Consecuencia del epicardio y Ensayo de Cultivo

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Una sola capa de líneas de células epicárdicas el corazón, proporcionando factores paracrinos que estimulan la proliferación de los cardiomiocitos y contribuir directamente progenitores cardiovasculares durante el desarrollo y la enfermedad. Mientras que un número de factores han sido implicados en la movilización de células derivadas del epicardio (CDEP), los mecanismos que regulan su posterior migración y diferenciación son poco conocidos. A continuación, presentamos in vitro y ex vivo para estudiar las estrategias de EPDC la motilidad y la diferenciación. En primer lugar, se describe un método para obtener células epicárdicas primarias por la cultura consecuencia del corazón de embriones de ratón. También presentamos un protocolo detallado para evaluar la migración tridimensional de EPDC marcado en un sistema de cultivo de órganos. Ofrecemos pruebas de que el uso de estas técnicas de eliminación genética de miocardina relacionados con factores de transcripción en el epicardio atenúa la migración EPDC. Este enfoque sirve como una plataforma para evaluar modificadores candidatos de EPDCbiología y podría ser utilizado para desarrollar pantallas genéticos o químicos para identificar nuevos reguladores de movilización EPDC que podrían ser útiles para la reparación cardiaca.

Introduction

El epicardio es una sola capa de células mesoteliales que recubre el corazón y los impactos cardiaca desarrollo, maduración y reparación. A través de un intercambio muy coordinada de señales paracrinas, el diálogo íntimo entre el miocardio y epicardio es indispensable para el crecimiento cardíaco y la formación de no miocitos cardíacos linajes 1. Células epicárdicas derivados (CDEP) emergen de un subconjunto de células epicárdicas a través de un epitelio-a-mesenquimal transición (EMT) 2, invadir el espacio subepicárdica y el miocardio subyacente, y diferenciar en gran medida en las células murales vasculares coronarias y fibroblastos cardíacos, y a una en menor medida, las células endoteliales y cardiomiocitos 3-9.

Los mecanismos que regulan la EMT epicárdico y la invasión EPDC se han atribuido a la acción coordinada de diversas moléculas, incluyendo ligandos secretados 10-13, receptores de superficie celular y moléculas de adhesión, 14,15 regudores de la polaridad apical-basal 16,17, 18,19 pequeñas GTPasas, y factores de transcripción 2,20,21. Mientras que muchos de los efectores moleculares de la migración EPDC se han definido, una mejor comprensión de las señales fisiológicas que estimulan la movilización EPDC en el embrión puede acelerar el desarrollo de estrategias para manipular este proceso en el adulto para mejorar la reparación cardíaca.

Estudios dirigidos a la identificación de nuevos reguladores de movilización EPDC se basan en la purificación de esta población de células o trazando la migración de las células epicárdicas individuales. Uno o una combinación de genes marcadores, incluyendo WT1 Tcf21, Tbx18, y / o Aldh1a2, se utiliza comúnmente para identificar el epicardio fetal al 1. Sin embargo, el uso de estos marcadores para realizar un seguimiento migrando EPDC no es óptima como expresión de marcadores epicárdicas disminuye en el transcurso de desarrollo del corazón y, a menudo se pierde cuando las células epicárdicas someten transdifdife- en las células mesenquimales.

La aplicación del sistema Cre / loxP, en conjunción con la prensa de linaje de trazado, ha sido útil en el etiquetado de forma permanente el epicardio y sus descendientes durante el desarrollo del corazón y después de una lesión isquémica en el adulto 7,22,23. Varias líneas de Cre epicárdicas restringida se han generado y se utilizan ampliamente para etiquetar EPDC y para las estrategias de deleción de genes condicional 1. Estos estudios han llevado a la caracterización de diversos linajes epicárdicas, y la identificación de mediadores críticos de EPDC la motilidad y la diferenciación. Sin embargo, la acumulación de evidencia también sugiere el epicardio es una población heterogénea de células progenitoras 4,24,25. Por lo tanto, sólo un subconjunto de las células epicárdicas se orientará con un controlador de Cre dado.

Con el fin de etiquetar todo el epicardio independientemente de Cre especificidad, un número de laboratorios han utilizado cul excrecenciasistemas tura o ex vivo los métodos de cultivo de órganos para aislar fielmente o marcar las células epicárdicas sin depender de la expresión de un linaje genético marcadores 26-28. Para los estudios ex vivo de migración, corazones embrionarias son aislados antes de la EMT epicárdica y se cultivaron en medio suplementado con una proteína fluorescente verde (GFP) expresando adenovirus (Ad / GFP) 9,18. Este enfoque permite el etiquetado eficiente de toda el epicardio en vez de un subconjunto de células por recombinación mediada por Cre. Culturas corazón son posteriormente expuestos a inductores conocidos de EMT para estimular la movilización de EPDC 28,29. Ex vivo e in vivo análisis se complementan con in vitro cultivos de explantes epicárdicas, que son un enfoque particularmente útil para explorar mecanismos detallados que impulsan la migración EPDC.

A continuación, se describen los métodos para aislar células epicárdicas primarios para los estudios in vitro de epicardial EMT, así como un sistema de cultivo de órganos ex vivo para los análisis de EPDC motilidad. Recientemente hemos demostrado la utilidad y robustez de este método mediante la modulación genéticamente relacionados con el factor de transcripción miocardina-(MRTF) / factor de respuesta a suero (SRF), el eje de señalización para manipular la migración basada en la actina de EPDC 9. Aunque nuestros resultados ponen de relieve una vía de señalización necesaria para la regulación de la migración EPDC, estos métodos son adecuados para desentrañar los mecanismos que organizan conjuntamente la migración y diferenciación de EPDC. Por otra parte, el explante y ex sistemas de cultivo in vivo podrían ser implementadas en las pantallas funcionales para identificar nuevos reguladores de la movilización de EPDC para aplicaciones terapéuticas en la regeneración cardiaca.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTA: Todos los experimentos con ratones que fueron aprobados por el Comité Universitario de Recursos Animales de la Universidad de Rochester.

1. epicárdica excrecencia Ensayo de Cultivo (Figura 1A)

  1. Preparativos
    1. Preparar 5 ml de medio A para el aislamiento de células epicárdica primaria completándolo Medium 199 (M199) con 5% de suero bovino fetal (FBS) y 1% de penicilina / estreptomicina (Pen / Strep).
    2. Pre-caliente medio A y 100 ml solución salina equilibrada de Hanks (HBSS) en un baño de agua C 37 °.
    3. Permitir a portaobjetos de cámara recubiertos con colágeno de calentar a temperatura ambiente durante 30 min.
    4. Añadir 100 l medio A a cada pocillo de la corredera de cámara y girar suavemente para cubrir uniformemente la superficie de colágeno. Repita durante 8-12 pozos. Retire los medios de comunicación después de cámaras de recubrimiento.
    5. Alícuota de pre-calentado HBSS en dos placas de 10 cm2 que contenían 50 ml de cada uno de HBSS.
  2. Aislar embrionarias de los corazones de la presa embarazada en el 11,5 Días postcoital (DPC).30
    1. Anestesiar al ratón con 0,5 ml de 13 mg / ml de ketamina / 0,88 mg / ml de cóctel de xilazina en 1x de Dulbecco tamponada con fosfato salino (DPBS) a través de inyección intraperitoneal. Confirmar la anestesia adecuada mediante una prueba del dedo del pie sujetador. Un pellizco suave es suficiente para determinar si el ratón es sensible. Cualquier movimiento o retirar la pata indica que el animal no está suficientemente anestesiado hacer la cirugía. La eutanasia por dislocación cervical.
    2. Coloque el ratón hacia la parte ventral del abdomen y rociar con un 70% de etanol para reducir la contaminación por el pelo.
    3. Pellizcar la piel con pinzas y cortar una incisión lateral en el abdomen con tijeras quirúrgicas. Mantener la piel firme y luego separarse en direcciones hacia la cabeza y la cola de oposición.
    4. Pellizcar el peritoneo con una pinza y se corta con unas tijeras para exponer la cavidad abdominal.
    5. Retire cuidadosamente la decidua cortando a lo largo de la mesometrio. Transferencia de la decidua diseccionado para pre-calentado en el primer HBSS10 cm2 de placas.
    6. Separar la decidua cortando entre embriones.
    7. Transferencia de un embrión a la segunda placa de 10 cm 2 con HBSS pre-calentado bajo un microscopio de disección. Retirar con cuidado el saco vitelino y el tejido extraembrionario, luego decapitar al embrión.
    8. Una pizca de la pared torácica con unas pinzas y desgarrar el tejido aparte en la línea media, dejando al descubierto la cavidad torácica.
    9. Coloque la pinza detrás del corazón. Agarre el tracto de salida y tire del corazón lejos del embrión. Separar el tracto pulmonar y los pulmones desde el corazón, si todavía unido.
  3. Transferir el corazón a un solo pocillo de la corredera revestido con colágeno y colocarlo lado dorsal hacia abajo (Figura 1B). Repita los pasos 1.2.7-1.3 para cada embrión.
  4. Una vez que todos los corazones se han transferido a pocillos individuales, se incuba el portaobjetos de cámara durante 30 min a 37 ° C, 5% de CO 2 para permitir la suficiente adhesión a la matriz de colágeno.
  5. añadir con cuidado20-50 l de pre-calentado medio de explante alrededor de cada corazón. Importante: No agregue el medio demasiado rápido o a un nivel por encima del corazón, de lo contrario corazones puedan desprenderse del sustrato colágeno.
  6. Cultura los corazones a 37 ° C, 5% de CO 2 durante aproximadamente 24 horas para permitir el crecimiento del epicardio. Nota: excrecencias pueden observarse ya en 3-4 horas de cultivo (Figura 1C) y se compone principalmente de las células mesoteliales que muestran la morfología de adoquines, con un mínimo de contaminación de células mesenquimales (Figuras 1D, E). Los resultados representativos se adquirieron usando un microscopio de disección equipado con una cámara.

2. La ablación genética y la inducción de la EMT en epicárdicos excrecencias

Precaución: Manipular con cuidado los adenovirus de acuerdo con las normas de bioseguridad aprobados.

  1. Preparar 15 ml de medio B (M199 suplementado con 1% de FBS y 1% penicilina / estreptomicina) y pre-calentamiento a 37 ° C en un baño de agua.
  2. Para la escisión defloxed alelos, se preparan explante medio B suplementado con 2,5 x 10 4 pfu / ml de adenovirus que expresan la recombinasa Cre (Ad / CRE) o virus de control.
    Nota: la sobreexpresión mediada por adenovirus de genes candidatos también se puede llevar a cabo para evaluar la ganancia de los fenotipos de función. Los títulos virales deben ser determinados por el usuario final.
  3. Retirar con cuidado los corazones del epicardio empobrecido a partir de cultivos de excrecencia con unas pinzas. corazones de transferencia a tubos de 1,5 ml con 800 l de Trizol y almacenar a -80 ° C para su posterior aislamiento de ARN y el análisis de la expresión génica.
  4. Lavar cada pocillo con DPBS para eliminar el exceso de células de la sangre y restos celulares.
  5. Añadir 500 l explante medio B suplementado con adenovirus (es) a cada cultivo consecuencia y se incuba durante 24 horas a 37 ° C, 5% de CO 2.
  6. Para la inducción de EMT, eliminar el medio y reponer con 37 explante medio B ° C suplementado con factor de crecimiento transformante recombinante (TGF) -β1 [10 ng / ml] o el vehículo (4 mM hácido ydrochloric (HCl) que contiene 1 mg / ml de albúmina de suero bovino (BSA)). Explantes de cultivo durante 24 horas adicionales a 37 ° C, 5% de CO 2. Proceder con el gen / proteína analiza la expresión o inmunocitoquímica como se detalla en los protocolos posteriores.
    Nota: La inducción de EMT epicárdica ha sido estimulado con diversas concentraciones de TGF-β1 que van desde 0,5 ng / ml - 10 ng / ml 26,31-33. Mayores concentraciones de ligando puede dar lugar a la unión no específica a todos los receptores de TGF-β. La concentración de TGF-β1 debe reflejar los objetivos experimentales específicas.

3. Análisis de Expresión Génica del epicardio excrecencias

  1. corazones epicardio-descongelación agotado previamente almacenados en Trizol (2.2).
  2. Aspirar los medios de cultivos de CDEP y se lavan dos veces con DPBS.
  3. Añadir 800 l Trizol temperatura ambiente para explante culturas.
  4. Incubar corazones epicardio-agotado y culturas CDEP en Trizol durante 5 min a temperatu de la habitación re. Pipetear arriba y abajo diez veces para homogeneizar la muestra lisada.
    Nota: Los corazones pueden requerir más de pipeteado para homogeneizar completamente.
  5. Transferir lisados ​​a tubos de 1,5 ml y proceder con el aislamiento de ARN total según las instrucciones del fabricante. Añadir 10 g de glucógeno antes de la precipitación para aumentar el rendimiento de ARN. Un explante dado producirá aproximadamente 0,5 a 1,0 g de ARN.
  6. Eliminar la contaminación de ADN con DNasa I y transcripción inversa 0,5 g de ARNm por las instrucciones del fabricante.
  7. Validar la pureza de los explantes y / o la inducción de EMT con transcripción inversa cuantitativa epicárdicas (QRT) -PCR 34 utilizando SYBR verde y los marcadores descritos en la Tabla 1. Normalizar los niveles de ARNm de gliceraldehído 3-fosfato deshidrogenasa (GAPDH) y calcular la expresión relativa usando el 2 - método ΔΔCt 35. Los resultados típicos se muestran en la Figura 2A.
título "> 4. El análisis de proteínas de epicárdicos excrecencias

  1. Aspirar los medios de cultivos de CDEP y se lavan dos veces con DPBS.
  2. Añadir 10 l de tampón de lisis de proteína enfriado con hielo (Tris 50 mM pH 7,5, cloruro de sodio 150 mM, 1 mM de ácido etilendiaminotetraacético pH 8,0, 1% de Triton X-100, cóctel 1x inhibidor de la proteasa) a cada cámara de bien y colocar la placa de cámara de hielo. Corte aproximadamente ¼ de la parte inferior en una punta de pipeta P200 y utilizar la pieza restante para raspar las células fuera de la corredera. Pipeta hacia arriba y abajo de las células epicárdicas lisan y transferir a un tubo de 1,5 ml.
  3. Sonicar explantes lisadas en baja (160 W) durante 5 min en un baño de agua con hielo con 30 ciclos seg ON y OFF.
  4. lisados ​​Centrifugar durante 10 minutos a 10.000 xg, 4 ° C. Transferir el sobrenadante a un tubo nuevo y determinar la concentración de proteína usando un ensayo de proteína de 36.
    Nota: Un explante dada producirá hasta 1,5 g de proteína total. Hemos encontrado que la puesta en común explantes de dos corazones unad proteínas de carga 2 g por así es suficiente para detectar músculo α-actina liso (ACTA2) y GAPDH 9. La detección de otras proteínas diana puede requerir la puesta en común de múltiples muestras de explantes tal como se determina por el usuario final.

5. La inmunocitoquímica de epicárdicos excrecencias

  1. Retire el medio de cultivos de explantes y se lava dos veces con DPBS.
  2. Añadir con cuidado 500 l de 4% (v / v) de paraformaldehído o metanol enfriado con hielo a cada pocillo y fijar explantes durante 5 min a temperatura ambiente o 10 min a -20 ° C, respectivamente. Fijar acuerdo con las especificaciones de anticuerpos como se recomienda por el fabricante.
  3. Eliminar fijador y enjuagar cada pocillo con DPBS tres veces durante 5 min.
  4. Permeabilizar las células con 500 l de 0,1% (v / v) de Triton X-100 en DPBS para 5 min.
  5. Retire la solución de permeabilización y enjuague con DPBS tres veces durante 5 min.
  6. Bloquear las células con 10% de suero en DPBS durante 30 minutos a temperatu habitaciónre.
  7. Proceder con la tinción de anticuerpos primaria según las recomendaciones del fabricante y las condiciones óptimas según lo determinado por el usuario final.
  8. Retirar la solución de anticuerpo y enjuague con DPBS tres veces durante 5 min.
  9. Aplicar anticuerpo secundario según las instrucciones del fabricante y contratinción con un colorante nuclear adecuado.
  10. Retirar la solución de anticuerpo y enjuague con DPBS tres veces durante 5 min.
  11. Eliminar paredes de la cámara de deslizamiento según las instrucciones del fabricante y añadir medio de montaje acuoso directamente a las células. Colocar un cubreobjetos sobre las células y sellar con esmalte de uñas. Los resultados típicos se muestran en la Figura 2B - 2D usando invertida microscopía de barrido confocal.

6. Ex Vivo Cultura de ensayo (Figura 3A)

  1. Preparativos
    1. Preparar 12 ml ex vivo medio de cultivo utilizando un (1: 1) mezcla de de Eagle modificado por Dulbecco (DMEM): M199 suplementado con 10%FBS y 1% de penicilina / estreptomicina.
    2. En un baño de agua a 37 °, pre-caliente ex vivo medio de cultivo y 100 ml HBSS.
    3. Alícuota de 1 ml de medio precalentado a 8-12 pocillos de una placa de 24 pocillos.
    4. Transferencia pre-calentado HBSS para dos 2 placas de 10 cm, que contiene 50 ml cada una.
  2. Aislar los corazones de embriones de ratón en HBSS (como se describe en el punto 1.2) de madres embarazadas a 12,5 dpc.
  3. Transferir cada corazón a un solo pocillo de la placa de 24 pocillos que contiene medio de cultivo ex vivo. Incubar la placa a 37 ° C, 5% de CO 2 con agitación suave manualmente o utilizando una plataforma oscilante para evitar la adherencia. Inmediatamente continúe en el paso 7.1.

7. Etiquetado epicárdica y EMT Inducción ex vivo culturas

  1. Para etiquetar el epicardio, preparar 12 ml de 37 ° C el medio de cultivo ex vivo suplementado con 3.0 x 10 6 pfu / ml de Ad / GFP. Para la ablación selectiva de alelos floxed, la transferencia de 6 ml de unad / GFP complementado medio de cultivo a un nuevo tubo cónico de 15 ml. Añadir Ad / Cre o controlar adenovirus a una concentración final de 1,5 x 10 6 pfu / ml.
    Nota: ganancia de función Los análisis también se puede llevar a cabo con adenoviral adecuado de administración de genes mediada.
  2. Retirar con cuidado el medio de cultivo de cada pocillo de la placa de 24 pocillos usando una punta de pipeta P1,000.
  3. agregar suavemente medio de cultivo suplementado con adenovirus (es) a cada pocillo.
  4. Incubar la placa a 37 ° C, 5% de CO2 durante 24 horas con agitación suave.
  5. Para la inducción de EMT, preparar 12 ml de 37 ° C ex vivo medio de cultivo que contiene 10 ng / ml de TGF-β1 y 20 ng / ml de factor de crecimiento derivado de plaquetas (PDGF) -BB o vehículo (HCl 4 mM que contenía 1 mg / ml BSA ).
  6. Retirar con cuidado el medio de cultivo de cada pocillo de la placa de 24 pocillos usando una punta de pipeta P1,000. Enjuague suavemente los corazones con 1 ml de DPBS.
  7. Retire las DPBS y reponer los corazones con el cultivo ex vivo yoDium que contiene TGF-β1 y PDGF-BB o vehículo.
  8. Incubar durante 24 horas a 37 ° C, 5% de CO 2 con suave balanceo.

8. La crioconservación y la inmunohistoquímica de cultivos ex vivo

  1. Preparar los corazones para la criopreservación.
    1. Retire el medio de cultivo y se lava dos veces con corazones DPBS enfriado con hielo.
    2. Añadir 1 ml de 4% (v / v) de paraformaldehído a cada corazón y fijar, por 2 horas a 4 ° C con agitación suave.
    3. Retire el fijador y lavar dos veces con DPBS corazones. Transferir los corazones a pozos frescos con 1 ml 10% (w / v) de sacarosa preparado en DPBS. Se incuba la placa durante la noche a 4 ° C con agitación suave.
    4. Transferir cuidadosamente corazones a nuevos pozos con el 18% (w / v) de sacarosa preparado en DPBS. Se incuba la placa durante la noche a 4 ° C con agitación suave.
    5. Transferir cada corazón a una criomolde que contiene medio de congelación de tejido. Inmediatamente congelar bloques usando nitrógeno líquido y se almacena a -80 & #176; C.
  2. Sección corazones a 5 micras utilizando un criostato secciones de tejido y colocar sobre portaobjetos de microscopio con carga positiva. Tienda desliza a -80 ° C hasta su tinción.
  3. Realizar inmunohistoquímica en secciones para la detección de la membrana basal sub-epicárdica.
    1. Descongelar los portaobjetos durante al menos 30 min a temperatura ambiente.
    2. Rehidratar las secciones por lavado dos veces en DPBS durante 5 min con agitación suave.
    3. sección permeabilizar con 0,1% (v / v) de Triton X-100 en PBS durante 5 min a temperatura ambiente.
    4. Lavar los portaobjetos dos veces en DPBS durante 5 minutos con agitación suave.
    5. Seque el exceso de DPBS y definir la región de tinción con una pluma etiquetado hidrófobo. secciones de bloque con 10% de suero en DPBS durante 30 min a temperatura ambiente.
    6. Retire el bloque y aplicar anticuerpo colágeno tipo IV (ColIV, 1: 200) diluido en bloque. Incubar durante la noche a 4 ° C en una cámara de humedad controlada.
    7. Lavar los portaobjetos tres veces en DPBS para5 min con agitación suave.
    8. Diluir anticuerpo fluorescente secundario conjugado (1: 500) y DAPI (1: 5000) en DPBS y se aplican a las diapositivas. Incubar durante 1 hora a temperatura ambiente. Elija un anticuerpo secundario apropiado con una longitud de onda de emisión y excitación distinta de GFP.
    9. Lavar los portaobjetos tres veces en PBS durante 5 min con agitación suave. Monte los portaobjetos con medio de montaje.

9. Imágenes y cuantificación de cultivos ex vivo

  1. Tener una imagen del usuario ciego y cuantificar las secciones teñidas. Imagen por lo menos cinco secciones de tejido no consecutivos de un corazón dada en 4-5 ubicaciones arbitrarias a lo largo del epicardio (borde del corazón) usando un microscopio de fluorescencia confocal o un aumento de 40X. Los resultados típicos se muestran en la Figura 3B usando invertida microscopía de barrido confocal.
  2. contar manualmente el número total de células positivas para GFP en una imagen dada. Identificar la migración EPDC como GFP positive células situadas dentro o fuera de la membrana basal subepicárdico ColIV. Determinar el porcentaje de migración de las células GFP como el número de la migración de células positivas GFP sobre el número total de células GFP positivas en una imagen dada. Los resultados típicos se muestran en la Figura 3C-D utilizando invertida microscopía de barrido confocal.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

El epicardio se puede aislar de manera eficiente el uso de un ensayo de cultivo consecuencia, tomando ventaja de su ubicación exterior y la explotación de la plasticidad de desarrollo y comportamiento migratorio intrínseca de EPDC. Corazones embrionarios murinos son aislados en E11.5 antes de EMT epicárdica y el lado dorsal cultivadas sobre portaobjetos de cámara recubiertos con colágeno 26 (Figura 1A, B). corazones explantados continuarán contrayendo; sin embargo, el epicardio se adhiere a la matriz de colágeno y migrar fuera del miocardio dentro de 24 horas de cultivo (Figura 1C). Células epicárdicas se pueden observar que emana desde el corazón con la morfología de adoquines similar, indicativa de la identidad mesotelial (figuras 1C-E). Después de 24 horas de cultivo, corazones del epicardio empobrecido se retiran para el análisis de expresión de proteína o gen.

Además de observar epithelial morfología, la pureza de los cultivos de células epicárdicas se puede validar aún más por la expresión de marcadores de genes y proteínas restringidas epicárdicas. Explantes de células epicárdicas muestran sólida expresión de marcadores de epicardio y mesoteliales (Aldh1a2, Tcf21, y WT1) y baja expresión de los genes de los cardiomiocitos (NKX2-5 y MYH7) en comparación con los corazones del epicardio empobrecido (Figura 2A). A fin de verificar la identidad, los cultivos de células epicárdicas se fijan 48 horas después de la extracción del corazón y co-teñidas con anticuerpos contra el tumor de Wilms 1 (WT1) y la zona occludens proteína 1 (NPV1) para marcar las células mesoteliales y uniones estrechas intercelulares, respectivamente (37,38 Figura 2B). Este método de cultivo consecuencia produce una pureza relativamente alta de las células mesoteliales; Sin embargo, los usuarios pueden observar un pequeño porcentaje de contaminación de células. Los fibroblastos y células musculares lisas exhiben un fenotipo mesenquimal alargado con una notable ausencia de nuclear WT1 y uniones estrechas organizados (Figura 2C). Solución de problemas de las técnicas para limitar la cantidad de contaminación de células no epicárdica se expanden en la discusión.

El ensayo de explante consecuencia es un sistema de cultivo útil para interrogar biología epicárdica in vitro. Para demostrar plasticidad de las células epicárdicas, los explantes fueron estimuladas con TGF-β1 [10 ng / ml] para inducir la transdiferenciación en células mesenquimales 26,28. Después de 24 h de estimulación, EPDC adoptar un fenotipo mesenquimal con reducida tinción ZO1 y robusto de novo la formación de fibras de músculo liso alfa-actina positivos de estrés (ACTA2 o SMA), en particular en la periferia de la cultura 39 (Figura 2D, rojo). En contraste con subrayar conjunto de fibras en la periferia de los explantes, las células epicárdicas confluentes con contactos intercelulares más definidos (ZO1, verde) en el centro de un monolayeexpresión de la proteína ACTA2 pantalla r en la actina cortical.

Además de someterse a EMT, EPDC invadirá el miocardio y diferenciar, que constituye una proporción sustancial de las poblaciones no cardiomiocitos. La motilidad de EPDC se puede evaluar usando un sistema establecido previamente ex vivo de órganos de cultivo mediante el cual el exterior de corazones E12.5 están etiquetados con un adenovirus que expresa GFP 9,18 (Figura 3A). corazones marcadas se cultivaron adicionalmente durante tres días en presencia de TGF-β1 [10 ng / ml] y PDGF-BB [20 ng / ml] para promover la migración EPDC. Cultivos de órganos se rotan periódicamente para evitar la adhesión de los ex corazones in vivo a la superficie de placas de cultivo. Este sistema permite el etiquetado eficiente de toda el epicardio y la evaluación de la motilidad EPDC en un modelo en tres dimensiones en comparación con la migración direccional con los ensayos de cero en vitro. La migración de las EPDC es observed como la invasión de células GFP positivas en epicárdicos o más allá de la ColIV (rojo) subepicárdica membrana basal 16 (figuras 3B, C). Para ilustrar la utilidad de este sistema, recientemente hemos demostrado que la manipulación del eje de señalización MRTF / SRF puede influir en la motilidad del EPDC 9. Supresión de Mrtfa y Mrtfb mediante escisión mediada por Cre de alelos floxed (MRTFdKO) atenúa la migración de las EPDC en el espacio subepicárdico. Por el contrario, la expresión de MRTF-A (Ad / MRTF-A) en ratones C57BL / 6 hearts resultados en aumento de la migración EPDC y la interrupción de la membrana ColIV sótano (Figuras 3C, D) forzado.

Gene Adelante Marcha atrás adhesión NCBI
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
MYH7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabla 1: Secuencias de cebadores directo e inverso utilizados para la validación de Epicárdicos excrecencia la pureza del cultivo mediante el análisis de epicardio y el miocardio restringido de expresión de genes de expresión génica se determina por el wi QRT-PCR.TH los siguientes parámetros: desnaturalizar a 95 ° C durante 10 s; recocido a 60 ° C durante 30 s; repetir 50x ciclos.

Figura 1
Figura 1: Aislamiento de células primarias epicárdicos Usando un Ensayo de Cultivo excrecencia (A) Una representación esquemática del ensayo de explante consecuencia epicárdico con una línea de tiempo recomendado para la modulación y el análisis epicárdica.. (B - E) Las imágenes de campo claro representativos de diferentes puntos de tiempo durante el ensayo de explante. (B) Embryonic día E11.5 corazones murinos se colocan lado dorsal hacia abajo sobre un sustrato de colágeno. (Células C) epicárdicos (puntas de flecha blancas) comenzarán a migrar fuera del corazón dentro de 3-4 horas de cultivo. Las células sanguíneas (flechas negras) pueden acumularse cerca o cubrir los explantes durante la hipertrofia del epicardio. (D, E) Despuésaproximadamente 24 horas de cultivo, se retiran los corazones y las monocapas epicárdicas permanecen adheridas a la diapositiva cámara. excrecencias celulares muestran la morfología del epitelio con un arreglo de adoquines de vaina de células. Barras de escala = 250 m (BD) o 50 micras (C, E). H = corazón, LA = aurícula izquierda, LV = ventrículo izquierdo, OFT = tracto de salida, RA = aurícula derecha, RV = ventrículo derecho. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Evaluación de la pureza epicárdica crecimiento externo de células (A) de validación de QRT-PCR de marcadores epicárdicas restringida (Tcf21, Aldh1a2, y WT1) en cultivos de excrecencia comparación con la expresión génica miocárdica (Nkx2-5 y MYH7) en E11 epicardio-agotado.. 5 corazones. represen datost la media ± SEM (n = 8 por grupo). Los asteriscos denotan significación estadística utilizando una prueba t de Student con **** p <0,0001. (B) co-tinción de inmunofluorescencia Representante de excrecencias no estimuladas para la expresión del epicardio (WT1, rojo), uniones estrechas intercelulares (NPV1, verde), y los núcleos (DAPI, azul). (C) Un ejemplo de contaminación de células en un cultivo consecuencia. Células epicárdicas (asterisco) se observan a la derecha del panel con la identidad característica mesotelial (WT1 nuclear, rojo) y las uniones estrechas organizados epiteliales (NPV1, verde). Las células adyacentes en el centro (puntas de flecha blanca) presentan una morfología alargada mesenquimales, que se muestra por formación de imágenes de contraste de interferencia diferencial (DIC), con un mínimo de proteína WT1 nuclear y la tinción ZO1 desorganizado. (D) los cultivos de células epicárdicos se estimularon con vehículo (HCl mM 4 en 1 mg / ml BSA) o TGF-β1 [10 ng / ml] para inducir epicárdicaEMT. la estimulación de TGF-β1 promueve la expresión robusta de ACTA2 (rojo) en las regiones corticales de células confluentes en el centro de los explantes o en las fibras de estrés de células que migran en el borde o periferia de la monocapa. adhesiones celulares son etiquetados por NPV1 (verde). Las barras de escala = 25 micras (BD). Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Evaluación Ex Vivo de EPDC Motilidad (a) un calendario esquemático del ensayo de cultivo ex vivo del corazón.. (B) Un representante de la sección 5 micras de un / 6 E12.5 corazón C57BL transducidas con Ad / GFP (verde) durante 24 horas para etiquetar el exterior del corazón. Ex corazones vivo fueron posteriormente cultivadas por un período adicional de 48 horas con TGF β1 [10 ng / ml]y PDGF-BB [20 ng / ml] para estimular la migración EPDC. Las secciones se tiñeron para la co-ColIV (rojo) para etiquetar la membrana basal y los núcleos subepicárdico (DAPI, azul). Ex vivo la morfología de la cultura del corazón se muestra por DIC. LV = ventrículo izquierdo, RV = ventrículo derecho, RA = aurícula derecha. (C, D) Un ejemplo de aplicación de la migración de ensayo ex vivo mediante la modulación del eje regulador MRTF / SRF. Esta cifra ha sido modificado a partir de [9]. Corazones E12.5 fueron aisladas de Mrtfa - / -;. Mrtfb fl / fl embriones y transducidas con Ad / GFP y un virus de control o un adenovirus que expresa la recombinasa Cre durante 24 horas Ex cultivos in vivo fueron entonces estimulados con TGF-β1 [10 ng / ml] y PDGF-BB [20 ng / ml] para una 48 h adicionales. EPDC motilidad (flechas blancas) se observa como la migración de células positivas GFP (verde) en o más allá de la ColIV (rojo). Cre mediada por la supresión de Mrtfb en el <em> Mrtfa - / - de fondo (MRTFdKO) resulta en la atenuación de la migración EPDC comparación con el control corazones. Por el contrario, la expresión de MRTF-A (Ad / MRTF-A) forzado en E12.5 C57BL / 6 corazones aumenta la migración de EPDC. (D) La cuantificación de la migración de células GFP positivas%. Los datos se presentan como la media ± SEM (n = 4 corazones para cada condición). Los datos se analizaron mediante un ANOVA de una vía con asteriscos denotan significación estadística de las pruebas post-hoc de Tukey con **** p <0,0001. Barras de escala = 200 m (B) o 25 mm (C). Todas las imágenes fueron adquiridas mediante invertida microscopía de escaneo láser confocal. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

A continuación describimos los métodos detallados para aislar células del epicardio primaria por derivación y seguimiento de la migración de EPDC en cultivos ex vivo del corazón. Para los cultivos de excrecencia, el momento adecuado para retirar el corazón epicardio-agotado varía ligeramente entre los experimentos. Se recomienda la monitorización periódica de los explantes después de una noche de incubación para medir el grado de derivación epicárdica y extraer el corazón antes de que aparezcan los fibroblastos. Para asegurar la pureza, corazones deben ser retirados dentro de 24 h de explantación para evitar la acumulación de los linajes no epicárdicas. El recorte de distancia del tracto de salida y las dos aurículas antes de transferir el corazón a un portaobjetos de cámara también puede reducir contaminantes tipos de células 27,40. Desde el corazón fetal se aíslan de una camada ratón durante una estrecha ventana de tiempo y se cultivaron en las mismas condiciones, el tiempo para que aparezcan excrecencias es relativamente similar de un corazón a otro dentro de un experimento. Por lo tanto, todos los corazones deben be quita cuando la mayoría de los explantes presenta excrecencias epicárdicas. En algunos casos, las células epicárdicas no migran a cabo de manera eficiente desde un corazón que se contrae con más fuerza que las otras, en cuyo caso este explante debe ser excluido de la prueba.

La acumulación de células de la sangre a menudo puede ocultar una monocapa plana de las células epicárdicas (flechas, Figura 1C), por lo que es difícil visualizar excrecencias. Para evitar contribución excesiva de células de la sangre, los corazones pueden permanecer en HBSS durante unos minutos sobre la disección del embrión. Esto da tiempo suficiente para que el corazón del feto para bombear la sangre residual en las cámaras del corazón antes de ser trasladado a una diapositiva de cámara. Como alternativa, que complementa los cultivos con medio explante A después de la primera incubación durante la noche le ayudará en la expulsión de algún exceso de sangre y revelar excrecencias; sin embargo, el nivel de los medios de comunicación no debe elevarse por encima del corazón como la tensión superficial se puede hacer que el corazóna separarse de sustrato. se observan crecimientos robustos epicárdicas usando colágeno tipo I como el sustrato de cultivo; sin embargo, se ha informado de otros sustratos dependiendo del organismo y / o aplicación 27,40-42. El uso de este protocolo, las células epicárdicas fetales primarias pueden prosperar durante 4 días después de la extracción del corazón y la reposición diaria media; Sin embargo, los diseños experimentales que requieren períodos de cultivo más largos deben ser determinados por el usuario final. Desde EMT epicárdica es fuertemente activa durante el desarrollo embrionario, esta técnica de cultivo consecuencia se limita a la enriquecimiento de células epicárdicas fetales. Otros grupos han descrito métodos para aislar células epicárdicas adultos 43,44.

Para los ensayos de migración ex vivo, la extracción del corazón y de etiquetado de células epicárdicos se recomiendan en E12.5 por dos razones. En primer lugar, los corazones aislados después de E12.5 son más grandes y por lo tanto requieren más de perfusión para apoyar la viabilidad. La simple difusión de nutrientess no es suficiente para mantener cultivos de órganos de los corazones grandes. En segundo lugar, la EMT epicárdica y la migración EPDC se producen alrededor de E12.5. Por lo tanto, el epicardio debe ser etiquetado con un adenovirus que expresa una proteína fluorescente inmediatamente después de la extracción del corazón para maximizar la detección de EPDC. Alternativamente, éster de succinimidilo diacetato de carboxifluoresceína (CFSE) se ha informado anteriormente para etiquetar el exterior del corazón y rastrear la migración EPDC 10,45.

En contraste con los ensayos de desarrollo, ex vivo culturas deben sacudieron periódicamente para evitar la unión del corazón y el crecimiento de células del epicardio. Los cultivos también podrían ser agitadas continuamente en una incubadora equipado con una mecedora en la velocidad más baja. Los usuarios notarán cambios en la morfología cardiaca dentro de unos pocos días de cultivo de órganos y deben evitar el análisis más allá de las 72 horas de aislamiento corazón. Utilizando este ensayo, se observa invasión EPDC dentro de 48 a 72 horas de cultivo. Si bien el sistema Cre-loxPse ha utilizado in vivo para mapear la localización de EPDC a la vasculatura coronaria, el intersticio miocardio, y el tabique interventricular 7,22, esta técnica ex vivo se limita a la migración EPDC dentro de unas pocas capas de células del espacio sub-epicárdica. Por lo tanto, este método es más adecuado para la determinación de los reguladores de EPDC motilidad y la invasión en lugar de definir el destino final de la migración de EPDC.

Aislamientos de células epicárdicas y ex vivo ensayos de migración, en combinación con la ganancia o pérdida de función de los enfoques, ya han demostrado su utilidad para la evaluación de genes candidatos que podrían afectar la biología EPDC 9,18,46. Estos métodos también proporcionan una plataforma para la ganancia de la función o las pantallas de la pérdida de la función de identificar nuevos reguladores de la migración EPDC. Esta estrategia, en conjunto con la clasificación de células activadas por fluorescencia o ARN de una sola célula-secuenciación, también puede proporcionar una oportunidad para investigar la heterogeneidad del epicardioy la diferenciación EPDC en mayor detalle. Finalmente, las modificaciones de estos procedimientos se podrían utilizar para desarrollar pantallas para las pequeñas moléculas que afectan a las células epicárdicas y biología EPDC para el propósito de la medicina regenerativa cardiaca.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgements

EMS fue apoyado por becas de los Institutos Nacionales de Salud (NIH) [número de concesión R01HL120919]; el [número de concesión 10SDG4350046] Asociación Americana del Corazón; Universidad de Rochester premio CTSA del NIH [número de concesión UL1 TR000042]; y los fondos de arranque en el Aab CVRI. MAT fue apoyado en parte por una subvención a la Universidad de Rochester Facultad de Medicina y Odontología de la Med-En-Grad Iniciativa Instituto Médico Howard Hughes; y un Premio al Servicio Nacional de Investigación Institucional Ruth L. Kirschstein de los NIH [número de concesión GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics