दिल।
  4. DPBS के साथ अच्छी तरह से प्रत्येक धोने रक्त कोशिकाओं और अतिरिक्त सेलुलर मलबे को हटाने के लिए।
  5. प्रत्येक परिणाम संस्कृति के लिए 500 μl explant मध्यम बी एडीनोवायरस (ते) के साथ पूरक जोड़ें और 37 डिग्री सेल्सियस, 5% सीओ 2 पर 24 घंटे के लिए सेते हैं।
  6. EMT शामिल करने के लिए, मीडिया को हटाने और 37 डिग्री सेल्सियस explant मध्यम पुनः संयोजक बदलने वृद्धि कारक (TGF) के साथ पूरक बी -β1 [10 एनजी / एमएल] या वाहन (4 मिमी एच साथ फिर से भरनाydrochloric एसिड (एचसीएल) युक्त 1 मिलीग्राम / एमएल गोजातीय सीरम albumin (बीएसए))। 37 डिग्री सेल्सियस पर एक अतिरिक्त 24 घंटे के लिए संस्कृति explants, 5% सीओ 2। जीन / प्रोटीन अभिव्यक्ति का विश्लेषण करती है या immunocytochemistry बाद प्रोटोकॉल में विस्तृत रूप के साथ आगे बढ़ें।
    नोट: epicardial EMT की प्रेरण 0.5 एनजी / एमएल से लेकर TGF-β1 के विभिन्न सांद्रता के साथ प्रेरित किया गया है - 10 एनजी / एमएल 26,31-33। ligand के उच्च सांद्रता गैर विशिष्ट सब TGF-β रिसेप्टर्स के लिए बाध्य हो सकता है। TGF-β1 की एकाग्रता विशिष्ट प्रयोगात्मक लक्ष्यों को प्रतिबिंबित करना चाहिए।

एपिकार्डियल outgrowths 3. जीन एक्सप्रेशन विश्लेषण

  1. पिघलना epicardium समाप्त दिलों पहले Trizol (2.2) में संग्रहीत।
  2. EPDC संस्कृतियों से महाप्राण मीडिया और DPBS के साथ दो बार धोने।
  3. 800 μl कमरे के तापमान संस्कृतियों explant को Trizol जोड़ें।
  4. कमरे temperatu पर 5 मिनट के लिए epicardium समाप्त दिल और Trizol में EPDC संस्कृतियों सेते फिर से। ऊपर पिपेट और दस बार नीचे lysed नमूना homogenize करने के लिए।
    नोट: दिल पूरी तरह से homogenize करने के लिए आगे pipetting आवश्यकता हो सकती है।
  5. 1.5 मिलीलीटर ट्यूबों के लिए lysates स्थानांतरण और निर्माता के निर्देशों के अनुसार कुल शाही सेना अलगाव के साथ आगे बढ़ें। शाही सेना उपज बढ़ाने के लिए वर्षा से पहले 10 माइक्रोग्राम ग्लाइकोजन जोड़ें। एक दिया explant लगभग 0.5-1.0 माइक्रोग्राम आरएनए निकलेगा।
  6. DNase मैं के साथ दूषित डीएनए निकालें और टाइप निर्माता के निर्देशों के अनुसार 0.5 माइक्रोग्राम mRNA रिवर्स।
  7. Epicardial explants और / या मात्रात्मक रिवर्स प्रतिलेखन के साथ EMT की प्रेरण की शुद्धता (क्यूआरटी) -PCR 34 मान्य SYBR हरे और मार्कर glyceraldehyde 3-फॉस्फेट डिहाइड्रोजनेज (GAPDH) के लिए तालिका में वर्णित 1। मानक के अनुसार mRNA स्तर का उपयोग कर और का उपयोग कर रिश्तेदार अभिव्यक्ति की गणना 2 - ΔΔCt विधि 35। ठेठ परिणाम चित्रा 2A में दिखाया जाता है।
शीर्षक "> 4। एपिकार्डियल outgrowths की प्रोटीन विश्लेषण

  1. EPDC संस्कृतियों से महाप्राण मीडिया और DPBS के साथ दो बार धोने।
  2. 10 μl ठंडा प्रोटीन lysis बफर (50 मिमी Tris पीएच 7.5, 150 मिमी सोडियम क्लोराइड, 1 मिमी ethylenediaminetetraacetic एसिड पीएच 8.0, 1% ट्राइटन X-100, 1x protease अवरोध कॉकटेल) प्रत्येक कक्ष के लिए अच्छी तरह से जोड़ें और पर चैम्बर स्लाइड जगह बर्फ। एक P200 विंदुक टिप पर लगभग नीचे की ¼ कट और स्लाइड के बंद कोशिकाओं परिमार्जन करने के लिए शेष टुकड़े का उपयोग करें। पिपेट और lyse epicardial कोशिकाओं और एक 1.5 मिलीलीटर ट्यूब को हस्तांतरण करने के लिए नीचे।
  3. 30 सेकंड पर और बंद के चक्र के साथ एक बर्फ नहाने के पानी में 5 मिनट के लिए कम (160 डब्ल्यू) पर lysed explants Sonicate।
  4. 10,000 XG, 4 डिग्री सेल्सियस पर 10 मिनट के लिए अपकेंद्रित्र lysates। एक ताजा ट्यूब स्थानांतरण सतह पर तैरनेवाला और एक प्रोटीन परख 36 का उपयोग प्रोटीन एकाग्रता का निर्धारण।
    नोट: एक दिया explant अप करने के लिए 1.5 माइक्रोग्राम कुल प्रोटीन निकलेगा। हमने पाया है कि दो दिलों से पूलिंग explants एकडी लोड हो रहा है अच्छी तरह से प्रति 2 माइक्रोग्राम प्रोटीन चिकनी पेशी α-actin (ACTA2) और GAPDH 9 पता लगाने के लिए पर्याप्त है। अन्य लक्ष्य प्रोटीन का पता लगाने के लिए कई explant नमूने पूलिंग के रूप में अंत उपयोगकर्ता द्वारा निर्धारित आवश्यकता हो सकती है।

5. एपिकार्डियल outgrowths की Immunocytochemistry

  1. explant संस्कृतियों से मीडिया निकालें और DPBS के साथ दो बार धोने।
  2. धीरे 4% (वी / वी) paraformaldehyde या ठंडा मेथनॉल के 500 μl प्रत्येक के लिए अच्छी तरह से explants कमरे के तापमान पर 5 मिनट या 10 मिनट के लिए -20 में सी, क्रमशः जोड़ने के लिए और तय कर लो। के रूप में निर्माता से सिफारिश की एंटीबॉडी विनिर्देशों के अनुसार ठीक करें।
  3. 5 मिनट के लिए लगानेवाला निकालें और तीन बार DPBS के साथ अच्छी तरह से प्रत्येक कुल्ला।
  4. 500 5 मिनट के लिए DPBS में (वी / वी) ट्राइटन X-100 0.1% की μl के साथ कोशिकाओं permeabilize।
  5. 5 मिनट के लिए permeabilization समाधान निकालें और तीन बार DPBS के साथ कुल्ला।
  6. कमरे temperatu पर 30 मिनट के लिए DPBS में 10% सीरम के साथ कोशिकाओं को ब्लॉकफिर से।
  7. निर्माता की सिफारिशों और इष्टतम स्थितियों के रूप में अंत उपयोगकर्ता द्वारा निर्धारित प्रति प्राथमिक एंटीबॉडी धुंधला के साथ आगे बढ़ें।
  8. 5 मिनट के लिए एंटीबॉडी समाधान निकालें और तीन बार DPBS के साथ कुल्ला।
  9. एक उपयुक्त परमाणु डाई के साथ निर्माता के निर्देशों और counterstain प्रति माध्यमिक एंटीबॉडी लागू करें।
  10. 5 मिनट के लिए एंटीबॉडी समाधान निकालें और तीन बार DPBS के साथ कुल्ला।
  11. निर्माता के निर्देशों के अनुसार चैम्बर स्लाइड दीवारों निकालें और कोशिकाओं को सीधे जलीय बढ़ते मध्यम जोड़ें। कोशिकाओं पर एक coverslip जगह और नेल पॉलिश के साथ सील। उल्टे confocal माइक्रोस्कोपी स्कैनिंग का उपयोग कर 2 डी - ठेठ परिणामों में चित्रा 2 बी दिखाए जाते हैं।

6. पूर्व vivo संस्कृति परख (चित्रा 3 ए)

  1. तैयारी
    1. तैयार 12 मिलीलीटर पूर्व vivo एक का उपयोग कर संस्कृति के माध्यम से (1: 1) Dulbecco संशोधित ईगल मध्यम (DMEM) का मिश्रण: M199 10% के साथ पूरकFBS और 1% पेन / Strep।
    2. एक 37 डिग्री सेल्सियस पानी के स्नान में, पूर्व गर्म पूर्व vivo संस्कृति के माध्यम से और 100 मिलीलीटर HBSS।
    3. अशेष 1 मिलीलीटर एक 24 अच्छी तरह से थाली की 8-12 कुओं में पूर्व गर्म माध्यम।
    4. स्थानांतरण दो 10 सेमी 2 प्लेटों के लिए पूर्व गरम HBSS, 50 मिलीलीटर प्रत्येक युक्त।
  2. 12.5 डीपीसी पर (1.2 में वर्णित) गर्भवती बांधों से HBSS में माउस भ्रूण दिलों अलग।
  3. 24 अच्छी तरह से थाली पूर्व vivo संस्कृति के माध्यम से युक्त का एक भी अच्छी तरह से करने के लिए हर दिल स्थानांतरण। 37 डिग्री सेल्सियस, कोमल मैन्युअल घोड़ा या एक कमाल मंच का उपयोग कर पालन को रोकने के साथ 5% सीओ 2 पर थाली सेते हैं। इसके तत्काल कदम करने के लिए 7.1 आगे बढ़ें।

7. एपिकार्डियल लेबलिंग और पूर्व vivo संस्कृतियों में EMT प्रेरण

  1. Epicardium लेबल करने के लिए, 37 डिग्री सेल्सियस पूर्व vivo संस्कृति के माध्यम से विज्ञापन / GFP के 3.0 x 10 6 pfu / एमएल के साथ पूरक की 12 मिलीलीटर की तैयारी। floxed alleles के लक्षित पृथक, ए के हस्तांतरण के 6 मिलीलीटर के लिएडी / GFP एक नया 15 मिलीलीटर शंक्वाकार ट्यूब संस्कृति के माध्यम से पूरक। विज्ञापन / Cre जोड़ें या 1.5 x 10 6 pfu / मिलीलीटर की एक अंतिम एकाग्रता के लिए एडीनोवायरस नियंत्रित करते हैं।
    नोट: समारोह का लाभ विश्लेषण भी उचित adenoviral मध्यस्थता जीन वितरण के साथ किया जा सकता है।
  2. ध्यान से 24 अच्छी तरह से थाली एक P1,000 पिपेट टिप का उपयोग कर के प्रत्येक अच्छी तरह से संस्कृति के माध्यम से हटा दें।
  3. धीरे अच्छी तरह से प्रत्येक के लिए एडीनोवायरस (ते) के साथ पूरक संस्कृति के माध्यम जोड़ें।
  4. कोमल कमाल के साथ 24 घंटे के लिए 37 डिग्री सेल्सियस, 5% सीओ 2 पर थाली सेते हैं।
  5. EMT शामिल करने के लिए, का 37 डिग्री सेल्सियस पूर्व vivo संस्कृति 10 एनजी / एमएल TGF-β1 और 20 एनजी / एमएल प्लेटलेट व्युत्पन्न वृद्धि कारक (PDGF) -BB या वाहन युक्त मध्यम (4 मिमी एचसीएल युक्त 1 मिलीग्राम / एमएल बीएसए 12 मिलीलीटर की तैयारी )।
  6. ध्यान से 24 अच्छी तरह से थाली एक P1,000 पिपेट टिप का उपयोग कर के प्रत्येक अच्छी तरह से संस्कृति के माध्यम से हटा दें। धीरे 1 मिलीलीटर DPBS के साथ दिलों कुल्ला।
  7. DPBS निकालें और पूर्व vivo संस्कृति के साथ दिल की भरपाई के लिए मुझेdium TGF-β1 और PDGF-बी बी या वाहन से युक्त।
  8. 37 डिग्री सेल्सियस पर 24 घंटा, 5% सीओ 2 कोमल कमाल के साथ के लिए सेते हैं।

8. Cryopreservation और पूर्व vivo संस्कृतियों का Immunohistochemistry

  1. Cryopreservation के लिए दिल से तैयार करें।
    1. संस्कृति के माध्यम से निकालें और ठंडा DPBS के साथ दो बार दिल धो लें।
    2. हर दिल को 4% (वी / वी) paraformaldehyde के 1 मिलीलीटर जोड़ें और कोमल कमाल के साथ 4 डिग्री सेल्सियस पर 2 घंटे के लिए तय कर लो।
    3. लगानेवाला निकालें और DPBS के साथ दो बार दिल धो लें। 1 मिलीलीटर 10% (w / v) DPBS में तैयार सुक्रोज के साथ नए सिरे कुओं के दिलों स्थानांतरण। कोमल कमाल के साथ 4 डिग्री सेल्सियस पर रात भर थाली सेते हैं।
    4. ध्यान से 18% (w / v) DPBS में तैयार सुक्रोज के साथ नए कुओं के लिए दिल हस्तांतरण। कोमल कमाल के साथ 4 डिग्री सेल्सियस पर रात भर थाली सेते हैं।
    5. एक cryomold ऊतक ठंड माध्यम से युक्त करने के लिए प्रत्येक दिल स्थानांतरण। इसके तत्काल बाद -80 & # पर तरल नाइट्रोजन और दुकान का उपयोग ब्लॉकों फ्रीज176, सी।
  2. सकारात्मक आरोप लगाया खुर्दबीन स्लाइड पर एक cryostat और जगह ऊतक वर्गों का उपयोग कर 5 माइक्रोन पर धारा दिलों। स्टोर -80 डिग्री सेल्सियस तक धुंधला पर स्लाइड।
  3. उप epicardial तहखाने झिल्ली का पता लगाने के लिए वर्गों पर immunohistochemistry प्रदर्शन।
    1. कमरे के तापमान पर कम से कम 30 मिनट के लिए स्लाइड गला लें।
    2. कोमल कमाल के साथ 5 मिनट के लिए DPBS में दो बार धोने से वर्गों rehydrate।
    3. कमरे के तापमान पर 5 मिनट के लिए 0.1% (वी / वी) ट्राइटन पीबीएस में X-100 के साथ Permeabilize अनुभाग।
    4. कोमल कमाल के साथ 5 मिनट के लिए दो बार DPBS में स्लाइड्स धो लें।
    5. अतिरिक्त DPBS बंद ब्लाट और एक हाइड्रोफोबिक लेबलिंग कलम के साथ धुंधला क्षेत्र को परिभाषित। कमरे के तापमान पर 30 मिनट के लिए DPBS में 10% सीरम के साथ ब्लॉक वर्गों।
    6. ब्लॉक निकालें और कोलेजन प्रकार चतुर्थ एंटीबॉडी (ColIV, 1: 200) लागू ब्लॉक में पतला। एक आर्द्रता नियंत्रित कक्ष में 4 डिग्री सेल्सियस पर रातोंरात सेते हैं।
    7. स्लाइड्स के लिए DPBS में तीन बार धोएंकोमल कमाल के साथ 5 मिनट।
    8. DPBS में और स्लाइड करने के लिए लागू होते हैं: और DAPI (5000 1): fluorescently संयुग्मित माध्यमिक एंटीबॉडी (500 1) पतला। कमरे के तापमान पर 1 घंटे के लिए सेते हैं। एक उत्सर्जन और उत्तेजना तरंगदैर्ध्य GFP से अलग के साथ एक उपयुक्त माध्यमिक एंटीबॉडी चुनें।
    9. स्लाइड कोमल कमाल के साथ 5 मिनट के लिए पीबीएस में तीन बार धोएं। माउंट बढ़ते मध्यम के साथ स्लाइड।

9. इमेजिंग और पूर्व vivo संस्कृतियों की मात्रा

  1. एक अंधे उपयोगकर्ता छवि है और दाग वर्गों यों। छवि कम से कम पांच गैर लगातार ऊतक epicardium (दिल की धार) 40x बढ़ाई पर एक फ्लोरोसेंट या confocal खुर्दबीन का उपयोग के साथ 4-5 मनमाने ढंग से स्थानों में एक भी दिल से वर्गों। ठेठ परिणाम उल्टे confocal स्कैनिंग माइक्रोस्कोपी का उपयोग चित्रा 3 बी में दिखाया जाता है।
  2. मैन्युअल एक दिया छवि में GFP सकारात्मक कोशिकाओं की कुल संख्या गिनती। GFP पो के रूप में EPDC पलायन को पहचानेंsitive के भीतर या ColIV subepicardial तहखाने झिल्ली से परे स्थित कोशिकाओं। GFP GFP एक दिया छवि में GFP सकारात्मक कोशिकाओं की कुल संख्या से अधिक सकारात्मक कोशिकाओं पलायन की संख्या के रूप में कोशिकाओं पलायन का प्रतिशत निर्धारित करते हैं। ठेठ परिणाम उल्टे confocal स्कैनिंग माइक्रोस्कोपी का उपयोग चित्रा -3 सी-डी में दिखाया जाता है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

epicardium कुशलता से इसकी बाहरी स्थान का लाभ ले रही है और विकास plasticity और EPDC के आंतरिक प्रवासी व्यवहार शोषण से एक परिणाम संस्कृति परख का उपयोग कर अलग किया जा सकता है। Murine भ्रूण दिल epicardial EMT और कोलेजन लेपित कक्ष स्लाइड पर नीचे सुसंस्कृत पृष्ठीय पक्ष से पहले E11.5 में अलग कर रहे हैं 26 (चित्रा 1 ए, बी)। Explanted दिल अनुबंध करने के लिए जारी रहेगा; हालांकि, epicardium कोलेजन मैट्रिक्स का पालन करना और संस्कृति के 24 घंटा (चित्रा 1 सी) के भीतर मायोकार्डियम से बंद पलायन होगा। Epicardial कोशिकाओं पत्थर की तरह आकृति विज्ञान, mesothelial पहचान (आंकड़े 1 सी-ई) का संकेत के साथ दिल से दूर चलाई मनाया जा सकता है। संस्कृति के 24 घंटे के बाद, epicardium समाप्त दिलों जीन या प्रोटीन अभिव्यक्ति विश्लेषण के लिए निकाल रहे हैं।

epitheli के अवलोकन के अलावाअल आकृति विज्ञान, epicardial सेल संस्कृतियों की पवित्रता आगे epicardial प्रतिबंधित जीन और प्रोटीन मार्कर की अभिव्यक्ति द्वारा मान्य किया जा सकता। Epicardial सेल explants epicardial और mesothelial मार्कर (Aldh1a2, Tcf21, और WT1) और cardiomyocyte जीन (Nkx2-5 और Myh7) epicardium समाप्त दिल (2A चित्रा) की तुलना में कम अभिव्यक्ति की मजबूत अभिव्यक्ति प्रदर्शित करते हैं। आगे पहचान सत्यापित करने के लिए, epicardial सेल संस्कृतियों के बाद 48 घंटा तय कर रहे हैं दिल को हटाने और Wilm के ट्यूमर 1 (WT1) और Zona occludens प्रोटीन 1 (ZO1) के खिलाफ एंटीबॉडी mesothelial कोशिकाओं और कहनेवाला तंग जंक्शनों में क्रमश: 37,38 लेबल करने के लिए (के साथ सह दाग चित्रा 2 बी)। इस परिणाम संस्कृति विधि mesothelial कोशिकाओं की एक अपेक्षाकृत उच्च शुद्धता पैदावार; हालांकि, उपयोगकर्ताओं को सेल संदूषण का एक छोटा सा प्रतिशत निरीक्षण कर सकते हैं। Fibroblasts और चिकनी मांसपेशियों की कोशिकाओं Nucle की एक उल्लेखनीय अभाव के साथ एक लम्बी mesenchymal phenotype का प्रदर्शनएआर WT1 और संगठित तंग जंक्शनों (चित्रा -2)। तकनीक समस्या निवारण को सीमित करने का गैर epicardial सेल संदूषण की राशि चर्चा में विस्तार कर रहे हैं।

Explant परिणाम परख इन विट्रो में epicardial जीव विज्ञान पूछताछ के लिए एक उपयोगी संस्कृति प्रणाली है। Epicardial सेल प्लास्टिसिटी प्रदर्शित करने के लिए, explants mesenchymal कोशिकाओं 26,28 में transdifferentiation प्रेरित करने के लिए TGF-β1 साथ [10 एनजी / एमएल] प्रेरित किया गया। उत्तेजना के 24 घंटे के बाद, EPDC कम ZO1 धुंधला और चिकनी पेशी α-actin सकारात्मक तनाव फाइबर (ACTA2 या SMA) के मजबूत नए सिरे से गठन के साथ एक mesenchymal phenotype अपनाने, विशेष रूप से संस्कृति 39 (चित्रा 2 डी, लाल) की परिधि में। इसके विपरीत explants की परिधि में फाइबर विधानसभा तनाव के लिए, एक monolaye के केंद्र में अधिक परिभाषित कहनेवाला संपर्क (ZO1, हरा) के साथ मिला हुआ epicardial कोशिकाओंआर प्रदर्शन cortical actin में ACTA2 प्रोटीन अभिव्यक्ति।

EMT के दौर से गुजर के अलावा, EPDC मायोकार्डियम आक्रमण और अलग होगा, गैर cardiomyocyte आबादी का एक बड़ा अनुपात का गठन। EPDC की गतिशीलता एक पहले से स्थापित पूर्व vivo अंग संस्कृति प्रणाली है जिससे E12.5 दिल के बाहरी एक adenovirus GFP 9,18 (चित्रा 3 ए) को व्यक्त करने के साथ चिह्नित कर रहे हैं का उपयोग कर मूल्यांकन किया जा सकता है। लेबल दिलों TGF-β1 [10 एनजी / एमएल] और PDGF-बी बी [20 एनजी / एमएल] EPDC पलायन को बढ़ावा देने की उपस्थिति में तीन दिनों के लिए आगे सुसंस्कृत हैं। अंग संस्कृतियों समय समय पर संस्कृति प्लेटों की सतह के लिए पूर्व vivo दिल के आसंजन को रोकने के लिए घुमाया जाता है। इस प्रणाली के रूप में इन विट्रो खरोंच assays के साथ दिशात्मक प्रवास का विरोध करने के लिए एक तीन आयामी मॉडल में पूरे epicardium और EPDC गतिशीलता के आकलन के कुशल लेबलिंग के लिए अनुमति देता है। EPDC के प्रवास के obser हैवेद GFP के आक्रमण सकारात्मक epicardial कोशिकाओं में या ColIV (लाल) subepicardial तहखाने झिल्ली 16 (आंकड़े 3 बी, सी) से परे है। इस प्रणाली की उपयोगिता को वर्णन, हमने हाल ही में MRTF / एसआरएफ संकेत अक्ष की है कि हेरफेर EPDC 9 की गतिशीलता को प्रभावित कर सकते हैं दिखाया है। Floxed alleles की Cre की मध्यस्थता छांटना (MRTFdKO) द्वारा Mrtfa और Mrtfb का विलोपन subepicardial अंतरिक्ष में EPDC के प्रवास के attenuates। इसके विपरीत, बढ़ EPDC प्रवास और ColIV तहखाने झिल्ली (आंकड़े -3 सी, डी) के विघटन में C57BL / 6 दिलों परिणामों में MRTF-ए (विज्ञापन / MRTF-ए) की अभिव्यक्ति के लिए मजबूर किया।

जीन आगे रिवर्स एन सी बी आई परिग्रहण
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

तालिका 1: आगे के दृश्यों और रिवर्स प्राइमरों epicardium का विश्लेषण और मायोकार्डियम प्रतिबंधित जीन एक्सप्रेशन जीन अभिव्यक्ति QRT- पीसीआर वाई द्वारा निर्धारित किया जाता द्वारा एपिकार्डियल परिणाम संस्कृति पवित्रता के सत्यापन के लिए इस्तेमाल किया।वें निम्नलिखित मानकों: 10 सेकंड के लिए 95 डिग्री सेल्सियस पर denature; 30 सेकंड के लिए 60 डिग्री सेल्सियस पर पानी रखना; 50x चक्र को दोहराएँ।

आकृति 1
चित्रा 1:। एक परिणाम संस्कृति परख (ए) epicardial मॉडुलन और विश्लेषण के लिए एक सिफारिश की समय के साथ epicardial परिणाम explant परख का एक योजनाबद्ध प्रतिनिधित्व का उपयोग प्राथमिक एपिकार्डियल कोशिकाओं के अलगाव। (बी - ई) explant परख के दौरान विभिन्न समय अंक के प्रतिनिधि brightfield छवियों। (बी) के भ्रूण दिन E11.5 murine दिल एक कोलेजन सब्सट्रेट पर पृष्ठीय पक्ष रखा जाता है नीचे। (सी) एपिकार्डियल कोशिकाओं (सफेद तीर) संस्कृति के 3-4 घंटा के भीतर दिल बंद विस्थापित करने के लिए शुरू हो जाएगा। रक्त कोशिकाओं (काला तीर) पास जमा या epicardial परिणाम दौरान explants कवर कर सकते हैं। (डी, ई) के बादसंस्कृति का लगभग 24 घंटा, दिल को हटा रहे हैं और epicardial monolayers चैम्बर स्लाइड का पालन रहते हैं। सेलुलर outgrowths कोशिकाओं का एक पत्थर की तरह व्यवस्था के साथ उपकला आकृति विज्ञान प्रदर्शित करते हैं। स्केल सलाखों = 250 माइक्रोन (बी) या 50 माइक्रोन (सी, ई)। एच = दिल, ला = बाएं आलिंद, एल.वी. = बाएं वेंट्रिकल, ओ एफ टी = बहिर्वाह पथ, आरए = सही आलिंद, आर.वी. = सही वेंट्रिकल। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2: एपिकार्डियल सेल परिणाम पवित्रता का मूल्यांकन (ए) मायोकार्डियल जीन अभिव्यक्ति (Nkx2-5 और Myh7) epicardium समाप्त E11 की तुलना में epicardial प्रतिबंधित मार्कर (Tcf21, Aldh1a2, और WT1) परिणाम संस्कृतियों में से QRT- पीसीआर सत्यापन।। 5 दिलों। डेटा प्रतिनिधिमतलब ± SEM के (एन = 8 समूह प्रति) टी। तारों **** पी <0.0001 के साथ एक छात्र टी परीक्षण का उपयोग सांख्यिकीय महत्व को निरूपित। (बी) के प्रतिनिधि सह immunofluorescent unstimulated outgrowths epicardial अभिव्यक्ति के लिए (WT1, लाल), कहनेवाला तंग जंक्शनों (ZO1, हरा), और नाभिक का धुंधला (DAPI, नीला)। (सी) एक परिणाम संस्कृति में सेल संदूषण का एक उदाहरण है। Epicardial कोशिकाओं (तारांकन) विशेषता mesothelial पहचान (परमाणु WT1, लाल) और संगठित उपकला तंग जंक्शनों (ZO1, हरा) के साथ पैनल के अधिकार के लिए मनाया जाता है। केंद्र (सफेद तीर) में आसन्न कोशिकाओं एक लम्बी mesenchymal आकृति विज्ञान, अंतर हस्तक्षेप विपरीत (डीआईसी) इमेजिंग द्वारा दिखाए गए न्यूनतम परमाणु WT1 प्रोटीन और असंगठित ZO1 धुंधला के साथ, दिखा रहे हैं। (डी) एपिकार्डियल सेल संस्कृतियों (1mg / एमएल बीएसए में 4 मिमी एचसीएल) वाहन के साथ प्रेरित कर रहे थे या TGF-β1 [10 एनजी / एमएल] epicardial प्रेरित करने के लिएEMT। TGF-β1 उत्तेजना explants की या किनारे या monolayer की परिधि में पलायन कोशिकाओं के तनाव फाइबर में केंद्र में मिला हुआ कोशिकाओं के cortical क्षेत्रों में ACTA2 (लाल) के मजबूत अभिव्यक्ति को बढ़ावा देता है। सेल adhesions ZO1 (हरा) से चिह्नित कर रहे हैं। स्केल सलाखों = 25 माइक्रोन (बी)। यहाँ यह आंकड़ा का एक बड़ा संस्करण देखने के लिए क्लिक करें।

चित्र तीन
चित्रा 3: EPDC गतिशीलता के पूर्व विवो आकलन (ए) के पूर्व vivo दिल संस्कृति परख का एक योजनाबद्ध समय।। (बी) के एक C57BL / 6 E12.5 दिल 24 घंटे के लिए विज्ञापन / GFP (हरा) के साथ ट्रांसड्यूस का एक प्रतिनिधि 5 माइक्रोन अनुभाग दिल के बाहरी लेबल करने के लिए। पूर्व vivo दिलों TGF- के साथ एक अतिरिक्त 48 घंटे के लिए बाद में सुसंस्कृत थे β1 [10 एनजी / एमएल]और PDGF-बी बी [20 एनजी / एमएल] EPDC प्रवास को प्रोत्साहित करने के लिए। धारा ColIV (लाल) के लिए सह दाग थे subepicardial तहखाने झिल्ली और नाभिक (DAPI, नीला)। पूर्व vivo दिल संस्कृति आकृति विज्ञान डीआईसी द्वारा दिखाया गया है लेबल करने के लिए। एल.वी. = बाएं वेंट्रिकल, आर.वी. = सही वेंट्रिकल, आरए = सही आलिंद। (सी, डी) MRTF / एसआरएफ नियामक अक्ष नियमन करने से पूर्व vivo प्रवास परख का एक उदाहरण आवेदन। यह आंकड़ा से [9] संशोधित किया गया है। E12.5 दिलों Mrtfa से अलग थे - / -;। Mrtfb FL / FL भ्रूण और विज्ञापन / GFP और एक नियंत्रण वायरस या एक adenovirus 24 घंटे के लिए Cre recombinase व्यक्त के साथ ट्रांसड्यूस पूर्व vivo संस्कृतियों तो TGF-β1 साथ प्रेरित किया गया [10 एनजी / एमएल] और PDGF-बी बी [20 एनजी / एमएल] एक अतिरिक्त 48 घंटे के लिए। EPDC गतिशीलता (सफेद तीर) GFP सकारात्मक कोशिकाओं (हरा) के पलायन में या ColIV (लाल) से परे के रूप में मनाया जाता है। में Cre की मध्यस्थता Mrtfb का विलोपन <उन्हें> Mrtfa - / - EPDC प्रवास दिलों पर नियंत्रण की तुलना की क्षीणन में पृष्ठभूमि (MRTFdKO) का परिणाम है। इसके विपरीत, E12.5 C57BL / 6 दिलों में MRTF-ए (विज्ञापन / MRTF-ए) की अभिव्यक्ति के लिए मजबूर EPDC प्रवास को बढ़ाता है। (डी)% GFP सकारात्मक सेल प्रवास की मात्रा। डेटा SEM (हर हालत के लिए एन = 4 दिल) ± मतलब के रूप में प्रस्तुत कर रहे हैं। डेटा तारों **** पी <0.0001 साथ Tukey के बाद अस्थायी परीक्षण द्वारा सांख्यिकीय महत्व को दर्शाने के साथ एक तरह से एनोवा का उपयोग कर विश्लेषण किया गया था। स्केल सलाखों = 200 माइक्रोन (बी) या 25 माइक्रोन (सी)। सभी छवियों औंधा confocal लेजर स्कैनिंग माइक्रोस्कोपी का उपयोग कर हासिल किया गया। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यहाँ हम विस्तृत तरीके रूपरेखा परिणाम द्वारा प्राथमिक epicardial सेल को अलग और पूर्व vivo दिल संस्कृतियों में EPDC प्रवास को ट्रैक करने के लिए। परिणाम संस्कृतियों के लिए, epicardium समाप्त दिल को दूर करने के लिए उचित समय प्रयोगों के बीच थोड़ा भिन्न होता है। एक रात ऊष्मायन के बाद explants की समय-समय पर निगरानी epicardial परिणाम की हद तक गेज करने और दिल को निकालने के लिए पहले fibroblasts दिखाई सिफारिश की है। शुद्धता सुनिश्चित करने के लिए, दिल गैर epicardial प्रजातियों के संचय को रोकने के लिए explanting के 24 घंटा के भीतर हटा दिया जाना चाहिए। दूर बहिर्वाह पथ और दोनों अटरिया एक कक्ष स्लाइड करने के लिए दिल के हस्तांतरण भी प्रकार की कोशिकाओं को दूषित 27,40 कम कर सकते हैं करने से पहले ट्रिमिंग। भ्रूण दिल समय की एक संकीर्ण खिड़की के दौरान एक माउस कूड़े से अलग और एक ही परिस्थितियों में सुसंस्कृत कर रहे हैं के बाद से, प्रकट करने के लिए outgrowths के लिए समय अपेक्षाकृत एक दिल से एक प्रयोग के भीतर एक और करने के लिए इसी तरह की है। इसलिए, सब के दिल ख चाहिएई हटा जब explants के बहुमत epicardial outgrowths दिखा रहे हैं। कुछ मामलों में, epicardial कोशिकाओं को एक दिल है कि दूसरों को, जो मामले में यह explant प्रयोग से बाहर रखा जाना चाहिए की तुलना में अधिक तेजी से करार है कुशलता से बाहर की ओर पलायन नहीं है।

रक्त कोशिकाओं का संचय अक्सर epicardial कोशिकाओं (तीर, चित्रा 1 सी) के एक फ्लैट monolayer छिपा कर सकते हैं, इस प्रकार यह मुश्किल outgrowths कल्पना करने के लिए कर रही है। अत्यधिक रक्त कोशिका योगदान से बचने के लिए, दिल भ्रूण से विच्छेदन पर कुछ मिनट के लिए HBSS में रह सकते हैं। यह पर्याप्त समय एक कक्ष स्लाइड के लिए स्थानांतरित किया जा रहा से पहले दिल कक्षों में अवशिष्ट रक्त पंप करने के लिए भ्रूण दिल के लिए अनुमति देता है। वैकल्पिक रूप से, पहली रात ऊष्मायन के बाद explant मध्यम एक साथ संस्कृतियों का सप्लीमेंट कुछ अतिरिक्त रक्त दूर फ्लश और outgrowths प्रकट करने में मदद मिलेगी; हालांकि, मीडिया के स्तर पर दिल से ऊपर उठ नहीं करना चाहिए के रूप में सतह तनाव पैदा कर सकता है दिलसब्सट्रेट से दूर खींचने के लिए। मजबूत epicardial outgrowths संस्कृति सब्सट्रेट के रूप में कोलेजन प्रकार मैं का उपयोग कर मनाया जाता है; हालांकि, अन्य substrates जीव और / या आवेदन 27,40-42 के आधार पर सूचना दी गई है। इस प्रोटोकॉल का उपयोग करना, प्राथमिक भ्रूण epicardial कोशिकाओं दिल को हटाने और दैनिक मध्यम पुनःपूर्ति निम्नलिखित 4 दिनों के लिए पनपे कर सकते हैं; हालांकि, प्रयोगात्मक संस्कृति की लंबी अवधि की आवश्यकता डिजाइन अंत उपयोगकर्ता द्वारा निर्धारित किया जाना चाहिए। epicardial EMT दृढ़ता से भ्रूण के विकास के दौरान सक्रिय होता है के बाद से, इस परिणाम संस्कृति तकनीक भ्रूण epicardial कोशिकाओं का संवर्धन करने के लिए सीमित है। अन्य समूहों वयस्क epicardial कोशिकाओं 43,44 को अलग करने के तरीकों का वर्णन किया है।

पूर्व vivo प्रवास assays, दिल निष्कर्षण और epicardial सेल लेबलिंग के लिए दो कारणों के लिए E12.5 पर सिफारिश कर रहे हैं। सबसे पहले, E12.5 के बाद अलग-थलग दिलों में बड़े होते हैं और इसलिए व्यवहार्यता का समर्थन करने के लिए और अधिक छिड़काव की आवश्यकता है। पोषक तत्वों की सरल प्रसाररों बड़ा दिल से अंग संस्कृतियों को बनाए रखने के लिए पर्याप्त नहीं है। दूसरा, epicardial EMT और EPDC प्रवास E12.5 आसपास पाए जाते हैं। इसलिए, epicardium एक adenovirus दिल निकालने के बाद तुरंत एक फ्लोरोसेंट प्रोटीन व्यक्त EPDC का पता लगाने को अधिकतम करने के साथ लेबल किया जाना चाहिए। वैकल्पिक रूप से, Carboxyfluorescein diacetate succinimidyl एस्टर (CFSE) पहले दिल के बाहरी लेबल और EPDC प्रवास 10,45 पता लगाने के लिए सूचित किया गया है।

परिणाम assays के विपरीत, पूर्व vivo संस्कृतियों दिल लगाव और epicardial सेल परिणाम से बचने के लिए समय समय पर हिलाकर रख दिया जाना चाहिए। संस्कृति का भी लगातार सबसे कम गति की स्थापना पर एक घुमाव के साथ सुसज्जित एक मशीन में उत्तेजित किया जा सकता है। उपयोगकर्ता अंग संस्कृति के कुछ ही दिनों के भीतर हृदय आकृति विज्ञान के क्षेत्र में परिवर्तन की सूचना देगा और दिल के अलगाव के 72 घंटा से परे विश्लेषण से बचना चाहिए। इस परख का उपयोग करना, EPDC आक्रमण संस्कृति की 48 से 72 घंटा के भीतर मनाया जाता है। जबकि Cre पर loxP प्रणालीकोरोनरी वाहिका, मायोकार्डियम interstitium, और interventricular पट 7,22, इस पूर्व vivo तकनीक उप epicardial अंतरिक्ष के कुछ सेल परतों के भीतर EPDC प्रवास करने के लिए सीमित है EPDC के स्थानीयकरण नक्शा करने के लिए विवो में इस्तेमाल किया गया है। इस प्रकार, इस विधि EPDC गतिशीलता और आक्रमण के नियामकों का निर्धारण करने के बजाय EPDC पलायन के अंतिम गंतव्य को परिभाषित करने के लिए अधिक उपयुक्त है।

Epicardial सेल isolations और पूर्व vivo प्रवास assays, लाभ या समारोह दृष्टिकोण के नुकसान के साथ संयोजन में, पहले से ही उम्मीदवार जीन है कि EPDC जीव विज्ञान 9,18,46 प्रभाव हो सकता मूल्यांकन के लिए उपयोगी सिद्ध कर दिया है। इन तरीकों में भी EPDC प्रवास के उपन्यास नियामकों की पहचान करने के लिए लाभ के समारोह या हानि के समारोह स्क्रीन के लिए एक मंच प्रदान करते हैं। यह रणनीति, प्रतिदीप्ति सक्रिय सेल छंटनी या एकल कक्ष शाही सेना अनुक्रमण के साथ संयोजन के रूप में, यह भी epicardial विविधता की जांच के लिए एक अवसर प्रदान कर सकता हैऔर अधिक विस्तार में EPDC भेदभाव। अंत में, इन प्रक्रियाओं के संशोधनों छोटे अणुओं है कि हृदय पुनर्योजी चिकित्सा के उद्देश्य के लिए epicardial सेल और EPDC जीव विज्ञान प्रभाव के लिए स्क्रीन विकसित करने के लिए इस्तेमाल किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ भी नहीं है।

Acknowledgements

ईएमएस स्वास्थ्य (एनआईएच) के राष्ट्रीय संस्थानों से अनुदान द्वारा समर्थित किया गया था [अनुदान संख्या R01HL120919]; अमेरिकन हार्ट एसोसिएशन [अनुदान संख्या 10SDG4350046]; एनआईएच [अनुदान संख्या UL1 TR000042] से रोचेस्टर सीटीएसए पुरस्कार के विश्वविद्यालय, और Aab CVRI से स्टार्टअप धन। मेट हॉवर्ड ह्यूजेस मेडिकल इंस्टीट्यूट मेड-में-ग्रैड पहल से चिकित्सा और दंत चिकित्सा के रोचेस्टर विश्वविद्यालय के स्कूल ऑफ करने के लिए एक अनुदान द्वारा समर्थित किया गया था; और एनआईएच [अनुदान संख्या GM068411] से एक संस्थागत रुथ एल Kirschstein राष्ट्रीय अनुसंधान सेवा पुरस्कार।

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics