Epicardial תולדת תרבות Assay ו

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

שכבה יחידה של קווי תאי epicardial בלב, מתן גורמי paracrine מעודדי התפשטות cardiomyocyte וישירות תורם אבות לב וכלי דם במהלך התפתחות ומחלות. בעוד מספר גורמים היו מעורבים בגיוס epicardium תאים שמקורם (EPDC), המנגנונים השולטים הגירה והבחנה הבאים שלהם הם הבינו היטב. כאן, אנו מציגים במבחנה לשעבר אסטרטגיות vivo ללמוד EPDC תנועתיות והבחנה. ראשית, אנו מתארים שיטה של ​​קבלת תאי epicardial ראשוניים על ידי תרבות תולדה מלב העכבר העוברי. כמו כן, אנו מציגים פרוטוקול מפורט על מנת להעריך הגירה תלת ממדית של EPDC מתויג מערכת התרבות איברים. אנו מספקים ראיות באמצעות טכניקות אלה כי מחיקה גנטית של גורמי תעתוק הקשורות myocardin ב epicardium פוחתת גירת EPDC. גישה זו משמשת כפלטפורמה להעריך מכפילי מועמד של EPDCביולוגיה יכולה לשמש לפיתוח מסך גנטי או כימי לזהות רגולטורי רומן של גיוס EPDC שעשויה להיות שימושי עבור תיקון לב.

Introduction

Epicardium היא שכבה אחת של תאי mesothelial המרפדת את הלב ואת השפעות לב פיתוח, התבגרות ותיקון. באמצעות חילופי מתואם מאוד של אותות paracrine, הדיאלוג האינטימי בין שריר הלב ואת epicardium הוא הכרחי לצמיחת לב ויצירת שושלות לב הלא myocyte 1. Epicardial שמקורם בתאים (EPDC) עולים מתוך תת קבוצה של תאי epicardial דרך אפיתל-to-mesenchymal מעבר (EMT) 2, לפלוש למרחב subepicardial ואת שריר לב בסיסי, ולבדל בעיקר לתאי ציור קיר כלי דם הכליליים פיברובלסטים לב, וכדי ובמידה פחותה, תאי cardiomyocytes אנדותל 3-9.

המנגנונים המסדירים EMT epicardial ופלישת EPDC יוחסו הפעולה המתואמת של מולקולות שונות, כוללים ליגנדים מופרש 10-13, קולטנים בתא שטח ואת מולקולות דבקות 14,15, regulators קוטביות פסגה-basal 16,17, GTPases הקטן 18,19, ו שעתוק גורמי 2,20,21. בעוד רבים של effectors המולקולרי של הגירה EPDC הוגדרו, הבנה טובה יותר של אותות פיזיולוגיים המעודדים גיוס EPDC בעובר עשוי להאיץ את הפיתוח של אסטרטגיות כדי לתפעל את התהליך הזה אצל המבוגר לתיקון הלב משופרת.

מחקרים שמטרתו לאתר רגולטורי רומן של גיוס EPDC להסתמך על טיהור של אוכלוסיית תא זה או התחקות נדידת תאי epicardial פרט. אחת או שילוב של גני סמן, כולל Wt1, Tcf21, Tbx18, ו / או Aldh1a2, משמש בדרך כלל כדי לזהות את epicardium העוברית 1. עם זאת, השימוש של סמנים אלה כדי לעקוב אחר נודדות EPDC אינו אופטימלי כמו ביטוי של סמנים epicardial דועכת במהלך התפתחות הלב הולך לאיבוד לעתים קרובות כאשר תאים epicardial לעבור transdifferentiation לתאי mesenchymal.

היישום של מערכת Cre / loxP, בשיתוף עם כתבי התחקות שושלת, כבר שימושי תיוג epicardium לצמיתות וצאצאיו במהלך התפתחות לב בעקבות פציעה איסכמית המבוגר 7,22,23. כמה מוגבל epicardial קווי Cre נוצרו נמצאים בשימוש נרחב לתייג EPDC ועבור 1 אסטרטגיות מחיקת גן מותנה. מחקרים אלה הובילו את האפיון של שושלות שונות epicardial, ואת ההזדהות של מתווכים קריטיים של תנועתיות והבחנת EPDC. עם זאת, הראיות המצטברות גם מרמז על epicardium אוכלוסייה הטרוגנית של ובתאים 4,24,25. לפיכך, רק קבוצת משנה של תאי epicardial יהיה ממוקד באמצעות נהג Cre נתון.

על מנת לתייג את epicardium כולו ללא קשר סגולי Cre, מספר המעבדות נצל מבוי סתום תולדהמערכות ture או לשעבר שיטות תרבות איבר vivo לבודדות בנאמנות או תווית תאי epicardial בלי תלוי הביטוי של שושלת גנטית סמני 26-28. עבור מחקרים הגירה vivo לשעבר, לבבות עובריים מבודדים לפני EMT epicardial ו בתרבית בינוני בתוספת חלבון פלואורסצנטי ירוק (GFP) -expressing אדנו (Ad / GFP) 9,18. גישה זו מאפשרת תיוג יעיל של epicardium כולו ולא משנה של תאים על ידי רקומבינציה בתיווך Cre. תרבויות לב ובהמשך נחשפות מעוררים ידוע של EMT כדי לעורר את הגיוס של EPDC 28,29. Ex vivo ו vivo ניתוחים משלימים במבחנת תרבויות explant epicardial, אשר הן גישה יעילה במיוחד עבור חקר מנגנונים מפורטים נהיגת הגירת EPDC.

כאן אנו מתארים שיטות לבודדות תאי epicardial עיקריים לבדיקות במבחנה של epicardiאל EMT, כמו גם מערכת תרבות איבר עבור vivo לשעבר מנתח של תנועתיות EPDC. אנחנו הוכיחו לאחרונה השירות וחוסנם של שיטה זו על ידי גנטית ויסות גורם שעתוק הקשורה myocardin (MRTF) / גורם בתגובה בסרום (SRF) איתות ציר לתמרן הגירה המבוססת על אקטין של EPDC 9. בעוד ממצאינו להדגיש את אחד מסלולי איתות הכרחיים להסדרת הגירת EPDC, שיטות אלה מתאימים לפרום את המנגנונים קולקטיביים לתזמר הגירה והבחנת EPDC. יתר על כן, explant לשעבר מערכות תרבות vivo יכולים להיות מיושמים מסך פונקציונלי לזהות רגולטורי רומן של גיוס EPDC ליישומים טיפוליים התחדשות לב.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

הערה: כל ניסויים עם עכברים אושרו על ידי הוועדה הכלל אוניברסיטאית על משאבים בעלי חיים באוניברסיטת רוצ'סטר.

1. Assay תרבות Epicardial תולדה (איור 1 א)

  1. תכשירים
    1. הכן 5 מ"ל מדיום בידוד תא epicardial העיקרי על ידי משלים בינוני 199 (M199) עם 5% בסרום שור עוברית (FBS) ו -1% פניצילין / סטרפטומיצין (עט / סטרפטוקוקוס).
    2. טרום חמים בינוני A ו- 100 מ"ל תמיסת מלח מאוזן "הנקס (HBSS) באמבט מים 37 מעלות צלזיוס.
    3. אפשר שקופיות קאמרית מצופה קולגן כדי לחמם לטמפרטורת החדר למשך 30 דקות.
    4. הוספת בינוני 100 μl היטב בכל השקופית קאמרית בעדינות לסובב כדי מעיל באופן שווה על פני השטח קולגן. חזור על 8-12 בארות. הסר התקשורת לאחר לתאי הציפוי.
    5. Aliquot מחומם מראש HBSS לשתי 10 ס"מ 2 צלחות המכילות 50 מ"ל כל אחד HBSS.
  2. לבודד עוברי לבבות מן הסכר בהריון 11.5 ימי ההודעה Coitum (DPC).30
    1. להרדים העכבר עם 0.5 מ"ל של 13 מ"ג / מ"ל ​​קטמין / 0.88 מ"ג / קוקטייל xylazine מ"ל ב פוספט שנאגרו מלוחים של 1x Dulbecco (DPBS) באמצעות זריקה intraperitoneal. אשר הרדמה נכונה באמצעות מבחן קמצוץ בוהן. קורט עדין מספיק כדי לקבוע אם העכבר הוא מגיב. כל תנועה או כף לסגת ציין החיה אינה מורדמת מספיק לעשות ניתוח. להרדים ידי נקע בצוואר הרחם.
    2. הנח את העכבר מול גחון כלפי מעלה ולרסס את הבטן עם אתנול 70% כדי להפחית את הזיהום על ידי שיער.
    3. לצבוט את העור עם מלקחיים ולחתוך חתך לרוחב הבטן עם מספריים כירורגיות. מתח את העור בחוזקה ולאחר מכן לפרק בכיוונים מנוגדים לכיוון הראש והזנב.
    4. לצבוט את הצפק עם מלקחיים לגזור במספריים כדי לחשוף את חלל הבטן.
    5. מוציאים בזהירות את decidua ידי חיתוך לאורך mesometrium. מעבירים את decidua גזור מראש חימם HBSS ב הראשון10 ס"מ 2 צלחת.
    6. הפרד את decidua ידי חיתוך בין העוברים.
    7. העבר עובר לצלחת 10 ס"מ 2 השני עם HBSS מחומם מראש תחת מיקרוסקופ לנתח. מוציאים בזהירות את שק רקמות חלמון extraembryonic, ואז לערוף את העובר.
    8. לצבוט את קיר בית החזה עם מלקחיים לקרוע את הרקמה בנפרד על קו האמצע, חשיפת חלל החזה.
    9. מניח את המלקחיים מאחורי הלב. אחוז בדרכי היצוא ולמשוך את הלב הרחק עובר. הפרד את דרך ריאתי מהלב לריאות, אם עדיין מחובר.
  3. מעבירים את הלב אל באר יחיד של השקופית מצופה קולגן ולמקם אותו בצד הגב למטה (איור 1B). חזרו על שלבי 1.2.7-1.3 עבור כל עובר.
  4. ברגע שכל הלבבות הועברו בארות בודדות, דגירת השקופיות הקאמריות במשך 30 דקות ב 37 מעלות צלזיוס, 5% CO 2 כדי לאפשר עמידים מספיק כדי מטריצת קולגן.
  5. בזהירות להוסיף20-50 μl של מדיום explant מחומם מראש סביב כל לב. חשוב: אל תוסיף מדיום מהר מדי או לרמה מעל הלב, אחרת לבבות יכולים לנתק מן מצע קולגן.
  6. תרבות בליבם על 37 מעלות צלזיוס, 5% CO 2 למשך כ 24 שעות כדי לאפשר תוצאה epicardial. הערה: ניתן להבחין בצמחים מוקדם ככל 3-4 שעות של התרבות (התרשים 1C) ובעיקר מכילים תאי mesothelial מוצגים מורפולוגיה מרוצפת, עם (1D הדמוי, E) זיהום תא mesenchymal המינימאלי. נציג תוצאות נרכשו באמצעות מיקרוסקופ לנתיחה מצויד במצלמת.

אבלציה גנטי 2. אינדוקציה של EMT ב Epicardial בצמחים

זהירות: טפל adenoviruses בזהירות על פי הנחיות בטיחות ביולוגית שאושרה.

  1. הכן 15 מ"ל ב בינוני (M199 בתוספת FBS 1% לבין 1% פן / סטרפטוקוקוס) וטרום-חמים 37 מעלות צלזיוס באמבט מים.
  2. עבור כריתה שלאללים floxed, להכין B בינוני explant השלימו עם 2.5 x 10 4 pfu / מ"ל של אדנו להביע Cre recombinase (Ad / Cre) או וירוס שליטה.
    הערה: ביטוי יתר בתיווך adenoviral של גני מועמדים יכול גם להתבצע כדי להעריך רווח של פנוטיפים פונקציה. titers ויראלי צריך להיקבע על ידי משתמש הקצה.
  3. מוציאים בזהירות לבבות מדולדל epicardium מתרבויות תולדה באמצעות מלקחיים. העברת לבבות צינורות 1.5 מ"ל עם 800 μl Trizol ולאחסן ב -80 ° C עבור בידוד RNA מאוחר יותר ניתוח ביטוי גנים.
  4. לשטוף היטב עם כל DPBS להסיר תאי דם ופסולת הסלולר עודף.
  5. הוסף 500 μl B הבינוני explant השלים עם אדנו (es) לכל תרבות תולדת דגירה במשך 24 שעות ב 37 מעלות צלזיוס, 5% CO 2.
  6. לזירוז EMT, להסיר תקשורת ומלא עם 37 מעלות צלזיוס explant הבינוני B בתוספת גורם גדילה ששינה את מציאות רקומביננטי (TGF) -β1 [10 ng / ml] או רכב (4 מ"מ hחומצה ydrochloric (HCl) המכיל 1 מ"ג / מ"ל ​​אלבומין בסרום שור (BSA)). Explants תרבות עבור 24 שעות נוספות על 37 מעלות צלזיוס, 5% CO 2. המשך עם גן / חלבון ביטוי מנתח או immunocytochemistry כמפורט בפרוטוקולים הבאים.
    הערה: אינדוקציה של EMT epicardial כבר מגורה עם ריכוזים שונים של TGF-β1 הנעים בין 0.5 ng / ml - 10 ng / ml 26,31-33. ריכוזים גבוהים יותר של ליגנד עלולים לגרום ספציפיים שאינם מחייבים לכל קולטני TGF-β. ריכוז TGF-β1 צריך לשקף את מטרות הניסוי הספציפי.

3. ג'ין ניתוח ביטוי של Epicardial בצמחים

  1. epicardium מדולדל להפשיר לבבות נשמרו קודם Trizol (2.2).
  2. התקשורת לשאוב מתרבויות EPDC ולשטוף פעמיים עם DPBS.
  3. להוסיף 800 Trizol בטמפרטורת החדר μl כדי explant תרבויות.
  4. דגירה לבבות מדולדל epicardium ותרבויות EPDC ב Trizol במשך 5 דקות ב חדר טמפרטורות מִחָדָשׁ. פיפטה למעלה ולמטה עשר פעמים כדי homogenize המדגם lysed.
    הערה: לבבות עשויים לדרוש pipetting נוספת homogenize לחלוטין.
  5. העבר lysates 1.5 מ"ל צינורות והמשך עם בידוד RNA הכולל לפי הוראות היצרן. הוסף 10 מיקרוגרם הגליקוגן לפני ממטרים כדי להגדיל את התשואה RNA. Explant נתון יניב כ 0.5-1.0 מיקרוגרם RNA.
  6. הסר DNA לזהם עם DNase אני הפוכה לתמלל 0.5 מיקרוגרם mRNA לפי הוראות היצרן.
  7. אמת את הטוהר של explants epicardial ו / או אינדוקציה של EMT עם שעתוק לאחור כמותית (qRT) -PCR 34 באמצעות SYBR ירוק סמנים המתואר בטבלה 1. רמות ה- mRNA לנרמל dehydrogenase 3-פוספט glyceraldehyde (GAPDH) ולחשב הביטוי היחסי באמצעות 2 - שיטת ΔΔCt 35. תוצאות אופייניות מוצגות באיור 2A.
הכותרת "> 4. ניתוח חלבון של Epicardial בצמחים

  1. התקשורת לשאוב מתרבויות EPDC ולשטוף פעמיים עם DPBS.
  2. הוסף 10 חיץ תמוגה חלבון μl קרים כקרח (50 מ"מ טריס 7.5 pH, 150 נתרן כלורי מ"מ, 1 מ"מ pH חומצה ethylenediaminetetraacetic 8.0, 1% Triton X-100, מעכבי פרוטאז קוקטייל 1x) לכל תא היטב במקום להחליק קאמרית על קֶרַח. חותכים כ ¼ של התחתון שלה על קצה פיפטה P200 ולהשתמש חתיכת הנותרים כדי לגרד את התאים את השקופית. עד פיפטה ולמטה לתאים epicardial lyse ו והעברת צינור 1.5 מ"ל.
  3. Sonicate explants lysed על נמוך (160 W) במשך 5 דקות באמבט מי קרח עם 30 מחזורים שניים לסירוגין.
  4. lysates צנטריפוגה במשך 10 דקות ב 10,000 XG, 4 ° C. העברת supernatant לצינור טרי ולקבוע את ריכוז החלבון באמצעות assay חלבון 36.
    הערה: explant נתון יניב עד 1.5 מיקרוגרם חלבון כולל. מצאנו כי explants איגום משני לבבותד טעינה 2 מיקרוגרם חלבון לכל טוב מספיק כדי לזהות שריר חלק α יקטין (ACTA2) ו GAPDH 9. זיהוי של חלבוני יעד אחרים עשוי לדרוש איגום דגימות מרובות explant כפי שנקבע על ידי משתמש הקצה.

5. Immunocytochemistry של Epicardial בצמחים

  1. הסר מדיה מתרבויות explant ולשטוף פעמיים עם DPBS.
  2. בעדינות להוסיף 500 μl של 4% (v / v) paraformaldehyde או מתנול קר כקרח היטב כל ולתקן explants במשך 5 דקות בטמפרטורת החדר או 10 דקות ב -20 מעלות צלסיוס, בהתאמה. תקן על פי מפרט נוגדן כפי המומלץ על ידי היצרן.
  3. הסר מקבע ולשטוף היטב עם כל שלוש DPBS פעמים במשך 5 דקות.
  4. Permeabilize את התאים עם 500 μl של 0.1% (v / v) טריטון X-100 ב DPBS למשך 5 דקות.
  5. הסר פתרון permeabilization ולשטוף עם שלושה DPBS פעמים במשך 5 דקות.
  6. חסום את התאים עם סרום 10% ב DPBS למשך 30 דקות ב חדר טמפרטורותמִחָדָשׁ.
  7. המשך עם מכתים נוגדן ראשוני לכל המלצות היצרן ו תנאים אופטימליים כפי שנקבע על ידי משתמש הקצה.
  8. הסר פתרון נוגדן ולשטוף עם שלושה DPBS פעמים במשך 5 דקות.
  9. החל נוגדנים משני לפי הוראות יצרן ו counterstain עם צבע גרעיני מתאים.
  10. הסר פתרון נוגדן ולשטוף עם שלושה DPBS פעמים במשך 5 דקות.
  11. הסר קירות שקופיות קאמריות לפי הוראות היצרן ולהוסיף בינוני הרכבה מימי ישירות אל התאים. מניחים coverslip על התאים לאטום עם לק. תוצאות אופייניות מוצגות באיור 2B - 2D באמצעות מיקרוסקופיית confocal הפוכה.

6. Assay אקס תרבות Vivo (איור 3 א)

  1. תכשירים
    1. כן 12 מיליליטר לשעבר vivo בינוני תרבות באמצעות (1: 1) תערובת של בינוני הנשר השונה של Dulbecco (DMEM): M199 בתוספת 10%FBS ו 1% פן / סטרפטוקוקוס.
    2. באמבט מים 37 מעלות צלזיוס, טרום חם vivo לשעבר בינוני תרבות 100 מ"ל HBSS.
    3. Aliquot 1 מ"ל בינוני מחומם מראש לתוך 8-12 בארות צלחת 24 היטב.
    4. העברת מחומם מראש HBSS לשני 10 ס"מ 2 צלחות, המכיל 50 מ"ל כל אחד.
  2. לבודד לבבות העכבר עובריים HBSS (כמתואר 1.2) מ סכרים בהריון 12.5 DPC.
  3. העברת כל הלב אל באר יחיד של 24 את הצלחת היטב המכיל בינוני תרבות vivo לשעבר. דגירה את הצלחת על 37 מעלות צלזיוס, 5% CO 2 עם נדנדה עדין ידני או באמצעות פלטפורמת נדנדה כדי למנוע הדבקות. מיד להמשיך לשלב 7.1.

7. תיוג Epicardial ואינדוקציה EMT בתרבויות Ex Vivo

  1. כדי לתייג את epicardium, להכין 12 מ"ל של 37 ° C לשעבר בינוני תרבות vivo השלימו עם 3.0 x 10 6 pfu / מ"ל של מודעות / GFP. עבור אבלציה ממוקד של אללים floxed, העברת 6 מ"ל שלד / GFP בתוספת בינוני תרבות צינור חרוטי 15 מ"ל חדש. הוסף מודעה / Cre או לשלוט אדנו לריכוז סופי של 1.5 x 10 6 pfu / ml.
    הערה: רווח של פונקציה ניתוחית יכול גם להתבצע עם למסירת גן בתיווך adenoviral המתאים.
  2. מוציאים בזהירות את המדיום תרבות מבאר כל 24 את הצלחת היטב באמצעות קצה פיפטה P1,000.
  3. בעדינות להוסיף בינוני תרבות בתוספת אדנו (es) זה טוב.
  4. דגירה את הצלחת על 37 מעלות צלזיוס, 5% CO 2 למשך 24 שעות עם נדנדה עדינה.
  5. לזירוז EMT, להכין 12 מ"ל של 37 ° C לשעבר בינוני תרבות vivo המכיל 10 ng / ml TGF-β1 ו -20 ng / ml גורם הגדילה הנגזרות טסיות (PDGF) -BB או רכב (4 מ"מ HCl המכיל 1 מ"ג / מ"ל BSA ).
  6. מוציאים בזהירות בינוני תרבות מבאר כל 24 את הצלחת היטב באמצעות קצה פיפטה P1,000. לשטוף בעדינות את לבבות עם 1 מ"ל DPBS.
  7. הסר את DPBS ומלא לבבות עם תרבות vivo לשעבר ליdium המכיל TGF-β1 ו PDGF-BB או הרכב.
  8. דגירה של 24 שעות ב 37 מעלות צלזיוס, 5% CO 2 עם נדנדה עדינה.

Cryopreservation 8. אימונוהיסטוכימיה של תרבויות Ex Vivo

  1. הכן את הלבבות עבור Cryopreservation.
    1. הסר בינוני תרבות לשטוף לבבות פעמיים עם DPBS קר כקרח.
    2. הוסף 1 מ"ל של 4% (v / v) paraformaldehyde לכל לב ולתקן עבור שעה 2 ב 4 ° C עם נדנדה עדין.
    3. הסר מקבע ולשטוף לבבות פעמיים עם DPBS. מעבירים את הלבבות לבארות טרי עם 1 מ"ל 10% (w / v) סוכרוז ערוכים DPBS. דגירה את צלחת הלילה ב 4 ° C. עם נדנדה עדינה.
    4. להעביר בזהירות לבבות בארות חדשות עם 18% (w / v) סוכרוז ערוכים DPBS. דגירה את צלחת הלילה ב 4 ° C. עם נדנדה עדינה.
    5. העבר כל לב על cryomold המכיל בינוני הקפאת רקמות. מיד להקפיא בלוקים באמצעות חנקן נוזלי ולאחסן ב -80 & #176; ג.
  2. לבבות סעיף ב 5 מיקרומטר באמצעות קטעי רקמה cryostat ומניחים על שקופיות מיקרוסקופ בעלי מטען חשמלי חיובי. חנות שקופיות ב -80 ° C עד מכתים.
  3. בצע אימונוהיסטוכימיה על חלקים לגילוי של קרום במרתף תת-epicardial.
    1. להפשיר שקופיות למשך 30 דקות לפחות בטמפרטורת החדר.
    2. רעננותם הסעיפים ידי שטיפת פעמי DPBS במשך 5 דקות עם נדנדה עדינה.
    3. סעיף Permeabilize עם 0.1% (v / v) טריטון X-100 ב PBS במשך 5 דקות בטמפרטורת החדר.
    4. שטוף את השקופיות פעמים ב DPBS במשך 5 דקות עם נדנדה עדינה.
    5. כתם את DPBS העודף ולהגדיר באזור המכתים עם עט תיוג הידרופובי. סעיפים בלוק עם סרום 10% ב DPBS למשך 30 דקות בטמפרטורת החדר.
    6. הסר בלוק ולהחיל נוגדנים מסוג IV קולגן (ColIV, 1: 200) מדולל בבלוק. דגירת הלילה ב 4 מעלות צלזיוס בתא לחות מבוקרת.
    7. שטפו את השקופיות שלוש פעמים DPBS עבור5 דקות עם נדנדה עדינה.
    8. לדלל נוגדנים משני מצומדות fluorescently (1: 500) ו DAPI (1: 5,000) ב DPBS ולהחיל על השקופיות. דגירה עבור שעה 1 בטמפרטורת החדר. בחר נוגדנים משני מתאימים עם אורך גל פליטת עירור נבדל GFP.
    9. שטוף את השקופיות שלוש פעמים PBS במשך 5 דקות עם נדנדה עדינה. הר שקופיות עם הרכבה בינונית.

9. הדמיה וכימות של תרבויות Ex Vivo

  1. שיהיה לך תמונת משתמש עיוורת ולכמת סעיפים מוכתמים. תמונה לפחות חמש סעיפי רקמות לא רצוף מתוך לב נתון 4-5 מקומות שרירותיים לאורך epicardium (בקצה הלב) באמצעות מיקרוסקופ פלואורסצנטי או confocal בהגדלה 40X. תוצאות אופייניות מוצגות איור 3B באמצעות מיקרוסקופיית confocal הפוכה.
  2. באופן ידני לספור את המספר הכולל של תאים חיוביים GFP בתמונה נתונה. זהה נודדות EPDC כמו GFP poתאי sitive הממוקמים בתוך או מעבר קרום subepicardial במרתף ColIV. לקבוע את אחוז GFP תאים נודד כמספר נודדות GFP תאים חיוביים על המספר הכולל של תאים חיוביים GFP בתמונה נתונה. תוצאות אופייניות מוצגות באיור 3C-D באמצעות מיקרוסקופיית confocal הפוכה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Epicardium ניתן לבודד ביעילות באמצעות assay תרבות תולדה ידי ניצול מיקומה החיצוני וניצול פלסטיות התפתחותית התנהגות נדידה פנימית של EPDC. לבבות עובריים Murine מבודדים ב E11.5 לפני EMT epicardial ואת הצד הגבי תרבותי למטה בשקופיות קאמרית מצופה קולגן 26 (איור 1 א ', ב'). לבבות explanted ימשיכו להתכווץ; עם זאת, epicardium תדבק מטריקס קולגן ולהעביר מן שריר הלב תוך 24 שעות של תרבות (איור 1 ג). תאי Epicardial ניתן לצפות בוקע מן הלב עם מורפולוגיה מרוצפת דמוית, מגדירי זהות mesothelial (דמויות 1C-E). לאחר 24 שעות של תרבות, לבבות מדולדלים epicardium יוסרו עבור ניתוח ביטוי גנים או חלבונים.

בנוסף התבוננות epitheliמורפולוגיה אל, טוהר בתרביות תאים epicardial ניתן תוקף עוד יותר על ידי ביטוי של סמנים גן וחלבון מוגבל epicardial. Explants תא Epicardial להציג ביטוי חזק של סמנים epicardial ו mesothelial (Aldh1a2, Tcf21, ו Wt1) וביטוי נמוך של גנים cardiomyocyte (Nkx2-5 ו Myh7) לעומת לבבות מדולדל epicardium (איור 2 א). כדי להמשיך לאמת את זהותו, תרביות תאי epicardial שתוקנו 48 שעות לאחר הסרת לב ושיתוף מוכתם נוגדנים כנגד הגידול של וילם 1 (WT1) ו Zona occludens חלבון 1 (ZO1) לתייג תאי mesothelial וצומת חזקים אינטר, בהתאמה 37,38 ( איור 2B). שיטת תרבות תולדה זה מניב טוהר גבוהה יחסית של תאי mesothelial; עם זאת, משתמשים יכולים לצפות אחוז קטן של זיהום תא. פיברובלסטים ותאי שריר חלק תערוכה פנוטיפ mesenchymal מוארך עם היעדרות בולטת של nuclear WT1 וצומת חזקים מאורגנים (איור 2 ג). פתרון בעיות טכניקות כדי להגביל את כמות זיהום תאים שאינן epicardial מורחבת בדיון.

את assay תולדת explant הוא מערכת תרבות שימושית חוקר ביולוגית epicardial במבחנה. כדי להדגים פלסטיות תא epicardial, explants היו מגורה עם-β1 TGF [10 ng / ml] להשרות transdifferentiation לתאי mesenchymal 26,28. לאחר 24 שעות של גירוי, EPDC לאמץ פנוטיפ mesenchymal עם מכתים ZO1 מופחת היווצרות חזקה דה נובו של סיבי מתח החיוביים α יקטין שריר חלק (ACTA2 או SMA), במיוחד בפריפריה של התרבות 39 (2D איור, אדום). בניגוד להדגיש הרכבת סיבים בשולי explants, תאי epicardial ומחוברים עם אנשי קשר אינטר מוגדרים יותר (ZO1, ירוק) במרכז של monolayer תצוגת ביטוי ACTA2 חלבון יקטין קליפת המוח.

בנוסף עובר EMT, EPDC יפלוש שריר הלב ולבדל, המהווים חלק ניכר של אוכלוסיות שאינן cardiomyocyte. תנועתיות של EPDC ניתן להעריך באמצעות מערכת התרבות איבר הוקמה בעבר vivo לשעבר לפיה הצד החיצוני של לבבות E12.5 מסומנים עם אדנו להביע GFP 9,18 (איור 3 א). לבבות שכותרתו הם עוד בתרבית למשך שלושה ימים בנוכחות-β1 TGF [10 ng / ml] ו PDGF-BB [20 ng / ml] לקדם הגירה EPDC. תרבויות איברים הם מסובבים מדי פעם כדי למנוע הידבקות של לבבות vivo לשעבר אל פני השטח של צלחות תרבית. מערכת זו מאפשרת תיוג יעיל של epicardium והערכה כולו של תנועתיות EPDC במודל תלת מימדי להבדיל הגירה כיוונית עם מבחני שריטה במבחנה. ההגירה של EPDC היא observed כמו הפלישה של ה- GFP תאי epicardial חיוביים לתוך או מעבר ColIV (אדום) קרום במרתף subepicardial 16 (3B הדמוי, C). כדי להמחיש את התועלת של מערכת זו, יש לנו לאחרונה הראו כי מניפולציה של ציר איתות MRTF / SRF יכול להשפיע על תנועתיות של EPDC 9. מחיקת Mrtfa ו Mrtfb ידי כריתה בתיווך Cre של אללים floxed (MRTFdKO) פוחתת נדידת EPDC לחלל subepicardial. לעומת זאת, נאלץ ביטוי MRTF-A (Ad / MRTF-A) בתוצאות לבבות C57BL / 6 גירת EPDC מוגברת שיבוש של הקרום במרתף ColIV (3C הדמוי, D).

גֵן קָדִימָה לַהֲפוֹך הצטרפות צמח שדה
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
Wt1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Primers רצפים של קדימה לאחור משמש אימות של Epicardial תולדה תרבות טוהר על ידי ניתוח של Epicardium ואת שריר הלב מוגבלים Gene Expression ביטוי גנים נקבע על ידי Wi qRT-PCR: טבלה 1.ה את הפרמטרים הבאים: לפגל על ​​95 מעלות צלזיוס למשך 10 שניות; לחשל ב 60 מעלות צלזיוס למשך 30 שניות; לחזור 50x מחזורים.

איור 1
איור 1: בידוד של תאים הראשוניים Epicardial שימוש Assay תרבות תולדה (א) ייצוג סכמטי של assay explant תולדת epicardial עם ציר זמן מומלץ עבור אפנון epicardial וניתוח.. (B - E) תמונות brightfield נציג של נקודות זמן שונות במהלך assay explant. (ב) לבבות בעכברים עוברי היום E11.5 ממוקמים בצד הגבה למטה על מצע קולגן. (ג) תאים Epicardial (ראשי חץ לבן) יתחילו להעביר את הלב תוך 3-4 שעות של תרבות. תאי דם (חיצים שחורים) עלולים להצטבר סמוך או לכסות explants במהלך תולדת epicardial. (D, E) לאחרכ 24 שעות של תרבות, לבבות יוסרו monolayers epicardial להישאר דבק לשקופית קאמרית. בצמחים סלולריים להציג מורפולוגיה אפיתל עם הסדר דמוי מרוצף של תאים. ברי סולם = 250 מיקרומטר (BD) או 50 מיקרומטר (C, E). H = הלב, LA = הפרוזדור השמאלי, LV = החדר השמאלי, OFT = בדרכי יצוא, RA = right אטריום, RV = right החדר. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2: הערכת טוהר Epicardial Cell תולדה (א) qRT-PCR אימות של סמנים מוגבל epicardial (Tcf21, Aldh1a2, ו Wt1) בתרבויות תולדה לעומת ביטוי גנים שריר הלב (Nkx2-5 ו Myh7) ב E11 מדולדל epicardium.. 5 לבבות. represen נתוניםך * ממוצע ± SEM (n = 8 בכל קבוצה). כוכביות לציין מובהקות סטטיסטית באמצעות Student T-test עם **** p <0.0001. (ב) מכתים שיתוף immunofluorescent נציג של בצמחים unstimulated לביטוי epicardial (WT1, אדום), צמתים הדוקים בין תאית (ZO1, ירוק), גרעינים (DAPI, כחול). (ג) דוגמא של זיהום תא תרבות תוצאה. תאים Epicardial (כוכבית) הם נצפו בצד ימין של הפאנל עם זהות mesothelial מאפיין (WT1 גרעיני, אדום) צמתים הדוקים אפיתל מאורגן (ZO1, ירוק). התאים הסמוכים במרכז (ראשי חץ לבן) תערוכה מורפולוגיה mesenchymal מוארך, שמוצג על ידי התערבות ההפרש לעומת זאת (DIC) הדמיה, עם חלבון WT1 גרעיני מינימלי מכתים ZO1 מאורגן. (ד) בתרביות תאים Epicardial היו מגורה עם הרכב (4 מ"מ HCl ב 1mg / ml BSA) או-β1 TGF [10 ng / ml] להשרות epicardialEMT. גירוי TGF-β1 מקדם ביטוי חזק של ACTA2 (אדום) באזורים בקליפת המוח של תאים ומחוברות במרכז explants או בסיבי לחץ של תאים הנודדים בקצה או בפריפריה של בשכבה. הידבקויות Cell מסומנות על ידי ZO1 (ירוק). ברי סולם = 25 מיקרומטר (BD). נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3: Ex Vivo הערכת EPDC תנועתיות (א) ציר זמן סכמטי של assay תרבות לב vivo לשעבר.. (ב) 5 מיקרומטר סעיף נציג לב C57BL / 6 E12.5 transduced עם מודעות / GFP (ירוק) למשך 24 שעות כדי לתייג את החלק החיצוני של הלב. הלב גופיים היו ובהמשך תרבותי עבור 48 שעות נוספות עם TGF- β1 [10 ng / ml]ו PDGF-BB [20 ng / ml] כדי לעורר הגירה EPDC. סעיפים היו שיתוף מוכתם עבור ColIV (אדום) לתייג את קרום גרעינים במרתף subepicardial (DAPI, כחול). מורפולוגיה התרבות לב-גופיים מוצגת על ידי דסק"ש. LV = החדר השמאלי של הלב, RV = right החדר, RA = ימין אטריום. (C, D) בקשה דוגמה assay הגירה vivo לשעבר ידי ויסות ציר רגולטוריות MRTF / SRF. נתון זה יש הבדל בין [9]. לבבות E12.5 בודדו Mrtfa - / -;. Mrtfb fl / fl עוברים transduced עם מודעות / GFP ו וירוס שליטה או בעל אדנו להביע recombinase Cre למשך 24 שעות תרבויות vivo לשעבר היו מגורה אז עם-β1 TGF [10 ng / מ"ל] ו PDGF-BB [20 ng / ml] עבור 48 שעות נוספות. תנועתיות EPDC (חצים לבנים) הוא ציין גם את ההגירה של GFP תאים חיוביים (ירוק) לתוך או מעבר ColIV (אדום). Cre בתיווך מחיק של Mrtfb ב <em> Mrtfa - / - רקע (MRTFdKO) תוצאות הנחתה של גירת EPDC לעומת שליטת לבבות. לעומת זאת, נאלץ ביטוי MRTF-A (Ad / MRTF-A) ב E12.5 C57BL / 6 לבבות משפר הגירה EPDC. (ד) כימותי% GFP נדידת תאים חיוביים. הנתונים מוצגים כממוצע ± SEM (n = 4 לבבות עבור כל תנאי). הנתונים נותחו באמצעות ANOVA חד כיווני עם כוכביות המציין מובהקות סטטיסטית על ידי בדיקות פוסט הוק Tukey עם **** p <0.0001. ברי סולם = 200 מיקרומטר (ב) או 25 מיקרומטר (C). כל התמונות נרכשו באמצעות מיקרוסקופ סריקת לייזר confocal הפוכה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

כאן אנו מתארים שיטות מפורטות לבודדים תאי epicardial ראשוניים על ידי תולדה ולעקוב אחר גירת EPDC בתרבויות vivo לשעבר לב. עבור תרבויות תולדה, בזמן המתאים כדי להסיר את הלב מדולדל epicardium משתנה מעט בין הניסויים. המעקב התקופתי אחר התפתחות explants לאחר הדגירה לילה מומלץ לאמוד את היקף תולדה epicardial וכדי לחלץ את הלב לפני פיברובלסטים להופיע. כדי להבטיח טוהר, לבבות יוסרו בתוך 24 שעות של explanting כדי למנוע הצטברות של שושלות הלא epicardial. זמירה משם בדרכי יצוא ושניהם הפרוזדורים לפני העברת בלב לשקופית קאמרית יכול גם להפחית סוגי תאים לזהם 27,40. מאז לבבות עובריים מבודדים המלטת עכבר במהלך חלון צר של זמן בתרבית בתנאים הזהים, הזמן בצמחים להופיע הוא יחסית דומה מלב אחד למשנו בתוך ניסוי. לכן, כל הלבבות צריכים bדואר מוסר כאשר רוב explants להפגין בצמחים epicardial. במקרים מסוימים, תאי epicardial אינם נודדים החוצה ביעילות מלב כי מתכווץ באופן נמרץ יותר מהאחרים, ובמקרה explant זה חייב להיות מחוץ הניסוי.

ההצטברות של תאי דם לעתים קרובות יכולה להסתיר בשכבה שטוחה של תאי epicardial (חיצים, 1C איור), ובכך הוא הופך אותו קשה לדמיין בצמחים. כדי למנוע תרומת תאי דם מוגזמת, לבבות יכולים להישאר HBSS במשך כמה דקות על לנתיחה מן העובר. זה מאפשר מספיק זמן עבור לב העובר כדי לשאוב את הדם שיורית בתאי הלב לפני שהועבר שקופית קאמרית. לחלופין, להשלים את התרבויות עם מדיום explant לאחר דגירת הלילה הראשונה יעזור לרוקן קצת דם עודף ולחשוף בצמחים; עם זאת, רמת התקשורת לא צריכה להתעלות מעל הלב כמו מתח הפנים יכול לגרום ללבלהתרחק מן המצע. בצמחי epicardial חזקים הם נצפו באמצעות סוג קולגן אני כמו מצע התרבות; עם זאת, מצעים אחרים דווחו בהתאם האורגניזם ו / או יישום 27,40-42. שימוש בפרוטוקול זה, תאי epicardial עובר ראשוניים יכולים לשגשג במשך 4 ימים לאחר הסרת לב ומילוי בינוני יומי; עם זאת, עיצובים ניסיוניים המחייבים תקופות ארוכות יותר של התרבות צריכים להיקבע על ידי משתמש הקצה. מאז EMT epicardial מופעל בתוקף במהלך התפתחות עוברית, טכניקת תרבות תולדה זו מוגבלת להעשרת תאי epicardial העובריות. קבוצות אחרות תארו שיטות לבודדות תאי epicardial מבוגרים 43,44.

עבור מבחני הגירה vivo לשעבר, מיצוי לב תיוג תא epicardial המומלצים ב E12.5 משתי סיבות. ראשית, לבבות מבודדים לאחר E12.5 הם גדולים יותר, ולכן דורשים יותר זלוף לתמוך כדאיות. דיפוזיה פשוטה של ​​מזיןs אינו מספיק כדי לשמור על תרבויות איברי לבבות גדולים. שנית, EMT epicardial והגירה EPDC להתרחש סביב E12.5. לכן, epicardium צריך להיות מתויג עם אדנו לבטא חלבון פלואורסצנטי מייד לאחר חילוץ לב על מנת למקסם את זיהוי של EPDC. לחלופין, אסתר succinimidyl diacetate carboxyfluorescein (CFSE) דווחה בעבר לתייג את החלק החיצוני של הלב ואת עקבות EPDC הגירה 10,45.

בניגוד מבחני תולדה, תרבויות vivo לשעבר צריכים להיות התנדנדו באופן תקופתי כדי למנוע עיקול לב תולדת תא epicardial. תרבויות יכולות גם להיות נסערות ברציפות באינקובטור מצויד נדנדה על הגדרת המהירות הנמוכה ביותר. משתמשים יבחינו שינויים במורפולוגיה לב בתוך כמה ימים של תרבות איבר וצריך למנוע ניתוחים מעבר 72 שעות של בידוד לב. שימוש assay זה, הפלישה EPDC הוא ציין בתוך 48 עד 72 שעות של תרבות. בעוד מערכת Cre-loxPנעשה שימוש vivo למפות את הלוקליזציה של EPDC אל כלי הדם הכליליים, את interstitium שריר הלב, ואת interventricular מחץ 7,22, טכניקת vivo לשעבר זו מוגבלת הגירת EPDC בתוך שכבות תאים כמה מן לחלל epicardial. לכן, שיטה זו מתאימה יותר לקביעת הרגולטורים של תנועתיות EPDC ופלישה במקום להגדיר את היעד הסופי של נודדות EPDC.

Isolations תא Epicardial לשעבר vivo מבחני הגירה, בשילוב עם רווח או הפסד של גישות פונקציה, כבר הוכיחו שימושי להערכת גנים מועמדים העלולים להשפיע ביולוגיה EPDC 9,18,46. שיטות אלה גם לספק פלטפורמה עבור רווח של פונקציה או הפסד של פונקציה המסכים לזהות הרגולטורים הרומן של הגירה EPDC. אסטרטגיה זו, בשילוב עם מיון תא מופעל קרינה או RNA-רצף תא בודד, עשויה גם לספק הזדמנות לחקור ההטרוגניות epicardialו EPDC בידול ביתר פירוט. לבסוף, שינויים של נהלים אלה יכולים לשמש לפיתוח מסך עבור מולקולות קטנות שמשפיעות תא epicardial וביולוגית EPDC לצורך רפואת רגנרטיבית לב.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים אין לי מה לחשוף.

Acknowledgements

EMS נתמכה על ידי מענקים מהמוסד הלאומי לבריאות (NIH) [מספר מענק R01HL120919]; איגוד הלב האמריקני [מספר מענק 10SDG4350046]; אוניברסיטת הפרס רוצ'סטר CTSA מן [מספר מענק UL1 TR000042] NIH; וקרנות אתחול מתוך Aab CVRI. MAT נתמכה בחלקה על ידי מענק של אוניברסיטת רוצ'סטר בית הספר לרפואה ורפואת שיניים מהמוסד הרפואי ע"ש הווארד יוז Med-Into-גראד יוזמת; וכן פרס שירות המוסדי רות ל Kirschstein הלאומית למחקר מן [GM068411 מספר מענק] NIH.

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics