Epikardial Udvækst Kultur Assay og

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Et enkelt lag af epikardiale cellelinier hjertet, hvilket giver parakrine faktorer, der stimulerer cardiomyocyte proliferation og bidrager direkte kardiovaskulære progenitorer under udviklingen og sygdom. Mens en række faktorer har været impliceret i epikardiet-afledt celle (EPDC) mobilisering, er de mekanismer, der styrer deres efterfølgende migrering og differentiering dårligt forstået. Her præsenterer vi in vitro og ex vivo strategier til at studere EPDC motilitet og differentiering. Først beskriver vi en metode til at opnå primære epikardielle celler ved udvækst kultur fra den embryonale mus hjerte. Vi indfører også en detaljeret protokol til at vurdere tredimensionale migration af mærket EPDC i et organ kultursystem. Vi leverer beviser ved hjælp af disse teknikker, som genetisk sletning af myocardin-relaterede transkriptionsfaktorer i epikardiet dæmper EPDC migration. Denne fremgangsmåde fungerer som en platform til at vurdere kandidat modifikatorer af EPDCbiologi og kunne anvendes til at udvikle genetiske eller kemiske skærme for at identificere hidtil ukendte regulatorer af EPDC mobilisering der kan være nyttige til hjerte- reparation.

Introduction

Epicardiet er et enkelt lag af mesotelceller at linjer hjerte og påvirkninger cardiac udvikling, modning og reparation. Gennem en meget koordineret udveksling af parakrine signaler, den intime dialog mellem myocardium og epicardium er uundværlig for cardiac vækst og dannelse af ikke-myocyt kardiale afstamninger 1. Epikardielle-afledte celler (EPDC) frem fra en undergruppe af epikardiale celler gennem en epitelial-til-mesenchymal overgang (EMT) 2, invaderer subepicardial rum og underliggende myocardium, og differentiere i vid udstrækning i koronare vaskulære mural celler og kardiale fibroblaster, og til en mindre omfang, endotelceller og cardiomyocytter 3-9.

De mekanismer, der regulerer epikardial EMT og EPDC invasion er blevet tilskrevet den koordineret indsats af forskellige molekyler, herunder udskilles ligander 10-13, celleoverfladereceptorer og adhæsionsmolekyler 14,15, regulatorer af apikale-basal polaritet 16,17, små GTPaser 18,19, og transkriptionsfaktorer 2,20,21. Mens mange af de molekylære effektorer af EPDC migration er blevet defineret, at en bedre forståelse af de fysiologiske signaler, der stimulerer EPDC mobilisering i fosteret kan fremskynde udviklingen af ​​strategier manipulere denne proces i den voksne for forbedret hjertefunktion reparation.

Undersøgelser til formål at identificere nye regulatorer af EPDC mobilisering stole på rensning af denne celle population eller opsporing migrationen af ​​individuelle epikardielle celler. En eller en kombination af markørgener, herunder WT1, Tcf21, Tbx18, og / eller Aldh1a2, er almindeligt anvendt til at identificere fostrets epicardium 1. Men anvendelsen af ​​disse markører spore migrerende EPDC ikke er optimal som udtryk for epikardiale markører aftager i løbet af hjerte udvikling og er ofte tabt, når epikardiale celler undergår transdifrentiering i mesenchymale celler.

Anvendelsen af Cre / loxP-system, sammen med slægt-tracing journalister, har været nyttig i permanent mærkning af epicardium og dens efterkommere under hjerte udvikling og efter iskæmisk skade i den voksne 7,22,23. Adskillige epikardielle-begrænset Cre linjer er blevet genereret og er almindeligt anvendt til at mærke EPDC og for betinget gendeletion strategier 1. Disse undersøgelser har ført til karakteriseringen af ​​forskellige epikardielle slægter, og identifikationen af ​​kritiske formidlere af EPDC motilitet og differentiering. Men akkumulere tyder også, epicardiet er en heterogen population af progenitorceller 4,24,25. Således vil kun en delmængde af epikardiale celler målrettes under anvendelse af en given Cre driver.

For at mærke hele epicardium uanset Cre specificitet, har en række laboratorier udnyttet udvækst cultidige systemer eller ex vivo organ dyrkningsmetoder til trofast isolere eller mærke epikardielle celler uden afhængigt af ekspressionen af et genetisk afstamning markører 26-28. For ex vivo studier migration, er embryonale hjerter isoleret før epikardial EMT og dyrket i medium suppleret med et grønt fluorescerende protein (GFP) udtrykkende adenovirus (Ad / GFP) 9,18. Denne fremgangsmåde giver mulighed for effektiv mærkning af hele epicardium snarere end en undergruppe af celler ved Cre-medieret rekombination. Heart kulturer efterfølgende eksponering for kendte induktorer af EMT at stimulere mobilisering af EPDC 28,29. Ex vivo og in vivo analyser suppleres af in vitro epikardielle eksplantatkulturer, som er en særlig nyttig metode til at udforske detaljerede mekanismer kørsel EPDC migration.

Her beskriver vi metoder til isolering primære epikardielle celler til in vitro-undersøgelser af epicardial EMT, samt et organ dyrkningssystem til ex vivo-analyser af EPDC motilitet. Vi har for nylig demonstreret nytten og robustheden af denne metode ved genetisk modulere myocardin-relaterede transskription faktor (MRTF) / serum respons faktor (SRF) signalering akse til at manipulere actin-baserede migration af EPDC 9. Mens vores resultater fremhæve en signalvej nødvendig til regulering EPDC migration, disse metoder er egnede til optrævling de mekanismer, der kollektivt orkestrerer EPDC migration og differentiering. Endvidere kunne eksplantatet og ex vivo dyrkningssystemer implementeres i funktionelle skærme at identificere nye regulatorer af EPDC mobilisering til terapeutiske anvendelser i hjerte-regenerering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

BEMÆRK: Alle eksperimenter med mus blev godkendt af University udvalg for Animal Resources ved University of Rochester.

1. Epikardial Udvækst Culture Assay (figur 1A)

  1. Forberedelser
    1. Forbered 5 ml medium A til primær epikardial celleisolering ved supplering Medium 199 (M199) med 5% føtalt bovint serum (FBS) og 1% penicillin / streptomycin (Pen / Strep).
    2. Pre-varm medium A og 100 ml Hanks 'Balanced Salt Solution (HBSS) i en 37 ° C vandbad.
    3. Tillad collagencoatede kammerskiver at opvarme til stuetemperatur i 30 minutter.
    4. Tilsæt 100 pi medium A til hver brønd af kammeret slide og forsigtigt rotere jævnt overtrække collagen overflade. Gentag for 8-12 brønde. Fjern medier efter overtrækning kamre.
    5. Aliquot forvarmet HBSS i to 10 cm2 plader indeholdende 50 ml af hver af HBSS.
  2. Isoler Embryonale Hjerter fra Gravid Dam på 11,5 dage efter coitum (DPC).30
    1. Bedøver musen med 0,5 ml 13 mg / ml ketamin / 0,88 mg / ml xylazin cocktail i 1x Dulbeccos phosphatbufret saltvand (DPBS) via intraperitoneal injektion. Bekræft korrekt bedøvelse under anvendelse af en tå knivspids test. En blid knivspids er tilstrækkelig til at bestemme, om musen reagerer. Enhver bevægelse eller pote trække indikerer at dyret ikke er tilstrækkeligt bedøvet at gøre kirurgi. Aflive ved cervikal dislokation.
    2. Læg musen vender ventrale side op og sprøjte maven med 70% ethanol for at reducere forurening med hår.
    3. Klem huden med pincet og skære en lateral incision på maven med kirurgiske sakse. Hold huden fast og træk fra hinanden i modsatte retninger mod hoved og hale.
    4. Klem bughinden med pincet og skåret med en saks for at blotlægge den abdominale kavitet.
    5. Fjern forsigtigt decidua ved at skære langs mesometrium. Overfør det dissekerede decidua at forvarmet HBSS i første10 cm2 plade.
    6. Adskil decidua ved at skære mellem embryoner.
    7. Overfør et foster til den anden 10 cm2 plade med forvarmet HBSS under et dissektionsmikroskop. Fjern forsigtigt extraembryonic væv og blommesækken, så halshugge embryoet.
    8. Klem thorax væg med pincet og rive vævet fra hinanden ved midterlinjen, udsætter brysthulen.
    9. Placer pincet bag hjertet. Tag fat i udstrømningen tarmkanalen og træk hjerte væk fra embryonet. Adskil det pulmonale tarmkanalen og lunger fra hjertet, hvis den stadig er fastgjort.
  3. Overfør hjertet til en enkelt brønd i collagen-coatede objektglas og placere den dorsale side ned (figur 1B). Gentag trin 1.2.7-1.3 for hver foster.
  4. Når alle hjerter er blevet overført til de enkelte brønde, inkuberes kammeret slide i 30 min ved 37 ° C, til 5% CO2 tilstrækkelig tilslutning til kollagen matrix.
  5. tilsættes forsigtigt20-50 pi forvarmet eksplantat medium A omkring hvert hjerte. Vigtigt: Du må ikke tilføje mediet for hurtigt eller til et niveau over hjertet, ellers hjerter kan løsne sig fra kollagen substrat.
  6. Kultur hjerter ved 37 ° C, 5% CO2 i ca. 24 timer for at tillade epikardial udvækst. Bemærk: udvækster kan observeres så tidligt som 3-4 timers kultur (figur 1C) og primært består af mesothelial celler, som viser brostensbelagte morfologi, med forurening minimal mesenkymale celler (figur 1D, E). Repræsentative resultater blev opnået under anvendelse af et dissektionsmikroskop forsynet med et kamera.

2. Genetisk Ablation og Induktion af EMT i Epikardielle udvækster

Forsigtig: Håndter adenovirus med omhu i henhold til godkendte biosikkerhed retningslinjer.

  1. Forbered 15 ml medium B (M199 suppleret med 1% FBS og 1% Pen / Strep) og præ-opvarmes til 37 ° C i et vandbad.
  2. Til udskæring affloxet alleler, forberede eksplantat medium B suppleret med 2,5 x 10 4 pfu / ml adenovirus, der udtrykker Cre rekombinase (Ad / Cre) eller kontrol-virus.
    Bemærk: Adenoviral medieret overekspression af kandidatgener kan også udføres for at vurdere forstærkningen funktions fænotyper. Virustitere bør fastsættes af slutbrugeren.
  3. Fjern forsigtigt epicardium-udtømte hjerter fra udvækst kulturer ved anvendelse af pincetter. Overfør hjerter til 1,5 ml rør med 800 pi Trizol og opbevares ved -80 ° C til senere RNA isolering og genekspression analyse.
  4. Vask hver brønd med DPBS til fjernelse blodlegemer og overskydende cellerester.
  5. Der tilsættes 500 pi eksplantat medium B suppleret med adenovirus (er) til hver udvækst kultur og inkuberes i 24 timer ved 37 ° C, 5% CO2.
  6. For EMT induktion, fjern medier og genopbygge med 37 eksplantat medium B ° C suppleret med rekombinant transformerende vækstfaktor (TGF) -β1 [10 ng / ml] eller køretøj (4 mM hydrochloric syre (HCl) indeholdende 1 mg / ml bovint serumalbumin (BSA)). Kultur eksplantater for yderligere 24 timer ved 37 ° C, 5% CO2. Fortsæt med gen / protein-ekspression analyser eller immuncytokemi som beskrevet detaljeret i efterfølgende protokoller.
    Bemærk: Induktion af epicardiale EMT er blevet stimuleret med forskellige koncentrationer af TGF-β1 i området fra 0,5 ng / ml - 10 ng / ml 26,31-33. Højere koncentrationer af ligand kan resultere i ikke-specifik binding til alle TGF-β-receptorer. Koncentrationen af ​​TGF-β1 bør afspejle de specifikke eksperimentelle mål.

3. Gene Expression Analyse af Epikardielle udvækster

  1. Optø epicardium-depleteret hjerter tidligere lagrede i Trizol (2.2).
  2. Aspirer medier fra EPDC kulturer og vaskes to gange med DPBS.
  3. Tilføj 800 pi stuetemperatur Trizol at eksplantatkulturer.
  4. Inkuber epicardium-depleteret hjerter og EPDC kulturer i Trizol i 5 minutter ved stue tempe re. Pipettere op og ned ti gange for at homogenisere den lyserede prøve.
    Bemærk: Hjerter kan kræve yderligere pipettering til helt homogenisere.
  5. Overfør lysater til 1,5 ml rør og fortsætte med total RNA-isolering ifølge producentens anvisninger. Tilsæt 10 ug glycogen før udfældning at øge RNA udbytte. En given eksplantat vil give ca. 0,5-1,0 ug RNA.
  6. Fjernelse af forurenende DNA med DNase I og revers transkribere 0,5 ug mRNA producentens instruktioner.
  7. Godkend renhed epikardiale eksplantater og / eller induktion af EMT med kvantitativ revers transkription (QRT) -PCR 34 under anvendelse af SYBR green og markørerne er beskrevet i tabel 1. Normalize mRNA niveauer til glyceraldehyd-3-phosphat-dehydrogenase (GAPDH) og beregne relative ekspression under anvendelse 2 - ΔΔCt metode 35. Typiske resultater er vist i figur 2A.
title "> 4. Protein Analyse af Epikardielle udvækster

  1. Aspirer medier fra EPDC kulturer og vaskes to gange med DPBS.
  2. Tilsæt 10 pi iskold protein lysis buffer (50 mM Tris pH 7,5, 150 mM natriumchlorid, 1 mM ethylendiamintetraeddikesyre pH 8,0, 1% Triton X-100, 1x protease inhibitor cocktail) til hvert kammer brønd og placere kammeret glider på is. Skær ca. ¼ af bunden på en P200 pipettespids og bruge den resterende stykke til at skrabe cellerne ud af dias. Pipette op og ned for at lysere epikardielle celler og overføres til et 1,5 ml rør.
  3. Sonikeres lyserede eksplantater på lav (160 W) i 5 minutter i et isvandbad med 30 sek ON og OFF cyklusser.
  4. Centrifuger lysater i 10 minutter ved 10.000 xg, 4 ° C. Overfør supernatanten til et frisk rør og bestemme proteinkoncentration anvendelse af et protein assay 36.
    Bemærk: En given eksplantat vil give op til 1,5 ug samlet protein. Vi har fundet, at pooling eksplantater fra to hjerter end loading 2 ug protein per brønd er tilstrækkeligt til at påvise glatmuskel α-actin (ACTA2) og GAPDH 9. Påvisningen af ​​andre målproteiner kan kræve pooling multiple eksplantatpartikler prøver som bestemt af slutbrugeren.

5. Immuncytokemi af Epikardielle udvækster

  1. Fjern medier fra eksplantatkulturer og vask to gange med DPBS.
  2. Forsigtigt tilsættes 500 pi 4% (v / v) paraformaldehyd eller iskold methanol til hver brønd og fastsætte eksplantater i 5 minutter ved stuetemperatur eller 10 minutter ved -20 ° C. Fix ifølge antistof specifikationer som anbefalet af producenten.
  3. Fjern fiksativ og skyl hver brønd med DPBS tre gange i 5 min.
  4. Permeabilisere cellerne med 500 pi 0,1% (volumen / volumen) Triton X-100 i DPBS for 5 min.
  5. Fjern permeabilisering opløsning og skyl med DPBS tre gange i 5 min.
  6. Blokere cellerne med 10% serum i DPBS i 30 minutter ved stue tempere.
  7. Fortsæt med primært antistof farvning pr fabrikantens anbefalinger og optimale betingelser, som fastlægges af slutbrugeren.
  8. Fjern antistofopløsning og skyl med DPBS tre gange i 5 min.
  9. Anvend sekundært antistof pr producentens anvisninger og kontrastfarve med en passende nukleare farvestof.
  10. Fjern antistofopløsning og skyl med DPBS tre gange i 5 min.
  11. Fjern kammer slide vægge pr producentens anvisninger og tilføje vandigt montering medium direkte til cellerne. Læg et dækglas over cellerne og forsegle med neglelak. Typiske resultater er vist i figur 2B - 2D hjælp inverteret konfokal scanning mikroskopi.

6. Ex vivo-dyrkning assay (figur 3A)

  1. Forberedelser
    1. Forbered 12 ml ex vivo dyrkningsmedium under anvendelse af en (1: 1) blanding af Dulbeccos modificerede Eagle-medium (DMEM): M199 suppleret med 10%FBS og 1% Pen / Strep.
    2. I et 37 ° C vandbad, før varm ex vivo dyrkningsmedium og 100 ml HBSS.
    3. Alikvote 1 ml forvarmet medium i 8-12 brønde i en 24 brønds plade.
    4. Overførsel forvarmet HBSS til to 10 cm 2 plader, indeholdende 50 ml hver.
  2. Isoler mus embryonale hjerter i HBSS (som beskrevet i 1.2) fra gravide moderdyr på 12,5 dpc.
  3. Overfør hvert hjerte til en enkelt brønd på 24-brønds plade indeholdende ex vivo dyrkningsmedium. Inkubér pladen ved 37 ° C, 5% CO2 under forsigtig vipning manuelt eller ved anvendelse af en vippeplatform at forhindre vedhæftning. fortsætte Umiddelbart til trin 7.1.

7. Epikardial Mærkning og EMT Induktion i Ex Vivo Cultures

  1. To label epicardiet, forberede 12 ml 37 ° C ex vivo dyrkningsmedium suppleret med 3,0 x 10 6 pfu / ml Ad / GFP. Til målrettet ablation af floxet alleler, overførsel 6 ml Ad / GFP suppleret dyrkningsmedium til en ny 15 ml konisk rør. Tilføj annonce / Cre eller kontrol adenovirus til en slutkoncentration på 1,5 x 10 6 pfu / ml.
    Bemærk: Gain af funktionen analyser kan også udføres med passende adenoviral medieret genlevering.
  2. Fjern forsigtigt dyrkningsmediet fra hver brønd af 24-brønds plade under anvendelse af en P1,000 pipettespids.
  3. tilføj forsigtigt dyrkningsmedium suppleret med adenovirus (r) til hver brønd.
  4. Inkubér pladen ved 37 ° C, 5% CO2 i 24 timer under forsigtig vipning.
  5. For EMT induktion, forberede 12 ml 37 ° C ex vivo dyrkningsmedium indeholdende 10 ng / ml TGF-β1 og 20 ng / ml blodpladeafledt vækstfaktor (PDGF) -BB eller vehikel (4 mM HCI indeholdende 1 mg / ml BSA ).
  6. Fjern forsigtigt dyrkningsmedium fra hver brønd af 24-brønds plade under anvendelse af en P1,000 pipettespids. Forsigtigt skylles hjerter med 1 ml DPBS.
  7. Fjern DPBS og genopbygge hjerter med ex vivo kultur migdium indeholdende TGF-β1 og PDGF-BB eller vehikel.
  8. Inkuber i 24 timer ved 37 ° C, 5% CO2 under forsigtig vipning.

8. Kryopræservering og Immunhistokemi af ex vivo kulturer

  1. Forbered hjerter for Kryopræservering.
    1. Fjern dyrkningsmediet og vask hjerter to gange med iskold DPBS.
    2. Der tilsættes 1 ml 4% (v / v) paraformaldehyd til hvert hjerte og løse i 2 timer ved 4 ° C under forsigtig vipning.
    3. Fjern fiksativ og vask hjerter to gange med DPBS. Overfør hjerter til friske brønde med 1 ml 10% (w / v) sucrose udarbejdet i DPBS. Inkubér pladen natten over ved 4 ° C med forsigtig vipning.
    4. overføre omhyggeligt hjerter til nye brønde med 18% (vægt / volumen) saccharose fremstillet i DPBS. Inkubér pladen natten over ved 4 ° C med forsigtig vipning.
    5. Overfør hver hjerte til en kryoformen indeholdende væv frysemedium. fryse Umiddelbart blokke ved hjælp af flydende nitrogen og opbevares ved -80 & #176; C.
  2. Afsnit hjerter på 5 um bruger en kryostat og sted vævssnit på positivt ladede objektglas. Store glider ved -80 ° C indtil farvning.
  3. Udfør immunhistokemi på strækninger til påvisning af sub-epikardiel basalmembran.
    1. Optø objektglassene i mindst 30 minutter ved stuetemperatur.
    2. Rehydrere sektionerne ved vask to gange i DPBS i 5 minutter under forsigtig vipning.
    3. Permeabilisere sektion med 0,1% (volumen / volumen) Triton X-100 i PBS i 5 minutter ved stuetemperatur.
    4. Vask dias to gange i DPBS i 5 min med blide vuggende.
    5. Aftryk overskydende DPBS og definere farvning region med en hydrofob mærkning pen. Bloker sektioner med 10% serum i DPBS i 30 minutter ved stuetemperatur.
    6. Fjern blok og anvende collagen type IV-antistof (ColIV, 1: 200) fortyndet i blokken. Inkuber natten over ved 4 ° C i en fugtreguleret kammer.
    7. Vask slides tre gange i DPBS for5 min under forsigtig vipning.
    8. Fortynd fluorescens konjugeret sekundært antistof (1: 500) og DAPI (1: 5000) i DPBS og gælder for dias. Der inkuberes i 1 time ved stuetemperatur. Vælg et passende sekundært antistof med en emission og excitation bølgelængde adskiller sig fra GFP.
    9. Vask præparatglassene tre gange i PBS i 5 minutter under forsigtig vipning. Mount glider med montering medium.

9. Billedbehandling og Kvantificering af Ex Vivo kulturer

  1. Har en blindet bruger billede og kvantificere farvede sektioner. Billedfiler mindst fem vævssnit ikke på hinanden følgende fra en given hjerte i 4-5 vilkårlige steder langs epicardiet (kant af hjertet) med en fluorescerende eller konfokal mikroskop ved 40X forstørrelse. Typiske resultater er vist i figur 3B ved hjælp inverteret konfokal scanning mikroskopi.
  2. Manuelt tælle det samlede antal af GFP-positive celler i et givet billede. Identificer migrere EPDC som GFP posomt celler beliggende inden for eller uden for ColIV subepicardial basalmembranen. Bestemme procentdelen af ​​GFP migrerende celler som antallet af migrerende GFP-positive celler i det samlede antal af GFP-positive celler i et givet billede. Typiske resultater er vist i figur 3C-D ved anvendelse af inverteret konfokal scanning mikroskopi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Den epicardium effektivt kan isoleres ved hjælp af en udvækst kultur assay ved at udnytte dens ydre placering og udnytte den udviklingsmæssige plasticitet og iboende vandrende adfærd EPDC. Murine embryonale hjerte isoleres ved E11.5 før epikardial EMT og dyrkes dorsale side ned på collagen-coatede kammerskiver 26 (figur 1A, B). Eksplanterede hjerter vil fortsætte med at trække sig sammen; dog vil epicardiet holde sig til collagen matrix og migrerer ud fra myocardiet inden 24 timer af kultur (figur 1C). Epikardiale celler kan observeres stammer væk fra hjertet med brosten-lignende morfologi, indikerer mesotelial identitet (figur 1C-E). Efter 24 timer af kultur, er epicardium-udtømte hjerter fjernes til gen eller protein udtryk analyse.

Ud over at observere epithelial morfologi, kan renheden af ​​epicardiale cellekulturer yderligere valideres af ekspressionen af ​​epikardielle begrænsede gen- og protein-markører. Epicardiale celle eksplantater vise robust ekspression af epikardielle og mesothelial markører (Aldh1a2, Tcf21, og WT1) og lav ekspression af cardiomyocyte gener (Nkx2-5 og Myh7) sammenlignet med epikardiet-udtømte hjerter (figur 2A). For yderligere at verificere identitet, er epicardiale cellekulturer fast 48 timer efter hjerte fjernelse og co-farvet med antistoffer mod Wilms tumor 1 (WT1) og zona occludens protein 1 (ZO1) at mærke mesothelial celler og intercellulære tætte forbindelser, henholdsvis 37,38 ( Figur 2B). Denne udvækst kultur metode giver en relativt høj renhed af mesotelceller; dog kan brugerne observere en lille procentdel af forurening celle. Fibroblaster og glatte muskelceller udviser et aflangt mesenkymale fænotype med en iøjnefaldende mangel på Nuclear WT1 og organiserede tætte forbindelser (Figur 2C). Fejlfinding teknikker til at begrænse mængden af ​​ikke-epicardiale forurening celle udvides i diskussionen.

Eksplantatet udvækst assayet er et nyttigt dyrkningssystem spørgekriterierne epikardial biologi in vitro. For at demonstrere epikardiel celle plasticitet, blev eksplantater stimuleret med TGF-β1 [10 ng / ml] at inducere transdifferentiering i mesenkymceller 26,28. Efter 24 timer af stimulering, EPDC vedtage en mesenchymal fænotype med nedsat ZO1 farvning og robust de novo dannelsen af glatte muskelceller a-actin positive stress fibre (ACTA2 eller SMA), især ved periferien af kulturen 39 (figur 2D, rød). I modsætning til understrege samling fiber ved periferien af eksplantater, sammenflydende epikardiale celler med mere definerede intercellulære kontakter (ZO1, grøn) i midten af en monolayer display ACTA2 proteinekspression i kortikal actin.

Ud over at undergå EMT, vil EPDC invadere myokardiet og differentiere, der udgør en væsentlig andel af ikke-cardiomyocyte befolkninger. Motilitet EPDC kan vurderes ved anvendelse af en tidligere etableret ex vivo organkultur system, hvorved det ydre af E12.5 hjerter er mærket med et adenovirus, der udtrykker GFP 9,18 (figur 3A). Mærkede hjerter er yderligere dyrket i tre dage i nærvær af TGF-β1 [10 ng / ml] og PDGF-BB [20 ng / ml] at fremme EPDC migration. Organkulturer periodisk roteres for at forhindre adhæsion af ex vivo hjerter til overfladen af dyrkningsplader. Dette system giver mulighed for effektiv mærkning af hele epicardium og vurdering af EPDC motilitet i en tre-dimensionel model i modsætning til retningsbestemt migration med in vitro scratch assays. Migrationen af ​​EPDC er obseraba som invasionen af GFP-positive epikardiale celler ind i eller ud over ColIV (rød) subepicardial basalmembran 16 (figurerne 3B, C). For at illustrere anvendeligheden af dette system har vi for nylig vist, at manipulation af MRTF / SRF signalering akse kan påvirke motiliteten af EPDC 9. Sletning af Mrtfa og Mrtfb af Cre-medieret excision af floxet alleler (MRTFdKO) dæmper migration af EPDC i subepicardial rum. Omvendt tvungen ekspression af MRTF-A (Ad / MRTF-A) i C57BL / 6 hjerter resulterer i forøget EPDC migration og afbrydelse af ColIV basalmembran (figurerne 3C, D).

Gene Forward Bagside NCBI tiltrædelse
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabel 1: Sekvenser af forward og reverse primere anvendt for Validering af Epikardial Udvækst Kultur Renhed ved Analyse af epicardium og myocardium Begrænset Gene Expression Genekspression bestemmes af QRT-PCR wi.th følgende parametre: denaturering ved 95 ° C i 10 sek; annealer ved 60 ° C i 30 sek; gentag 50x cyklusser.

figur 1
Figur 1: Isolering af primær Epikardielle celler under anvendelse en udvækst Culture Assay (A) En skematisk fremstilling af epicardiale udvækst eksplantatet assay med en anbefalet tidsplan for epikardial modulation og analyse.. (B - E) Repræsentative lysfelt billeder af forskellige tidspunkter i løbet af eksplantatet assay. (B) Embryonale dag E11.5 murine hjerter er placeret dorsale side nedad på et kollagen substrat. (C) Epikardielle celler (hvide pilespidser) vil begynde at migrere fra hjertet inden 3-4 timer af kultur. Blodlegemer (sorte pile) kan akkumuleres i nærheden eller dække eksplantater under epikardial udvækst. (D, E) Eftercirka 24 timer af kultur, er hjerter fjernes og epikardielle monolag forbliver klæbet til kammeret dias. Cellulære udvækster vise epitelial morfologi med en brosten-lignende arrangement af celler. Scale barer = 250 um (BD) eller 50 pm (C, E). H = hjerte, LA = venstre atrium, LV = venstre ventrikel, OFT = udstrømning tarmkanalen, RA = højre atrium, RV = højre hjertekammer. Klik her for at se en større version af dette tal.

Figur 2
Figur 2: Evaluering af Epikardial celleudvækst Renhed (A) QRT-PCR validering af epikardielle begrænset markører (Tcf21, Aldh1a2, og WT1) i udvækst kulturer sammenlignet med myocardial genekspression (Nkx2-5 og Myh7) i epikardiet-forarmet E11.. 5 hjerter. data repræsent middelværdien ± SEM (n = 8 pr gruppe). Asterisk angiver statistisk signifikans under anvendelse af en Student t-test med **** P <0,0001. (B) Repræsentant co-immunfluorescensfarvning af stimulerede udvækster for epikardial udtryk (WT1, rød), intercellulære tætte forbindelser (ZO1, grøn) og kerner (DAPI, blå). (C) Et eksempel på kontaminering celle i en udvækst kultur. Epikardielle celler (stjerne) observeres til højre på panelet med karakteristisk mesothelial identitet (nuklear WT1, rød) og organiserede epiteliale tætte forbindelser (ZO1, grøn). De hosliggende celler i centrum (hvide pilespidser) udviser en langstrakt mesenchymal morfologi, vist ved differentiel interferens kontrast (DIC) afbildning, med minimal nukleare WT1-protein og uorganiseret ZO1 farvning. (D) Epikardielle cellekulturer blev stimuleret med vehikel (4 mM HCI i 1 mg / ml BSA) eller TGF-β1 [10 ng / ml] at inducere epikardialEMT. TGF-β1 stimulation fremmer robust ekspression af ACTA2 (rød) i corticale områder af konfluerende celler i centrum af eksplantater eller i stresssituationer fibre af celler migrerer på kanten eller periferien af ​​monolaget. Celleadhæsioner mærkes af ZO1 (grøn). Scale barer = 25 um (BD). Klik her for at se en større version af dette tal.

Figur 3
Figur 3: Ex vivo Vurdering af EPDC motilitet (A) En skematisk tidslinje for ex vivo hjerte kultur assay.. (B) En repræsentativ 5 um snit af en C57BL / 6 E12.5 hjerte transduceret med Ad / GFP (grønt) i 24 timer til at mærke det ydre af hjertet. Ex vivo hjerter var efterfølgende dyrket i yderligere 48 timer med TGF β1 [10 ng / ml]og PDGF-BB [20 ng / ml] at stimulere EPDC migration. Snit blev co-farvet for ColIV (rød) til at mærke den subepicardial basalmembran og kerner (DAPI, blue). Ex vivo hjerte kultur morfologi er vist ved DIC. LV = venstre ventrikel, RV = højre hjertekammer, RA = højre atrium. (C, D) Et eksempel anvendelse af ex vivo migration assay ved at modulere MRTF / SRF regulatorisk akse. Dette tal har været ændret siden [9]. E12.5 hjerter blev isoleret fra Mrtfa - / -;. Mrtfb fl / fl embryoner og transduceret med Ad / GFP og en kontrolgruppe virus eller et adenovirus, der udtrykker Cre-rekombinase i 24 timer ex vivo kulturer blev derefter stimuleret med TGF-β1 [10 ng / ml] og PDGF-BB [20 ng / ml] i yderligere 48 timer. EPDC motilitet (hvide pile) observeres som migreringen af ​​GFP-positive celler (grøn) ind i eller ud over ColIV (rød). Cre-medieret sletning af Mrtfb i <em> Mrtfa - / - baggrund (MRTFdKO) resulterer i svækkelse af EPDC migration i forhold til at styre hjerter. Omvendt tvunget udtryk for MRTF-A (Ad / MRTF-A) i E12.5 C57BL / 6 hjerter forbedrer EPDC migration. (D) Kvantificering af% GFP positive cellemigration. Data er præsenteret som gennemsnit ± SEM (n = 4 hjerter for hver betingelse). Dataene blev analyseret ved anvendelse af en envejs ANOVA med asterisker angiver statistisk signifikans ved Tukey post-hoc test med **** P <0,0001. Skalapanelerne = 200 um (B) eller 25 um (C). Alle billeder blev erhvervet ved hjælp af omvendt konfokal laser scanning mikroskopi. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her har vi skitsere detaljerede metoder til isolering primære epikardial celle ved udvækst og spore EPDC migration i ex vivo hjerte kulturer. For udvækst kulturer, et passende tidspunkt til at fjerne epikardiet-udtømte hjerte varierer lidt mellem eksperimenter. Periodisk monitorering af eksplantaterne efter inkubering natten anbefales at måle omfanget af epicardiale udvækst og at uddrage hjertet før fibroblaster vises. For at sikre renhed, bør hjerter fjernes inden 24 timer af eksplantering at forhindre ophobning af ikke-epikardielle slægter. Trimning væk udstrømningen tarmkanalen og begge forkamre før overføre hjertet til et kammer dias kan også reducere forurenende celletyper 27,40. Da føtale hjerter er isoleret fra en muse kuld under et smalt tidsvindue og dyrket under de samme betingelser, tidspunktet for udvækster der vises, er relativt ens fra et hjerte til et andet inden et eksperiment. Derfor bør alle hjerter be fjernes, når hovedparten af ​​eksplantaterne udviser epikardielle udvækster. I nogle tilfælde behøver epikardielle celler ikke migrere ud effektivt fra et hjerte, der er kontraherende mere energisk end de andre, i hvilket tilfælde dette eksplantatet skal udelukkes fra forsøget.

Akkumuleringen af blodceller kan ofte skjule en flad monolag af epikardiale celler (pile, figur 1C), hvilket gør det vanskeligt at visualisere udvækster. At undgå overdreven bidrag blodlegemer, kan hjerter forblive i HBSS i et par minutter upon dissektion fra embryoet. Dette giver tilstrækkelig tid til fostrets hjerte til at pumpe ud overskydende blod i hjertekamrene, før de overføres til et kammer dias. Alternativt vil supplere kulturerne med eksplantation medium A efter den første inkubation natten bidrage til at skylle væk nogle overskydende blod og afslører udvækster; imidlertid bør niveauet af medier ikke stige over hjertet som overfladespændingen kan forårsage hjertetat trække væk fra substratet. Robuste epikardiale udvækster, ved anvendelse collagen type I som kulturen substrat; dog er der rapporteret andre substrater afhængig af organismen og / eller anvendelsen 27,40-42. Ved hjælp af denne protokol, kan primære føtale epikardielle celler trives i 4 dage efter hjerte fjernelse og daglig medium genopfyldning; dog bør forsøgsdesign kræver længere perioder med kultur bestemmes af slutbrugeren. Da epikardial EMT kraftigt aktiveres under fosterudviklingen, er denne udvækst kultur teknik begrænset til berigelse af føtale epikardielle celler. Andre grupper har beskrevet metoder til at isolere voksne epikardielle celler 43,44.

For ex vivo migration assays, hjerte udsugning og epikardial celle mærkning anbefales ved E12.5 af to grunde. Første, hjerter isoleret efter E12.5 er større og dermed kræver mere perfusion at understøtte levedygtigheden. Simpel diffusion af næringsstoffers er ikke tilstrækkelig til at opretholde organkulturer fra større hjerter. For det andet, epikardiel EMT og EPDC migration opstå omkring E12.5. Derfor bør epicardiet mærkes med et adenovirus, der udtrykker et fluorescerende protein umiddelbart efter hjerte ekstraktion for at maksimere detektionen af ​​EPDC. Alternativt carboxyfluorescein diacetat succinimidylester (CFSE) tidligere er blevet rapporteret til at mærke det ydre af hjertet og spore EPDC migration 10,45.

I modsætning til udvækst analyser, bør ex vivo kulturer rystet jævne mellemrum for at undgå hjerte udlæg og epikardiel celle udvækst. Kulturer kunne også kontinuerligt omrørt i en inkubator udstyret med en rocker på hastighedsindstilling laveste. Brugerne vil bemærke ændringer i hjerte-morfologi inden for et par dage af orgel kultur og bør undgå analyser ud over 72 timer af hjerte isolation. Anvendelse af dette assay er EPDC invasion observeret inden for 48 til 72 timer af kultur. Mens Cre-loxP-systemeter blevet anvendt in vivo til at kortlægge lokaliseringen af EPDC til koronar vaskulatur, myokardiet interstitium, og interventricular septum 7,22, dette ex vivo teknik er begrænset til EPDC migration inden for nogle få cellelag i sub-epikardiale rum. Således er denne metode er mere egnet til at bestemme regulatorer af EPDC motilitet og invasion frem for at definere det endelige bestemmelsessted for at migrere EPDC.

Epikardielle celle isoleringer og ex vivo migration analyser, i kombination med gevinst eller tab af funktion tilgange, har allerede vist sig nyttig til evaluering kandidatgener, der kan påvirke EPDC biologi 9,18,46. Disse metoder giver også en platform for gevinst af funktion eller tab af funktion skærme til at identificere nye regulatorer af EPDC migration. Denne strategi, sammen med fluorescens-aktiveret celle sortering eller enkelt celle RNA-sekventering, kan også give mulighed for at undersøge epikardial heterogenitetog EPDC differentiering mere detaljeret. Endelig kunne modifikationer af disse procedurer anvendes til at udvikle skærme for små molekyler, der påvirker epikardial celle og EPDC biologi med henblik på kardial regenerativ medicin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgements

EMS blev støttet af tilskud fra National Institutes of Health (NIH) [tilskud nummer R01HL120919]; American Heart Association [tilskud nummer 10SDG4350046] den; University of Rochester CTSA pris fra NIH [tilskud nummer UL1 TR000042]; og start midler fra Aab CVRI. MAT blev delvist understøttet af et tilskud til University of Rochester School of Medicine og Dentistry fra Howard Hughes Medical Institute Med-Ind-Grad initiativet; og en Institutional Ruth L. Kirschstein National Research Service Award fra NIH [tilskud nummer GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics