Эпикардиального вырост Культура Анализ и

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Один слой эпикарда клеточных линий сердца, обеспечивая паракринной факторов, которые стимулируют пролиферацию кардиомиоцитов и непосредственно способствует сердечно-сосудистых клеток-предшественников во время развития и болезней. В то время как ряд факторов, которые были вовлечены в клетки (EPDC) мобилизации эпикарда происхождения, механизмы, регулирующие их последующую миграцию и дифференцировку плохо изучены. Здесь мы представляем в пробирке и стратегии бывших естественных условиях для изучения EPDC моторику и дифференциации. Во-первых, мы опишем метод получения первичных эпикардиальные клеток путем вырост культуры из эмбрионального сердца мыши. Введем также подробный протокол для оценки трехмерной миграции меченых EPDC в системе органной культуры. Мы предоставляем доказательства того, используя эти методы, что генетическое удаление myocardin связанных факторов транскрипции в эпикарда затухает миграции EPDC. Такой подход служит платформой для оценки кандидатов модификаторов EPDCбиологии и может быть использовано для разработки генетических или химических экранов для выявления новых регуляторов мобилизации EPDC, которые могут быть полезны для сердца ремонта.

Introduction

Эпикард представляет собой один слой мезотелиальной клеток, что линии сердца и последствия развития сердца, созревание и ремонт. Благодаря хорошо скоординированным обмена паракриновых сигналов, Интимной диалог между миокарда и эпикарда является необходимым условием для остановки роста и формирования не-миоцитов сердца родословных 1. Эпикардиального клетки , полученные из (EPDC) выходят из подмножества эпикарда клеток через эпителиальные-к-мезенхимальных перехода (EMT) 2, вторгнуться в субэпикардиального пространство и основной миокард и дифференцируются в основном в коронарных сосудов стенной клеток и сердечных фибробластов, а также к в меньшей степени, эндотелиальные клетки и кардиомиоциты 3-9.

Механизмы , регулирующие эпикардиального EMT и EPDC вторжения были отнесены к скоординированным действиям различных молекул , включая секретируемых лигандов 10-13 рецепторов клеточной поверхности и молекул адгезии 14,15, регулиляторов апикального-базальной полярности 16,17, малые GTPases 18,19 и факторов транскрипции 2,20,21. В то время как многие из молекулярных эффекторов миграции EPDC были определены, более глубокое понимание физиологических сигналов, которые стимулируют мобилизацию EPDC в зародыше может ускорить разработку стратегий для управления этим процессом в взрослых для улучшения ремонта сердца.

Исследования, направленные на выявление новых регуляторов мобилизации EPDC полагаются на очистку этой популяции клеток или проследить миграцию отдельных клеток эпикарда. Один или комбинации генов - маркеров, в том числе Wt1, Tcf21, Tbx18, и / или Aldh1a2, обычно используется для идентификации плода эпикарда 1. Тем не менее, использование этих маркеров для отслеживания миграции EPDC не является оптимальным, как экспрессия маркеров эпикарда убывание в течение развития сердца и часто теряется, когда эпикарда клетки подвергаются transdifференциации в мезенхимальных клетках.

Применение системы Cre / LoxP, в сочетании с LINEAGE-трассировку репортеров, было полезно в постоянно мечения эпикарда и его потомков в процессе развития сердца и после ишемического повреждения во взрослом 7,22,23. Несколько эпикардиальные с ограничением Cre линии были сформированы и широко используются для обозначения EPDC и условной делеции гена стратегий 1. Эти исследования привели к характеристике различных эпикардиальные линий, а также выявление критических медиаторов EPDC моторики и дифференциации. Тем не менее, накапливая данные также свидетельствуют о эпикард представляет собой гетерогенную популяцию клеток - предшественников 4,24,25. Таким образом, только часть эпикарда клеток будут направлены с использованием данного драйвера Cre.

Для того, чтобы маркировать всю эпикарда независимо от специфики Cre, ряд лабораторий использовали нарост CULTure системы или исключая виво методы органной культуры , чтобы точно изолировать или этикетку эпикардиальные клетки , не в зависимости от экспрессии генетической линии маркеров 26-28. Для исследований бывших естественных условиях миграции, эмбриональные сердца изолированы до эпикарда EMT и культивируют в среде , дополненной с зеленым флуоресцентным белком (GFP) -expressing аденовируса (Ad / GFP) 9,18. Такой подход позволяет эффективно маркировки всей эпикарда, а не подмножества клеток с помощью Cre-опосредованной рекомбинации. Сердце культуры впоследствии подвергается воздействию известных индукторов EMT , чтобы стимулировать мобилизацию EPDC 28,29. Ex естественных условиях и в естественных условиях анализов дополняются в пробирке эпикардиальные эксплантов культур, которые являются особенно полезным подходом для изучения детальных механизмов вождения миграции EPDC.

Здесь мы опишем методы выделения первичных эпикардиальные клеток для исследований в пробирке epicardiаль ЕМТ, а также система органной культуры для экс виво анализ EPDC моторики. Недавно мы продемонстрировали полезность и надежность этого метода с помощью методов генной модуляции myocardin связанных фактора транскрипции (MRTF) / коэффициент отклика сыворотки (ОСР) ось сигнализации для управления актина на основе миграции EPDC 9. В то время как наши данные подчеркивают один сигнальный путь, необходимый для регулирования миграции EPDC, эти методы пригодны для разгадке механизмов, которые в совокупности оркестрировать миграцию и дифференцировку EPDC. Кроме того, эксплантов и бывших естественных условиях системы культуры могут быть реализованы в функциональных экранов для идентификации новых регуляторов мобилизации EPDC для терапевтических применений в регенерации сердца.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Примечание: Все эксперименты с мышами были одобрены Университетской комитета по изучению ресурсов животного мира при Университете Рочестера с.

1. эпикардиального вырост Культура Анализ (Рисунок 1А)

  1. Препараты
    1. Подготовка 5 мл среды А для первичной изоляции эпикарда клеток путем дополнения среды 199 (М199) с 5% фетальной бычьей сыворотки (FBS) и 1% пенициллина / стрептомицина (Pen / Strep).
    2. Предварительно теплая среда А и 100 мл Хэнкса сбалансированный солевой раствор (HBSS) в C водяной бане при 37 °.
    3. Разрешить коллаген покрытием камерные слайды нагреться до комнатной температуры в течение 30 мин.
    4. Добавьте 100 мкл среды А в каждую лунку камеры горкой и осторожно повернуть, чтобы равномерно покрывать поверхность коллагена. Повторите эти действия для 8-12 скважин. Удалить СМИ после того, как камеры для нанесения покрытий.
    5. Аликвоты предварительно нагреты HBSS на два 10 см 2 пластины , содержащие 50 мл каждого из HBSS.
  2. Изолировать эмбриональных сердца от Беременные плотины на 11,5 дней после коитуса (DPC).30
    1. Обезболить мышь с 0,5 мл 13 мг / мл кетамина / 0,88 мг / мл ксилазина коктейль в 1X Дульбекко забуференным фосфатом физиологическим раствором (ДЗФР) с помощью внутрибрюшинной инъекции. Подтверждение надлежащего обезболивание с помощью теста пальца щепоткой. Мягкое пинч достаточно, чтобы определить, если мышь реагирует. Любое движение или лапа вывести указывает на то животное не достаточно наркоз делать операцию. Эвтаназии шейным смещением.
    2. Положите мышь перед вентральной стороной вверх и распылить живот с 70% -ным этанолом, чтобы уменьшить загрязнение волос.
    3. Сожмите кожу с пинцетом и разрезать боковой разрез на животе с хирургическими ножницами. Держите кожу плотно, а затем растащить в противоположных направлениях в сторону головы и хвоста.
    4. Pinch брюшины с пинцетом и вырезать ножницами, чтобы обнажить брюшную полость.
    5. Осторожно удалите децидуальной путем разрезания вдоль mesometrium. Передача расчлененный децидуальной предварительно нагретую HBSS в первом10 см 2 пластины.
    6. Отделить децидуальной путем разрезания между эмбрионами.
    7. Перенос эмбриона на второй 10 см 2 пластины с предварительно подогретого HBSS под микроскопом рассекает. Осторожно снимите ткань и желтка внеэмбриональной, затем обезглавить эмбриона.
    8. Pinch грудную стенку с пинцетом и разрывают ткани друг от друга на средней линии, обнажая грудной полости.
    9. Поместите щипцов позади сердца. Возьмитесь тракта оттока и вытащить сердце от зародыша. Отделить легочный тракт и легкие от сердца, если еще прилагается.
  3. Перенести сердце одной скважины коллагеновой покрытием горкой и поместите его спинной стороной вниз (рисунок 1b). Повторите шаги 1.2.7-1.3 для каждого эмбриона.
  4. После того, как все сердца были переданы в отдельные лунки, инкубировать в камере слайд в течение 30 мин при 37 ° С, 5% СО 2 , чтобы обеспечить достаточное присоединение к коллагеновой матрице.
  5. Осторожно добавьте20-50 мкл подогретого эксплантов среды А вокруг каждого сердца. Важно: Не добавляйте носитель слишком быстро или до уровня выше сердца, в противном случае сердца может отсоединиться от подложки коллагена.
  6. Культура сердца при 37 ° С, 5% СО 2 в течение примерно 24 ч , чтобы позволить эпикарда нарост. Примечание: Наросты можно наблюдать уже в 3-4 ч культуры (рис 1C) и в основном состоит из мезотелиальной клеток , воспроизводящих мощеной морфологии, с минимальным загрязнением мезенхимальных клеток (рис 1D, E). Представительные результаты были получены с использованием рассечение микроскопа, снабженного камерой.

2. Генетическая абляция и Индукция ЕМТ в эпикардиального выростов

Внимание: Ручка аденовирусов с осторожностью в соответствии с руководящими принципами, утвержденными в области биобезопасности.

  1. Приготовьте 15 мл среды В (М199 с добавлением 1% FBS и 1% Pen / Strep) и предварительно нагреться до 37 ° С в водяной бане.
  2. Для удаленияfloxed аллели, подготовить эксплантов среды B , дополненной 2,5 × 10 4 БОЕ / мл аденовируса , экспрессирующих Cre рекомбиназу (Ad / CRE) или контрольным вирусом.
    Примечание: Аденовирусный опосредованной избыточная экспрессия генов-кандидатов, также могут быть проведены, чтобы оценить усиление функции фенотипов. Титры вируса должна быть определена конечным пользователем.
  3. Осторожно удалите эпикарда обедненного сердца от выроста культур с использованием щипцов. Передача сердца в 1,5 мл пробирки с 800 мкл тризол и хранят при -80 ° С для последующего выделения РНК и анализ экспрессии генов.
  4. Промыть каждую лунку с ДЗФР для удаления клеток крови и избыток продуктов распада клеток.
  5. Добавьте 500 мкл эксплантов питательную среду В. дополненной аденовируса (ES) для каждой вырост культуры и инкубируют в течение 24 ч при 37 ° С в атмосфере 5% СО 2.
  6. Для EMT индукции, удалить носитель и пополняться 37 ° C эксплантов среде В, дополненной рекомбинантный трансформирующий фактор роста (TGF) -β1 [10 нг / мл] или транспортного средства (4 мМ чydrochloric кислота (HCl), содержащий 1 мг / мл бычьего сывороточного альбумина (БСА)). Культура эксплантов в течение еще ​​24 ч при температуре 37 ° С, 5% СО 2. Продолжайте ген / экспрессии белка анализа или иммуноцитохимию, как подробно описано в последующих протоколах.
    Примечание: Индукция эпикарда EMT стимулируется различными концентрациями TGF- 1 в диапазоне от 0,5 нг / мл - 10 нг / мл 26,31-33. Более высокие концентрации лиганда может привести к неспецифического связывания для всех TGF-β-рецепторов. Концентрация TGF- 1 должна отражать конкретные экспериментальные цели.

3. Экспрессия гена Анализ эпикардиального выростов

  1. Оттепель эпикарда обедненного сердца ранее сохраненные в TRIzol (2.2).
  2. Вытяжку из средств массовой информации EPDC культур и мыть дважды с ДЗФР.
  3. Добавить 800 мкл комнатной температуры Trizol в эксплантате культуры.
  4. Выдержите эпикарда обедненного сердца и EPDC культур в TRIzol в течение 5 мин при комнатной temperatu число рейнольдса Пипетировать вверх и вниз в десять раз гомогенизировать лизису образца.
    Примечание: Сердца могут потребовать дальнейшей пипетирования полностью гомогенизируют.
  5. Передача лизаты до 1,5 мл пробирки и продолжить полной изоляции РНК в соответствии с инструкциями изготовителя. Добавьте 10 мкг гликоген до осаждения для увеличения выхода РНК. Данный эксплантов даст примерно 0,5-1,0 мкг РНК.
  6. Удалить загрязняющие ДНК с ДНКазой I и обратный транскрибировать 0,5 мкг мРНК в соответствии с инструкциями изготовителя.
  7. Проверка чистоты эпикардиальные эксплантов и / или индукции EMT с количественной обратной транскрипции (QRT) -PCR 34 с использованием SYBR зеленый и маркеры , описанные в таблице 1. Нормализация уровня мРНК глицеральдегид 3-фосфатдегидрогеназы (GAPDH) и вычислить относительное выражение , используя 2 - метод ΔΔCt 35. Типичные результаты приведены на рисунке 2А.
Название "> 4. Белок Анализ эпикардиального выростов

  1. Вытяжку из средств массовой информации EPDC культур и мыть дважды с ДЗФР.
  2. Добавляют 10 мкл ледяной белка буфер для лизиса (50 мМ Трис, рН 7,5, 150 мМ хлорида натрия, 1 мМ рН этилендиаминтетрауксусной кислоты 8,0, 1% Тритон Х-100, ингибитор 1x протеаз) в каждой камере хорошо и поместить камеру слайд на лед. Отрежьте примерно ¼ дна на P200 пипетки и использовать оставшуюся часть для того чтобы очистить клетки от слайда. Пипетка вверх и вниз, чтобы лизировать клетки эпикарда и передачи в 1,5 мл трубки.
  3. Разрушать ультразвуком лизированных эксплантов на низких (160 Вт) в течение 5 мин в водяной бане со льдом с 30 циклами сек ВКЛ и ВЫКЛ.
  4. Центрифуга лизаты в течение 10 мин при 10000 х г, 4 ° C. Перенести супернатант в новую пробирку и определяют концентрацию белка с помощью анализа белка 36.
    Примечание: Данная эксплантов будет давать до 1,5 мкг общего белка. Мы обнаружили, что объединение эксплантов из двух сердецd загрузки белка 2 мкг на лунку достаточна для обнаружения гладких мышц альфа-актин (ACTA2) и GAPDH 9. Обнаружение других белков-мишеней может потребовать объединения нескольких эксплантов образцов, как определено конечным пользователем.

5. Иммуноцитохимическая эпикардиальных выростов

  1. Удалить носитель из эксплантов культур и дважды промывают ДЗФР.
  2. Осторожно добавьте 500 мкл 4% (об / об) параформальдегида или ледяной метанола в каждую лунку и зафиксировать эксплантатов в течение 5 мин при комнатной температуре или 10 минут при -20 ° С, соответственно. Закрепить в соответствии со спецификациями антител в соответствии с рекомендациями производителя.
  3. Удалить закрепитель и промойте каждую лунку с DPBS три раза в течение 5 мин.
  4. Клетки проницаемыми с 500 мкл 0,1% (об / об) Тритон Х-100 в DPBS в течение 5 мин.
  5. Удалить пермеабилизирующего раствор и промыть DPBS три раза в течение 5 мин.
  6. Блок клеток с 10% сыворотки в ДЗФР в течение 30 мин при комнатной temperatuчисло рейнольдса
  7. Продолжайте окрашивания первичных антител в соответствии с рекомендациями производителя и оптимальных условиях, определяемых конечным пользователем.
  8. Удалить раствор антитела и промыть DPBS три раза в течение 5 мин.
  9. Применение вторичного антитела в соответствии с инструкциями изготовителя и контрастирующая с соответствующим ядерным красителем.
  10. Удалить раствор антитела и промыть DPBS три раза в течение 5 мин.
  11. Удалить камеру слайд стены в соответствии с инструкциями изготовителя и добавьте водную среду непосредственно крепежное к клеткам. Поместите покровное над клетками и печать с лаком для ногтей. Типичные результаты показаны на фигуре 2В - 2D с использованием инвертированного сканирующей конфокальной микроскопии.

6. Ex Vivo культуры анализа (рис 3A)

  1. Препараты
    1. Приготовьте 12 мл экс виво культуральной среды с использованием (1: 1) смесь Дульбекко в модификации Дульбекко (DMEM): М199 , дополненной 10%FBS и 1% Pen / Strep.
    2. В водяной бане C 37 °, предварительно теплой ех естественных условиях культуральной среды и 100 мл HBSS.
    3. Аликвотные 1 мл предварительно нагретой среды в 8-12 лунки 24-луночного планшета.
    4. Передача предварительно нагреты HBSS до двух 10 см 2 пластины, содержащие по 50 мл каждый раз .
  2. Изолировать мышиных эмбриональных сердца в HBSS (как описано в разделе 1.2) от беременных плотин на 12,5 ДПЗ.
  3. Передача каждого сердца в одной лунке 24 - луночного планшета , содержащего исключая виво культуральной среды. Инкубируйте планшет при 37 ° С в атмосфере 5% СО 2 при осторожном качалки вручную или с помощью качающейся платформе , чтобы предотвратить сцепление. Сразу переходите к шагу 7.1.

7. эпикардиального Этикетировочное и EMT Индукция в Ex Vivo культур

  1. Для маркировки эпикарда, подготовить 12 мл 37 ° C ех естественных условиях культуральной среды , дополненной 3,0 × 10 6 БОЕ / мл Ad / GFP. Для целенаправленного абляции floxed аллели, передача 6 млг / GFP, дополненной культуральной среды на новый 15 мл коническую трубку. Добавить объявление / Cre или контролировать аденовирус до конечной концентрации 1,5 х 10 6 БОЕ / мл.
    Примечание: Усиление функции анализа также могут быть выполнены с соответствующими аденовирусной доставки опосредованного генного.
  2. Осторожно удалите культуральную среду из каждой лунки 24-луночного планшета с использованием наконечника P1,000 пипетки.
  3. Аккуратно добавить питательную среду, дополненную аденовирусов (ES) в каждую лунку.
  4. Инкубируйте планшет при 37 ° С в атмосфере 5% СО 2 в течение 24 ч при осторожном покачиванием.
  5. Для EMT индукции, подготовить 12 мл 37 ° C исключая виво культуральной среды , содержащей 10 нг / мл TGF- 1 и 20 нг / мл фактора роста , полученного из тромбоцитов (PDGF) -BB или транспортное средство (4 мМ HCl , содержащий 1 мг / мл бычьего сывороточного альбумина ).
  6. Тщательно удалить культуральную среду из каждой лунки 24-луночного планшета с использованием наконечника P1,000 пипетки. Осторожно промыть сердца с ДЗФР 1 мл.
  7. Удалите DPBS и наполняйте сердца с экс естественных условиях культуры мнеDIUM содержащие TGF- 1 и PDGF-BB или транспортное средство.
  8. Инкубировать в течение 24 ч при 37 ° С в атмосфере 5% СО 2 при осторожном покачиванием.

8. криоконсервации и Иммуногистохимия Ex Vivo культур

  1. Подготовка сердца для криоконсервации.
    1. Удалить культуральной среды и мыть сердца в два раза с ледяной ДЗФР.
    2. Добавить 1 мл 4% (об / об) параформальдегидом в каждое сердце и зафиксировать в течение 2 часов при температуре 4 ° С при осторожном покачиванием.
    3. Удалите закрепитель и мыть сердца дважды с ДЗФР. Передача сердца в чистые ячейки с 1 мл 10% (вес / объем) сахарозы, приготовленного в ДЗФР. Инкубируйте планшет в течение ночи при температуре 4 ° С при осторожном покачиванием.
    4. Тщательно передачи сердца к новым скважинам с 18% (вес / объем) сахарозы, полученного в ДЗФР. Инкубируйте планшет в течение ночи при температуре 4 ° С при осторожном покачиванием.
    5. Передача каждого сердца к cryomold содержащей ткани морозильную среды. Немедленно заморозить блоки с использованием жидкого азота и хранят при -80 & #176; С.
  2. Раздел сердца на 5 мкм с использованием срезов ткани криостата и место на положительно заряженных микроскопа. Хранить слайды при температуре -80 ° С до окрашивания.
  3. Выполните иммуногистохимии для обнаружения суб-эпикардиальная базальной мембраны.
    1. Растаяйте слайды в течение не менее 30 мин при комнатной температуре.
    2. Регидратировать секции дважды промывку в ДЗФР в течение 5 мин при осторожном покачиванием.
    3. раздел проницаемыми с 0,1% (об / об) Тритон Х-100 в PBS в течение 5 мин при комнатной температуре.
    4. Вымойте слайды дважды в ДЗФР в течение 5 мин с нежным покачиванием.
    5. Пятно от избытка DPBS и определяют область окрашивания с гидрофобным маркировки пером. Блочные участки с 10% сыворотки в ДЗФР в течение 30 мин при комнатной температуре.
    6. Удалить блок и применять коллагена типа IV антитела (ColIV, 1: 200), разведенного в блоке. Инкубируют в течение ночи при 4 ° С в камере с контролируемой влажностью.
    7. Вымойте слайды три раза в ДЗФР для5 мин с нежным покачиванием.
    8. Развести флуоресцентно конъюгированного вторичного антитела (1: 500) и DAPI (1: 5000) в ДЗФР и применить к слайдам. Инкубировать в течение 1 часа при комнатной температуре. Выберите подходящее вторичное антитело с эмиссионной и длине волны возбуждения, отличной от GFP.
    9. Вымойте слайды три раза в PBS в течение 5 мин с нежным покачиванием. Mount сползает с монтажной средой.

9. Работа с изображениями и Количественное Ex Vivo культур

  1. Иметь ослепили пользователя изображения и количественно окрашенные срезы. Изображение по крайней мере пять непоследовательных срезы ткани из данного сердца в 4-5 произвольных местах вдоль эпикарда (край сердца) с использованием флуоресцентного или конфокальной микроскопии при 40-кратном увеличении. Типичные результаты показаны на фигуре 3В с использованием инвертированного сканирующей конфокальной микроскопии.
  2. Вручную подсчитать общее количество GFP-положительных клеток в данном изображении. Определение миграции EPDC, как GFP роsitive клетки, расположенные в пределах или за пределами субэпикардиального базальной мембраны ColIV. Определить процент GFP мигрирующих клеток, как количество мигрирующих клеток GFP позитивных по отношению к общему количеству GFP-положительных клеток в данном изображении. Типичные результаты показаны на рисунке 3C-D с использованием инвертированного сканирующей конфокальной микроскопии.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Эпикард может быть эффективно изолированы с использованием анализа культуры нарост, воспользовавшись его внешней расположения и эксплуатации пластичностью развития и предлагает внутреннюю миграционную поведение EPDC. Мышиные эмбриональные сердца изолированы на E11.5 до эпикарда EMT и кисло спинной стороной вниз на коллагеновых покрытием камеры слайдах 26 (Фигура 1А, Б). Эксплантировали сердца будут продолжать сокращаться; Тем не менее, эпикарда будет прилипать к коллагеновой матрице и мигрируют от из миокарда в течение 24 ч культуры (рис 1C). Эпикардиального клетки можно наблюдать , исходящая от сердца с булыжной морфологией, что свидетельствует о мезотелиальной идентичности (Фигуры 1С-E). Через 24 часа культивирования эпикарда сердца обедненного удаляются для анализа экспрессии генов или белков.

В дополнение к соблюдению epitheliAl морфология, чистота эпикарда культур клеток может быть дополнительно подтверждена с помощью экспрессии эпикарда ограниченных маркеров генов и белков. Эпикардиального эксплантаты клеток отобразить устойчивую экспрессию эпикарда и мезотелиальной маркеров (Aldh1a2, Tcf21 и WT1) и низким уровнем экспрессии генов кардиомиоцитов (Nkx2-5 и Myh7) по сравнению с эпикарда обедненного сердца (рис 2А). Для дальнейшей проверки личности, эпикардиальные клеточные культуры закрепляются через 48 часов после удаления сердца и со-окрашивали антителами против опухоли Вильмса 1 (WT1) и Zona occludens белок 1 (ZO1) , чтобы маркировать мезотелиальной клеток и межклеточных плотных контактов, соответственно 37,38 ( Рисунок 2B). Этот метод нарост культура дает относительно высокую чистоту мезотелиальных клеток; Тем не менее, пользователи могут наблюдать небольшой процент заражения клеток. Фибробласты и клетки гладкой мускулатуры обнаруживают удлиненную мезенхимальных фенотипа с заметным отсутствием Nucleсоток WT1 и организованные плотные соединения (рис 2С). Поиск и устранение неисправностей методы, чтобы ограничить количество загрязнений, не эпикардиального клетки расширяются в обсуждении.

Анализ эксплантов нарост является полезной система культуры для допроса эпикардиального биологии в пробирке. Для демонстрации эпикарда клеток пластичностью, эксплантаты стимулировали TGF- 1 [10 нг / мл] , чтобы вызвать трансдифференцировку в мезенхимальные клетки 26,28. Через 24 часа стимуляции, EPDC принять мезенхимальных фенотип с пониженной ZO1 окрашивания и прочного формирования De Novo гладких мышц альфа-актин положительных стрессовых волокон (ACTA2 или SMA), в частности , на периферии культуры 39 (рис 2D, красный). В отличие от этого, чтобы подчеркнуть сборку волокна на периферии эксплантов, вырожденные эпикардиальные клетки с более определенными межклеточных контактов (ZO1, зеленый) в центре monolayeВыражение ACTA2 белка г Дисплей в корковой актина.

Помимо прохождения EMT, EPDC вторгнется миокард и дифференцируются, составляющие значительную часть некардиомиоцитов населения. Подвижность EPDC может быть оценена с использованием ранее установленной системы естественных условиях органной культуры ех в результате чего внешний вид E12.5 сердца помечены аденовируса , экспрессирующей GFP 9,18 (рис 3А). Меченые сердца дополнительно культивировали в течение трех дней в присутствии TGF- 1 [10 нг / мл] и PDGF-BB [20 нг / мл] для содействия миграции EPDC. Органные культуры периодически поворачивать , чтобы предотвратить прилипание виво сердца бывших к поверхности культуральных планшетах. Эта система позволяет эффективно маркировки всей эпикарда и оценки EPDC моторики в трехмерной модели в отличие от направленной миграции с анализами нуля витро. Миграция EPDC является obserвед как вторжение GFP позитивных клеток эпикарда в или за пределами ColIV (красный) субэпикардиального базальной мембраны 16 (фиг 3B, C). Чтобы проиллюстрировать полезность этой системы, мы недавно показали , что манипуляции с сигнальной оси MRTF / ОСР может влиять на моторику EPDC 9. Удаление Mrtfa и Mrtfb путем Cre-опосредованной иссечения floxed аллели (MRTFdKO) затухает миграцию EPDC в субэпикардиального пространство. С другой стороны , принудительное выражение MRTF-A (Ad / MRTF-A) в C57BL / 6 сердца приводит к увеличению миграции EPDC и нарушению ColIV базальной мембраны (рис 3C, D).

Ген Вперед Задний ход NCBI Присоединение
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
Wt1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Таблица 1: Последовательности прямого и обратного праймеров , используемых для проверки эпикардиального вырост культуры чистоты путем анализа эпикарда и Миокард Запретной экспрессии генов экспрессии генов определяется Wi QRT-PCR.го по следующим параметрам: денатурация при 95 ° С в течение 10 сек; Отжиг при температуре 60 ° С в течение 30 сек; повторять циклы 50x.

Рисунок 1
Рисунок 1: Выделение первичных эпикардиального клеток с использованием нарост культуры анализа (а) схематическое представление эпикардиального анализа вырост эксплантов с рекомендуемой сроки для эпикардиального модуляции и анализа.. (B - E) Представитель Светлое изображения различных моментов времени в ходе анализа эксплантов. (B) эмбриональный день E11.5 мышиные сердца расположены спинной стороной вниз на коллагеновой подложке. Клетки (С) эпикардиального (белые стрелки) начнут мигрировать от сердца в течение 3-4 ч культуры. Клетки крови (черные стрелки) могут накапливаться поблизости или покрыть эксплантов в течение эпикардиального вырост. (D, Е) После того, какоколо 24 ч культуры, сердца удаляются и эпикардиальные монослоя остаются приклеен к камере слайде. Клеточные выросты отображения эпителиальной морфологии с булыжной типа расположения клеток. Шкала баров = 250 мкм (BD) или 50 мкм (С, Е). H = сердце, LA = левое предсердие, LV = левый желудочек, OFT = тракт оттока, RA = правое предсердие, RV = правый желудочек. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2: Оценка эпикарда Cell нарост чистоты (А) QRT-ПЦР проверка эпикарда ограничено маркеров (Tcf21, Aldh1a2 и WT1) в нарост культурах по сравнению с инфарктом экспрессии генов (Nkx2-5 и Myh7) в эпикарда обедненного E11.. 5 сердец. представи данныхт среднее ± SEM (n = 8 на группу). Звездочки означают статистическую значимость с использованием Student T-тест с **** P <0,0001. (B) представитель совместно иммунофлуоресцентного окрашивания стимулированных выростов для эпикардиального выражения (WT1, красный), межклеточных плотных контактов (ZO1, зеленый) и ядер (DAPI, синий). (С) Пример заражения клеток в культуре нарост. Эпикардиального клетки (звездочка) наблюдаются в правой части панели с характерной мезотелиальной идентичности (ядерной WT1, красный) и организованных эпителиальных плотных контактов (ZO1, зеленый). Соседние клетки в центре (белые стрелки) обладают удлиненную мезенхимальных морфологию, как показано с помощью дифференциального интерференционного контраста (DIC) изображений, с минимальным белком WT1 ядерной и неорганизованного ZO1 окрашивания. (D) культуры эпикарда клеток стимулировали транспортное средство (4 мМ HCl в 1 мг / мл бычьего сывороточного альбумина) или TGF-β1 [10 нг / мл] , чтобы вызвать эпикардаЕМТ. TGF-β1 стимуляция способствует надежной экспрессию ACTA2 (красный) в кортикальных областях сливающихся клеток в центре эксплантов или в стрессовых волокон клеток, мигрирующих на краю или периферии монослое. Клеточные спаек помечены ZO1 (зеленый). Масштабные полоски = 25 мкм (BD). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3: Ex Vivo оценка EPDC Motility (А) Схематическое временная шкала экс виво сердца анализа культуры.. (B) представитель сечение / 6 E12.5 сердца C57BL трансдуцированную Ad / GFP (зеленый) в течение 24 ч 5 мкм для обозначения внешности сердца. Экс Vivo сердца были впоследствии культивировали еще в течение 48 ч с TGF- β1 [10 нг / мл]и PDGF-BB [20 нг / мл], чтобы стимулировать миграцию EPDC. Срезы окрашивали совместно для ColIV (красный) для обозначения субэпикардиального базальной мембраны и ядра (DAPI, синий). Ex естественных условиях сердце культуры морфологии проявляется ДВС - синдрома. LV = левый желудочек, RV = правый желудочек, RA = правое предсердие. (C, D) Пример применения естественных условиях анализа миграции экс путем модуляции регулирующей оси MRTF / SRF. Эта цифра была изменена с [9]. E12.5 сердца были изолированы от Mrtfa - / -;. Mrtfb фл / Fl эмбрионы и трансдуцированных Ad / GFP и контрольным вирусом или аденовирусом , экспрессирующим Cre рекомбиназу в течение 24 ч Ex естественных условиях Культуры затем стимулировали TGF- 1 [10 нг / мл] и PDGF-BB [20 нг / мл] в течение еще 48 часов. EPDC моторики (белые стрелки) наблюдается как миграция GFP позитивных клеток (зеленый) в или за пределами ColIV (красного цвета). Cre-опосредованное удаление Mrtfb в <EM> Mrtfa - / - фон (MRTFdKO) приводит к ослаблению EPDC миграции сравнению с контрольными сердца. С другой стороны, принудительное выражение MRTF-A (Ad / MRTF-A) в E12.5 C57BL / 6 сердец усиливает миграцию EPDC. (D) Количественное% миграции положительных клеток GFP. Данные представлены в виде среднего значения ± SEM (n = 4 сердца для каждого условия). Данные были проанализированы с помощью одностороннего ANOVA с звездочками, обозначающее статистическую значимость Тьюки после специальных тестов с **** P <0,0001. Шкала баров = 200 мкм (Б) или 25 мкм (С). Все изображения были получены с помощью перевернутого конфокальной лазерной сканирующей микроскопии. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Здесь мы приводим подробные методы , чтобы изолировать первичную эпикардиального клетку путем разрастания и отслеживать миграцию EPDC в бывших естественных культурах сердца. Для нарост культур, подходящее время для удаления эпикарда обедненного сердце изменяется незначительно между экспериментами. Периодический мониторинг эксплантов после инкубации в течение ночи рекомендуется, чтобы оценить степень эпикардиального выроста и извлечь сердце, прежде чем появляются фибробласты. Для обеспечения чистоты сердца должны быть удалены в течение 24 часов с культивирующий в искусственной среде, чтобы предотвратить накопление не-эпикардиальные родословных. Обрезка прочь тракта оттока и оба предсердия до передачи сердца к камере слайде может также уменьшить загрязняющие типы клеток 27,40. Поскольку сердца плода выделяют из помета мыши во время узкого окна времени, и культивируют при тех же самых условиях, время для выростов появляться относительно похожи от одного сердца к другому в течение эксперимента. Таким образом, все сердца должны бе удалены, когда большинство эксплантов проявляют эпикардиальные наросты. В некоторых случаях эпикардиальные клетки не мигрируют эффективно из сердца, является сжимающим более энергично, чем другие, и в этом случае это эксплантов должны быть исключены из эксперимента.

Накопление клеток крови часто может скрыть плоский монослой клеток эпикарда (стрелки, рис 1C), что делает его трудно визуализировать наросты. Для того, чтобы избежать чрезмерного вклада клеток крови, сердца могут оставаться в HBSS в течение нескольких минут после получения рассечения от эмбриона. Это позволяет достаточно времени для плода сердца откачивать остатки крови в камерах сердца перед передачей в камеру слайде. В качестве альтернативы, дополняя культуры с эксплантов среды А после первой инкубации в течение ночи поможет смыть некоторый избыток крови и выявить выростов; Тем не менее, уровень средств массовой информации не должна подниматься выше сердца, как поверхностное натяжение может привести к сердцуотстраниться от подложки. Прочные эпикардиальные наросты наблюдаются с использованием коллагена I типа в качестве субстрата культуры; Тем не менее, другие субстраты были зарегистрированы в зависимости от организма и / или применения 27,40-42. Используя этот протокол, первичные эмбриональные клетки эпикарда могут процветать в течение 4 дней после удаления сердца и ежедневного среднего пополнения; Тем не менее, экспериментальные образцы, требующие более длительных периодов культуры должны быть определены конечным пользователем. Поскольку эпикарда ЕМТ сильно активируется во время эмбрионального развития, эта методика нарост культура ограничена обогащения плодных клеток эпикарда. Другие группы описали методы , чтобы изолировать взрослых эпикардиальные клетки 43,44.

Для бывших естественных условиях миграции анализов, экстракции сердца и эпикарда маркировки клеток рекомендуются при E12.5 по двум причинам. Во-первых, после того, как сердца, изолированных E12.5 больше и, следовательно, требуют больше перфузию для поддержания жизнеспособности. Простая диффузия питательных веществs не является достаточным для поддержания культуры органов от больших сердец. Во-вторых, эпикардиальная EMT и миграция EPDC происходят вокруг E12.5. Таким образом, эпикарда должен быть помечены аденовирус, экспрессирующий флуоресцентный белок сразу после удаления сердца, чтобы максимизировать детектирование EPDC. В качестве альтернативы, карбоксифлуоресцеин диацетат сукцинимидил эфира (CFSE) уже сообщалось ранее для обозначения внешности сердца и проследить миграцию EPDC 10,45.

В отличие от выроста анализов, исключая виво культуры должны быть качали периодически , чтобы избежать привязанности сердца и эпикарда клеток вырост. Культуры могут также быть непрерывно перемешивают в термостате, снабженном качалку на самой низкой установке скорости. Пользователи заметят изменения в сердечной морфологии в течение нескольких дней культивирования органов и следует избегать анализов за 72 часов изоляции сердца. С помощью этого теста, EPDC вторжение наблюдается в течение 48 до 72 часов культуры. В то время как системы Cre-LoxPбыла использована в естественных условиях для картирования локализации EPDC в коронарных сосудах, интерстиции миокарда и межжелудочковой перегородки 7,22, это бывший естественных условиях метод ограничен миграции EPDC в течение нескольких слоев клеток суб-эпикардиальная пространства. Таким образом, этот метод является более подходящим для определения регуляторов EPDC подвижности и инвазии, а не определять конечный пункт назначения миграции EPDC.

Эпикардиального обособления клеток и ех естественных условиях миграции анализы, в сочетании с усилением или потерей функциональных подходов, уже доказали свою полезность для оценки генов - кандидатов , которые могут повлиять на EPDC биологии 9,18,46. Эти методы также предоставляют платформу для усиления из-функции или с потерей функции экранов для идентификации новых регуляторов миграции EPDC. Эта стратегия, в сочетании с активацией флуоресценции сортировки клеток или отдельных клеток РНК-последовательности, может также обеспечить возможность зондировать эпикардиального гетерогенностьи EPDC дифференциация более подробно. И, наконец, модификации этих процедур могут быть использованы для разработки экранов для небольших молекул, которые воздействуют на клетки и эпикарда EPDC биологии с целью сердечной регенеративной медицины.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgements

EMS была поддержана грантами от Национальных Институтов Здоровья (NIH) [номер гранта R01HL120919]; Американской ассоциации сердца [номер гранта 10SDG4350046]; Университет Рочестера CTSA награду от NIH [номер гранта UL1 TR000042]; и запуска средства из Aab CVRI. MAT была частично поддержана грантом в Университете Рочестера школы медицины и стоматологии от Med INTO-Град Инициатива Медицинского института Говарда Хьюза; и Национальной премии Сервис Исследования Institutional Ruth L. Kirschstein из NIH [номер гранта GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics