Epikardiell utvekst Kultur-analysen og

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Et enkelt lag av epikardiale cellelinjer hjertet, og gir parakrine faktorer som stimulerer proliferasjon kardiomyocytt og bidrar direkte kardiovaskulære progenitorer i løpet av utvikling og sykdom. Selv om en rekke faktorer har vært implisert i epikardet-avledede celle (EPDC) mobilisering, blir de mekanismer som styrer deres etterfølgende migrering og differensiering dårlig forstått. Her presenterer vi in vitro og ex vivo strategier for å studere EPDC motilitet og differensiering. Først beskriver vi en fremgangsmåte for å oppnå primær epikardiale celler ved å utvekst kultur fra den embryoniske mus hjerte. Vi introduserer også en detaljert protokoll for å vurdere tredimensjonal migrering av merket EPDC i et organkultursystemet. Vi gir bevis ved hjelp av disse teknikkene som genetisk sletting av myocardin relaterte transkripsjonsfaktorer i epikardet demper EPDC migrasjon. Denne tilnærmingen fungerer som en plattform for å vurdere kandidatens modifikatorer av EPDCbiologi og kan brukes til å utvikle genetiske eller kjemiske skjermer for å identifisere nye regulatorer av EPDC mobilisering som kan være nyttig for hjerte reparasjon.

Introduction

Epikardet er et enkelt lag av mesothelial celler som linjer hjertet og påvirker hjerte utvikling, modning og reparasjon. Gjennom et høyt koordinert utveksling av parakrine signaler, er den intime dialog mellom hjertemuskelen og epikardet uunnværlig for hjerte vekst og dannelse av ikke-kardiale myocyte linjene 1. Epikardiale-avledede celler (EPDC) komme ut av en undergruppe av epikardiale cellene gjennom et epitelial-til-mesenchymale overgang (EMT) 2, invadere subepicardial plass og underliggende myokard, og differensiere i stor grad inn i koronare vaskulære vegg celler og hjerte fibroblaster, og til en mindre grad, endotelceller og kardiomyocytter 3-9.

Mekanismene som regulerer epikardiell EMT og EPDC invasjonen har blitt tilskrevet den koordinert aksjon fra ulike molekyler inkludert utskilles ligander 10-13, reseptorer på celleoverflaten og adhesjonsmolekyler 14,15, bestemmelser ogspekulantene av apikal-basal polaritet 16,17, små GTPases 18,19, og transkripsjon faktorer 2,20,21. Mens mange av de molekylære effektorer av EPDC migrasjon er definert, til en bedre forståelse av de fysiologiske signaler som stimulerer EPDC mobilisering i embryoet kan akselerere utviklingen av strategier manipulere denne prosessen i den voksne for bedre hjerte reparasjon.

Studier som tar sikte på å identifisere nye regulatorer av EPDC mobilisering stole på rensing av denne cellepopulasjon eller hvem som er migrasjon av individuelle epikardiale celler. En eller en kombinasjon av markørgener, inkludert WT1, Tcf21, Tbx18, og / eller Aldh1a2, er ofte brukt for å identifisere fosterets epikardet en. Imidlertid er anvendelse av disse markørene spor trekkende EPDC er ikke optimalt som uttrykk for epikardiale markører avtar i løpet av hjerte utvikling og går ofte tapt når epikardiale cellene gjennomgå transdifferentiation inn mesenchymalceller.

Anvendelsen av Cre / loxP system, i forbindelse med avstamning-tracing journalister, har vært nyttig i permanent merking av epikardet og dens etterkommere under hjerte utvikling og etter iskemisk skade i voksen 7,22,23. Flere epikardiale-restricted Cre linjer har blitt generert, og er mye brukt til å merke EPDC og for betinget genet sletting strategier 1. Disse studiene har ført til karakterisering av ulike epikardiale linjene, og identifisering av kritiske mediatorer av EPDC motilitet og differensiering. Men, samler bevis tyder også epikardet er en heterogen populasjon av stamceller 4,24,25. Således vil bare en undergruppe av celler epikardiale være målrettet anvendelse av en gitt Cre driver.

For å merke hele epikardet uansett Cre spesifisitet, har en rekke laboratorier benyttet utvekst Culdige systemer eller ex vivo orgel kultur metoder for å trofast isolere eller merke epikardiale celler uten avhengig uttrykk for en genetisk avstamning markører 26-28. For ex vivo migrasjon studier, er embryonale hjerter isolert før epikardiell EMT og dyrket i medium supplert med et grønt fluorescerende protein (GFP) -expressing adenovirus (Ad / GFP) 9,18. Denne tilnærmingen muliggjør effektiv merking av hele epikardet i stedet for en undergruppe av celler ved Cre-formidlet rekombinasjon. Hjerte kulturer senere blir utsatt for kjente indusere av EMT å stimulere mobilisering av EPDC 28,29. Ex vivo og in vivo analyser er supplert med in vitro epikardiale eksplantering kulturer, som er et spesielt nyttig tilnærming for å utforske detaljerte mekanismer som driver EPDC migrasjon.

Her beskriver vi metoder for å isolere primær epikardiale celler for in vitro studier av epicardial EMT, samt et organ kultursystem for ex vivo-analyser av EPDC motilitet. Vi har nylig demonstrert nytten og robusthet av denne metoden ved genetisk modulere myocardin relaterte transkripsjonsfaktor (MRTF) / serum responsfaktor (SRF) signal- aksen å manipulere aktin basert migrasjon av EPDC 9. Mens våre funn markere en signalveien er nødvendig for å regulere EPDC migrasjon, disse metodene er egnet for å rakne mekanismene som kollektivt orkestrere EPDC migrasjon og differensiering. Videre kan eksplantering og ex vivo kultur systemer implementeres i funksjonelle skjermer for å identifisere nye regulatorer av EPDC mobilisering for terapeutiske anvendelser i hjerte gjenfødelse.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

MERK: All eksperimentering med mus ble godkjent av Universitetet komité for Animal Resources ved University of Rochester.

1. Epikardial utvekst Culture Assay (figur 1A)

  1. Forberedelser
    1. Fremstille 5 ml medium A for primær epikardiell celleisolasjon ved å supplere medium 199 (M199) med 5% føtalt bovint serum (FBS) og 1% penicillin / streptomycin (Pen / Strep).
    2. Pre-varme medium A og 100 ml Hanks 'Balanced Salt Solution (HBSS) i en 37 ° C vannbad.
    3. Tillat kollagen-belagte kammers objektglass for å oppvarmes til romtemperatur i 30 minutter.
    4. Tilsett 100 ul medium A til hver brønn av kammeret lysbildet og forsiktig rotere for å belegge jevnt kollagen overflate. Gjenta for 8-12 brønner. Fjern media etter belegg kamre.
    5. Alikvot forvarmet HBSS i to 10 cm 2 plater inneholdende 50 ml hver av HBSS.
  2. Isoler Embryonale Hearts fra Gravid Dam på 11,5 dager etter samleie (DPC).30
    1. Bedøve mus med 0,5 ml av 13 mg / ml ketamin / 0,88 mg / ml xylazin cocktail i 1x Dulbeccos fosfatbuffret saltoppløsning (DPBS) via intraperitoneal injeksjon. Bekreft riktig anesthetization bruker en tå klype test. En mild klype er tilstrekkelig til å fastslå om musen er responsive. Enhver bevegelse eller labb trekke tilbake indikerer at dyret er ikke tilstrekkelig bedøvet å gjøre operasjonen. Avlive ved halshugging.
    2. Lå musen vendt ventral side opp og spray magen med 70% etanol for å redusere forurensning av håret.
    3. Knip huden med pinsett og kuttet en lateral snitt på magen med kirurgiske saks. Hold huden fast og deretter trekke fra hverandre i motsatte retninger mot hode og hale.
    4. Klem peritoneum med tang og klippe med saks for å avsløre bukhulen.
    5. Fjern decidua forsiktig ved å kutte langs mesometrium. Overfør dissekert decidua til forvarmes HBSS i den første10 cm 2 plate.
    6. Skill decidua ved å kutte mellom embryoer.
    7. Overfør et embryo til andre 10 cm 2 plate med forvarmet HBSS under et dissekere mikroskop. Fjern forsiktig extraembryonic vev og plommesekken, og deretter halshogge embryo.
    8. Klem brystveggen med pinsett og rive vev fra hverandre på midtlinjen, utsette brysthulen.
    9. Plasser tang bak hjertet. Ta tak i utløpskanalen og trekk hjerte bort fra embryo. Skill lungeveier og lunger fra hjertet, hvis fortsatt festet.
  3. Overfør hjertet til en enkelt brønn av kollagen-belagt lysbilde og plassere den ryggsiden ned (figur 1B). Gjenta trinn 1.2.7-1.3 for hvert embryo.
  4. Når alle hjerter er blitt overført til individuelle brønner, inkuber kammeret lysbildet i 30 minutter ved 37 ° C, 5% CO 2 gi tilstrekkelig tilslutning til kollagen matrise.
  5. legge nøye20-50 ul forvarmet explant medium A rundt hvert hjerte. Viktig: Ikke legg mediet for fort eller til et nivå over hjertet, ellers hjerter kan løsne fra kollagen underlaget.
  6. Kultur hjertene ved 37 ° C, 5% CO 2 for ca 24 timer å tillate epikardiell utvekst. Merk: utvekster kan observeres så tidlig som 3-4 timer av kultur (figur 1C) og hovedsakelig består av mesothelial celler viser brosteinsbelagte morfologi, med minimal mesenchymale celle forurensning (Figurene 1D, E). Representative resultater ble anskaffet ved hjelp av en disseksjon mikroskop utstyrt med et kamera.

2. Genetisk ablasjon og Induksjon av EMT i epikardiell utvekster

Forsiktig: Håndter adenovirus med forsiktighet i henhold til godkjent biologisk retningslinjer.

  1. Fremstille 15 ml medium B (M199 supplementert med 1% FBS og 1% Pen / Strep) og pre-varm til 37 ° C i et vannbad.
  2. For fjerning avfloxed alleler, forberede explant medium B supplert med 2,5 x 10 4 PFU / ml adenovirus uttrykker Cre recombinase (Ad / Cre) eller kontroll virus.
    Merk: Adenoviral mediert overekspresjon av kandidatgener kan også utføres for å evaluere gevinst på funksjons fenotyper. Virale titere bør bestemmes av sluttbrukeren.
  3. Fjern forsiktig epikardet fattig hjerter fra utvekst kulturer ved hjelp av tang. Overfør hjertene til 1,5 ml rør med 800 mL Trizol og oppbevares ved -80 ° C for senere RNA isolering og analyse av genuttrykk.
  4. Vask hver brønn med DPBS for å fjerne blodceller og overskudd av cellerester.
  5. Legg 500 mL eksplantat medium B supplementert med adenovirus (es) til hver utvekst kultur og inkuberes i 24 timer ved 37 ° C, 5% CO2.
  6. For EMT induksjon, fjern mediet og etterfylle med 37 eksplantat medium B ° C supplert med rekombinant transformerende vekstfaktor (TGF) -β1 [10 ng / ml] eller bærer (4 mM hydrochloric syre (HCl) inneholdende 1 mg / ml bovint serumalbumin (BSA)). Kultur eksplantater i ytterligere 24 timer ved 37 ° C, 5% CO2. Fortsett med gen / protein uttrykk analyser eller immunocytochemistry som beskrevet i de etterfølgende protokoller.
    Merk: Induksjon av epikardiell EMT er blitt stimulert med forskjellige konsentrasjoner av TGF-β1 i området fra 0,5 ng / ml - 10 ng / ml 26,31-33. Høyere konsentrasjoner av ligand kan føre til ikke-spesifikk binding til alle TGF-β reseptorer. Konsentrasjonen av TGF-β1 bør gjenspeile de spesifikke eksperimentelle mål.

3. Gene Expression Analyse av epikardiell utvekster

  1. Tine epikardet fattig hjerter lagret i Trizol (2,2).
  2. Sug media fra EPDC kulturer og vask to ganger med DPBS.
  3. Legg 800 mL romtemperatur Trizol eksplanterer kulturer.
  4. Inkuber epikardet fattig hjerter og EPDC kulturer i Trizol i 5 min ved rom tempera re. Pipettere opp og ned ti ganger for å homogenisere den lyserte prøve.
    Merk: Hearts kan kreve ytterligere pipettering helt homogen.
  5. Overfør lysatene til 1,5 ml rør og fortsette med total RNA isolering henhold til produsentens anvisninger. Tilsett 10 ug glykogen før nedbøren å øke RNA yield. En gitt explant vil gi om lag 0,5-1,0 mikrogram RNA.
  6. Fjern forurensende DNA med DNase og revers transkribere 0,5 mikrogram mRNA henhold til produsentens anvisninger.
  7. Valider renheten av epikardiale explants og / eller induksjon av EMT med kvantitativ revers transkripsjon (QRT) -PCR 34 bruker SYBR grønn og markører som er beskrevet i tabell 1. Normal mRNA nivåer til glyseraldehyd 3-fosfat dehydrogenase (GAPDH) og beregne relative uttrykk ved hjelp 2 - ΔΔCt metode 35. Typiske resultater er vist i figur 2A.
title "> 4. Protein Analyse av epikardiell utvekster

  1. Sug media fra EPDC kulturer og vask to ganger med DPBS.
  2. Tilsett 10 mL iskald protein lyseringsbuffer (50 mM Tris pH 7,5, 150 mM natriumklorid, 1 mM etylendiamintetraeddiksyre pH 8,0, 1% Triton X-100, 1 x protease inhibitor cocktail) til hvert kammer godt og plassere kammeret lysbildet videre is. Kutt av ca ¼ av bunnen på en P200 pipette og bruke den gjenværende stykke å skrape cellene ut av raset. Pipetter opp og ned for å lyse epikardiale celler og overføring til et 1,5 ml tube.
  3. Sonicate lysert explants på lav (160 W) i 5 minutter i en isen vannbad med 30 sek ON og OFF sykluser.
  4. Sentrifuger lysater i 10 minutter ved 10 000 xg, 4 ° C. Overfør supernatanten til et nytt rør og bestemme proteinkonsentrasjonen ved hjelp av en proteinanalyse 36.
    Merk: En gitt explant vil gi opp til 1,5 mikrogram total protein. Vi har funnet ut at pooling explants fra to hjerter end lasting 2 mikrogram protein per brønn er tilstrekkelig til å oppdage glatt muskulatur α-aktin (ACTA2) og GAPDH 9. Påvisningen av andre mål-proteinene kan kreve pooling flere eksplantering prøver som bestemmes av sluttbrukeren.

5. Immunocytochemistry av epikardiell utvekster

  1. Fjern media fra eksplantering kulturer og vask to ganger med DPBS.
  2. Tilsett 500 ul 4% (v / v) paraformaldehyd eller is-kald metanol til hver brønn og feste eksplantater i 5 min ved værelsestemperatur eller 10 minutter ved -20 ° C, respektivt. Fix ifølge antistoff spesifikasjoner som er anbefalt av produsenten.
  3. Fjern fiksativ og skylle hver brønn med DPBS tre ganger i 5 min.
  4. Permeabilisere cellene med 500 ul 0,1% (v / v) Triton X-100 i DPBS i 5 min.
  5. Fjern permeabiliseringen løsning og skyll med DPBS tre ganger i 5 min.
  6. Blokkere cellene med 10% serum i DPBS i 30 minutter ved værelses temperare.
  7. Fortsett med primær antistoff farging i henhold til produsentens anbefalinger og optimale forhold som bestemmes av sluttbruker.
  8. Fjern antistoffløsning og skyll med DPBS tre ganger i 5 min.
  9. Påfør sekundært antistoff per produsentens instruksjoner og farge med en passende kjernefysisk fargestoff.
  10. Fjern antistoffløsning og skyll med DPBS tre ganger i 5 min.
  11. Fjern kammer lysbilde vegger henhold til produsentens anvisninger og legge vandig montering medium direkte til cellene. Plasser et dekkglass over cellene og forsegle med neglelakk. Typiske resultater er vist i Figur 2B - 2D ved bruk av invertert konfokal-skanning mikroskopi.

6. Ex Vivo Culture Assay (figur 3A)

  1. Forberedelser
    1. Fremstille 12 ml ex vivo dyrkningsmedium ved hjelp av en (1: 1) blanding av Dulbeccos modifiserte Eagle-medium (DMEM): M199 supplert med 10%FBS og 1% Pen / Strep.
    2. I et 37 ° C vannbad, pre-varm ex vivo dyrkningsmedium og 100 ml HBSS.
    3. Delmengde 1 ml forvarmet medium i 8-12 brønner på en 24 brønners plate.
    4. Transfer forvarmes HBSS til to 10 cm 2 plater, som inneholder 50 ml hver.
  2. Isoler mus embryonale hjerter i HBSS (som beskrevet i 1.2) fra gravide dammer på 12,5 DPC.
  3. Overfør hver hjerte til en enkelt brønn av 24-brønners plate inneholdende ex vivo dyrkningsmedium. Inkuber platen ved 37 ° C, 5% CO2 med myk, vuggende manuelt eller ved hjelp av en gyngende plattform for å hindre tilslutning. Umiddelbart videre til trinn 7.1.

7. Epikardial Merking og EMT Induksjon i ex vivo kulturer

  1. Å merke epikardet, forberede 12 ml 37 ° C ex vivo dyrkingsmedium supplert med 3,0 x 10 6 PFU / ml Ad / GFP. For målrettet ablasjon av floxed alleler, overføring 6 ml Ad / GFP supplert kulturmedium til en ny 15 ml konisk rør. Legg Ad / Cre eller tak adenovirus til en sluttkonsentrasjon på 1,5 x 10 6 pfu / ml.
    Merk: Forsterkning av funksjonsanalyser kan også utføres med passende adenoviral genavlevering.
  2. fjerne dyrkningsmediet forsiktig fra hver brønn på 24-brønners plate ved anvendelse av en P1,000 pipettespiss.
  3. Tilsett dyrkingsmedium supplert med adenovirus (es) til hver brønn.
  4. Inkuber platen ved 37 ° C, 5% CO2 i 24 timer med forsiktig vugging.
  5. For EMT induksjon, fremstille 12 ml 37 ° C ex vivo dyrkningsmedium inneholdende 10 ng / ml TGF-β1 og 20 ng / ml blodplateavledet vekstfaktor (PDGF) -BB eller bærer (4 mM HCl inneholdende 1 mg / ml BSA ).
  6. fjerne kulturmedium forsiktig fra hver brønn på 24-brønners plate ved anvendelse av en P1,000 pipettespiss. Skyll forsiktig hjertene med 1 ml DPBS.
  7. Fjern DPBS og fylle hjerter med ex vivo kultur megdium inneholdende TGF-β1 og PDGF-BB eller kjøretøy.
  8. Inkuber i 24 timer ved 37 ° C, 5% CO 2 med milde rocking.

8. Kryopreservering og Immunohistochemistry av ex vivo kulturer

  1. Forbered Hearts for kryokonservering.
    1. Fjerne kulturmediet og vaskes hjerter to ganger med is-kald DPBS.
    2. Tilsett 1 ml 4% (v / v) paraformaldehyde til hvert hjerte og fikse for 2 timer ved 4 ° C med milde rocking.
    3. Fjern fiksativ og vask hjerter to ganger med DPBS. Overfør hjertene til friske brønner med 1 ml 10% (vekt / volum) sukrose fremstilt i DPBS. Platen inkuberes over natten ved 4 ° C med milde rocking.
    4. overføre nøye hjerter til nye brønner med 18% (vekt / volum) sukrose fremstilt i DPBS. Platen inkuberes over natten ved 4 ° C med milde rocking.
    5. Overfør hvert hjerte til en cryomold inneholder vev frysemedium. Umiddelbart fryse blokker med flytende nitrogen og oppbevares ved -80 & #176, C.
  2. § hjerter på 5 mikrometer ved hjelp av en cryostat og sted vevssnitt på positivt ladede objektglass. Oppbevares lysbilder ved -80 ° C til farging.
  3. Utføre immunhistokjemi på seksjoner for deteksjon av under epikardiell basalmembran.
    1. Tine lysbilder i minst 30 minutter ved romtemperatur.
    2. Rehydrere seksjonene ved å vaske to ganger i DPBS i 5 min med milde rocking.
    3. Permeabilize seksjon med 0,1% (v / v) Triton X-100 i PBS i 5 min ved romtemperatur.
    4. Vask lysbildene to ganger i DPBS i 5 min med milde rocking.
    5. Blot av overflødig DPBS og definere farging regionen med en hydrofob merking penn. Blokkseksjoner med 10% serum i DPBS i 30 minutter ved romtemperatur.
    6. Fjern blokk og bruke kollagen type IV antistoff (ColIV, 1: 200) fortynnet i blokk. Inkuber over natten ved 4 ° C i en fuktighetskontrollert kammer.
    7. Vask lysbildene tre ganger i DPBS for5 min med milde rocking.
    8. Fortynnet fluorescens-konjugert sekundært antistoff (1: 500) og DAPI (1: 5000) i DPBS og gjelder for lysbildene. Inkuber i 1 time ved romtemperatur. Velg en passende sekundært antistoff med en emisjon og eksitasjon bølgelengde forskjellig fra GFP.
    9. Vask lysbildene tre ganger i PBS i 5 min med milde rocking. Mount lysbilder med monteringsmedium.

9. Imaging og Kvantifisering av ex vivo kulturer

  1. Ha en blindet brukerbilde og kvantifisere fargete snitt. Dette bildet er minst fem ikke-sammenhengende vevssnitt fra et gitt hjerte i 4-5 vilkårlige steder langs epikardet (kanten av hjertet) ved bruk av en fluorescerende eller konfokalt mikroskop ved 40X forstørrelse. Typiske resultater er vist i figur 3B ved hjelp av invertert konfokal-skanning mikroskopi.
  2. telle manuelt, det totale antall GFP positive celler i et gitt bilde. Identifisere migrerer EPDC som GFP pomerksomme celler lokalisert innenfor eller utenfor ColIV subepicardial basalmembran. Bestemme den prosent av GFP migrerende celler som antallet trekkende GFP-positive celler i løpet av det totale antall GFP positive celler i et gitt bilde. Typiske resultater er vist i figur 3C-D ved anvendelse av invertert konfokal-skanning mikroskopi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Epikardet kan effektivt isoleres ved hjelp av en utvekst kultur analyse ved å utnytte sin utvendig plassering og utnytte utviklings plastisitet og iboende vandringsmønstrene hos EPDC. Murine embryonale hjerter er isolert ved E11.5 før epikardiell EMT og kultivert ryggsiden ned på kollagen-belagt kammer lysbilder 26 (figur 1A, B). Eksplanterte hjerter vil fortsette å trekke seg sammen; vil imidlertid epikardet holde kollagen matrise og migrere bort fra hjertemuskelen innen 24 timer med kultur (figur 1C). Epikardiale celler kan observeres som kommer fra hjertet med brostein lignende morfologi, en indikasjon på mesothelial identitet (Tall 1C-E). Etter 24 timer med kultur, er epikardet fattig hjerter fjernet for gen eller protein uttrykk analyse.

I tillegg til å observere epithelial morfologi, kan renheten av epikardiale cellekulturer bli ytterligere validert av uttrykket av epikardiale bundne gen- og proteinmarkører. Epikardiale celle explants vise robust uttrykk for epikardiale og mesothelial markører (Aldh1a2, Tcf21, og WT1) og lav uttrykk for cardiomyocyte gener (Nkx2-5 og Myh7) sammenlignet med epikardet fattige hjerter (Figur 2A). For ytterligere å bekrefte identitet, er epikardiale cellekulturer fast 48 timer etter hjerte fjerning og co-farget med antistoffer mot Wilm tumor 1 (WT1) og zona okkludens protein 1 (ZO1) å merke mesothelial celler og inter tett veikryss, henholdsvis 37,38 ( figur 2B). Dette utvekst dyrkningsmetode som gir en forholdsvis høy renhet av mesothelial celler; imidlertid, kan brukerne observere en liten prosentandel av celle forurensning. Fibroblaster og glattmuskelceller oppviser en langstrakt mesenchymale fenotype med et bemerkelsesverdig fravær av nuclear WT1 og organisert tett veikryss (Figur 2C). Feilsøking av teknikker for å begrense mengden av ikke-epikardiell celle forurensning ekspanderes i diskusjonen.

Eksplantatet utvekst metoden er et nyttig system for kulturutspørring epikardiell biologi in vitro. For å demonstrere epikardiell celle plastisitet, ble eksplantater stimulert med TGF-β1 [10 ng / ml] for å indusere transdifferensiering inn i mesenchymale celler 26,28. Etter 24 timers stimulering, EPDC innta en mesenchymale fenotype med redusert ZO1 farging og robust de novo dannelsen av glatte muskel a-aktin positive spennings fibre (ACTA2 eller SMA), spesielt ved periferien av kulturen 39 (figur 2D, rød). I motsetning til stress fiber sammenstillingen ved periferien av eksplantater, konfluente epikardiale celler med flere definerte intercellulære kontakter (ZO1, grønt) i sentrum av en monolayer skjerm ACTA2 protein uttrykk i kortikale aktin.

I tillegg til å gjennomgår EMT, vil EPDC invadere hjertemuskelen og differensiere, utgjør en betydelig andel av ikke-cardiomyocyte populasjoner. Motiliteten av EPDC kan vurderes ved hjelp av et tidligere etablert ex vivo organ kultursystem, hvorved det ytre av E12.5 hjerter er merket med en adenovirus som uttrykker GFP 9,18 (figur 3A). Merkede hjerter er ytterligere dyrket i tre dager i nærvær av TGF-β1 [10 ng / ml] og PDGF-BB [20 ng / ml] for å fremme EPDC migrasjon. Organkulturer blir periodisk rotert for å forhindre adhesjon av ex vivo hjerter på overflaten av kulturplater. Dette systemet muliggjør effektiv merking av hele epikardet og vurdering av EPDC motilitet i en tredimensjonal modell, i motsetning til retnings migrasjon med in vitro skrape analyser. Migrasjon av EPDC er dialektikkenVed som invasjonen av GFP positive epikardiale celler inn i eller utenfor ColIV (rød) subepicardial basalmembran 16 (Tall 3B, C). For å illustrere nytten av dette systemet, har vi nylig vist at manipulering av MRTF / SRF aliserte akse kan påvirke motilitet av EPDC 9. Sletting av Mrtfa og Mrtfb av Cre-mediert fjerning av floxed alleler (MRTFdKO) demper migrasjon av EPDC inn i subepicardial plass. Motsatt, tvunget uttrykk for MRTF-A (Ad / MRTF-A) i C57BL / 6 hjerter fører til økt EPDC migrasjon og forstyrrelse av ColIV basalmembran (Tall 3C, D).

Gene Framover Omvendt NCBI Tiltredelse
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabell 1: sekvenser av forover og bakover Primere brukt for validering av Epikardial utvekst Kultur Purity ved analyse av epikardet og Myokard Restricted Gene Expression Gene uttrykk bestemmes av QRT-PCR wi.th følgende parametere: denaturering ved 95 ° C i 10 sekunder; annealing ved 60 ° C i 30 sekunder; gjenta 50x sykluser.

Figur 1
Figur 1: Isolering av primær epikardiale celler under anvendelse av en utvekst Culture Assay (A) En skjematisk fremstilling av det epikardiale utvekst eksplantatet analysen med en anbefalt tidslinje for epikardiell modulering og analyse.. (B - E) Representative lysfelt bilder av ulike tidspunkter i løpet av eksplantering analysen. (B) embryonale dag E11.5 murine hjerter er plassert ryggsiden ned på en kollagen underlaget. (C) epikardiell celler (hvite pilspisser) vil begynne å migrere av hjertet innen 3-4 timer av kultur. Blodceller (svarte piler) kan akkumuleres i nærheten eller dekke explants under epikardiell utvekst. (D, E) Etterca 24 timer av kultur, hjerter fjernet og epikardiale monolag fortsatt levd opp til kammeret lysbildet. Cellular utvekster vise epitelial morfologi med en brostein lignende arrangement av celler. Skala barer = 250 pm (BD) eller 50 um (C, E). H = hjerte, LA = venstre atrium, LV = venstre hjertekammer, OFT = utstrømningen kanalen, RA = høyre atrium, RV = høyre ventrikkel. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2: Evaluering av Epikardial celleutvekst Purity (A) QRT-PCR validering av epikardiale begrenset markører (Tcf21, Aldh1a2, og WT1) i utvekst kulturer i forhold til hjerteinfarkt genekspresjon (Nkx2-5 og Myh7) i epikardet fattig E11.. 5 hjerter. data representertt gjennomsnitt ± SEM (n = 8 per gruppe). Stjernene betegne statistisk signifikans ved hjelp av en Student t-test med **** P <0,0001. (B) Representant co-immunfluorescens farging av ustimulerte utvekster for epikardiell uttrykk (WT1, rød), inter tett veikryss (ZO1, grønn), og kjerner (DAPI, blå). (C) Et eksempel på en celle forurensning i en utvekst kultur. Epikardiale celler (stjerne) er observert på høyre side av panelet med karakteristiske mesothelial identitet (atom WT1, rød) og organiserte epitelceller tett veikryss (ZO1, grønn). De tilstøtende cellene i sentrum (hvite pilspisser) oppviser et langstrakt mesenchymale morfologi, som er vist ved differensiell interferens kontrast (DIC) avbildning, med minimal atom WT1-proteinet, og uorganisert ZO1 farging. (D) epikardiale cellekulturer ble stimulert med kjøretøyet (4 mM HCI i 1 mg / ml BSA) eller TGF-β1 [10 ng / ml] for å indusere epikardiellEMT. TGF-β1 stimulering fremmer robust ekspresjon av ACTA2 (rød) i kortikale regioner av konfluente celler i sentrum av eksplantater eller i stress fibre av celler som migrerer i kanten eller periferien av monolaget. Cellevoksninger er merket med ZO1 (grønn). Skala barer = 25 mikrometer (BD). Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3: Ex Vivo Vurdering av EPDC motilitet (A) En skjematisk tidslinje av ex vivo hjertet kultur analysen.. (B) En representant fem mikrometer del av en C57BL / 6 E12.5 hjerte omformet med Ad / GFP (grønt) for 24 timer å merke utsiden av hjertet. Ex vivo hjerter var deretter dyrket i ytterligere 48 timer med TGF β1 [10 ng / ml]og PDGF-BB [20 ng / ml] for å stimulere EPDC migrasjon. Snittene ble co-farget for ColIV (rød) for å merke subepicardial basalmembran og kjerner (DAPI, blå). Ex vivo hjerte kultur morfologi er vist ved DIC. LV = venstre hjertekammer, RV = høyre ventrikkel, RA = høyre atrium. (C, D) Et eksempel på anvendelse av ex vivo migrering assay ved å modulere MRTF / SRF regulerende akse. Dette tallet har blitt forandret fra [9]. E12.5 hjerter ble isolert fra Mrtfa - / -;. Mrtfb fl / fl embryoer og omformet med Ad / GFP og en kontroll virus eller et adenovirus som uttrykker Cre rekombinase for 24 timer Ex vivo kulturer ble deretter stimulert med TGF-β1 [10 ng / ml] og PDGF-BB [20 ng / ml] i ytterligere 48 timer. EPDC motilitet (hvite piler) er observert som migrasjon av GFP positive celler (grønn) i eller utenfor ColIV (rød). Cre-mediert sletting av Mrtfb i <em> Mrtfa - / - bakgrunn (MRTFdKO) resulterer i demping av EPDC migrasjon sammenlignet med kontroll hjerter. Motsatt, tvunget uttrykk for MRTF-A (Ad / MRTF-A) i E12.5 C57BL / 6 hjerter forbedrer EPDC migrasjon. (D) Kvantifisering av% GFP positive celle migrasjon. Data er presentert som gjennomsnitt ± SEM (n = 4 hjerter for hver betingelse). Data ble analysert ved hjelp av en enveis ANOVA med stjerner som viser statistisk signifikans ved Tukey post-hoc tester med **** P <0,0001. Skala barer = 200 um (B) eller 25 um (C). Alle bildene ble anskaffet ved hjelp invertert konfokal laser scanning mikroskopi. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her skisserer vi detaljerte metoder for å isolere primær epikardiell celle ved utvekst og spore EPDC migrasjon i ex vivo hjerte kulturer. For utvekst kulturer, den passende tid til å fjerne den epikardet fattige hjerte varierer noe mellom eksperimenter. Periodisk overvåkning av eksplantater etter en inkubasjon over natten anbefales for å måle omfanget av epikardiell utvekst og for å trekke ut hjertet før fibroblaster vises. For å sikre renhet, bør hjerter fjernes innen 24 timer fra eksplanteres å hindre opphopning av ikke-epikardiale linjene. Trimming bort utløpskanalen og begge atriene før overføring hjertet til et kammer lysbilde kan også redusere forurensende celletyper 27,40. Siden foster hjerter isolert fra en mus kull i løpet av et kort tidsrom og dyrket under de samme betingelser, er tiden for utvekster skal vises relativt lignende fra en hjerte til en annen i løpet av et eksperiment. Derfor bør alle hjerter be fjernet når flertallet av explants vise epikardiale utvekster. I noen tilfeller trenger epikardiale cellene ikke vandrer ut effektivt fra et hjerte som er prosjekt hardere enn de andre, og i så fall dette explant må utelukkes fra forsøket.

Oppbyggingen av blodceller kan ofte skjule en flat monolag av epikardiale celler (piler, figur 1C), noe som gjør det vanskelig å visualisere utvekster. For å unngå overdreven blodlegemer bidrag kan hjerter forbli i HBSS i noen minutter ved disseksjon fra embryo. Dette gir tilstrekkelig tid for fosterets hjerte til å pumpe ut blodrester i hjertekamrene før de blir overført til et kammer lysbilde. Alternativt vil supplere de kulturer med explant medium A etter den første natten inkubasjon bidra til å skylle bort litt overflødig blod og avsløre utvekster; imidlertid bør nivået av mediet ikke stige over hjertet som overflatespenningen kan føre til at hjertettil å trekke bort fra substratet. Robuste epikardiale utvekster er observert ved bruk av kollagen type I som dyrkingssubstratet; imidlertid har andre substrater vært rapportert avhengig av organismen og / eller anvendelse 27,40-42. Ved hjelp av denne protokollen, kan primær føtale epikardiale celler trives i 4 dager etter hjerte fjerning og daglig medium påfyll; bør imidlertid eksperimentelle design som krever lengre perioder av kulturen bestemmes av sluttbrukeren. Siden epikardiell EMT er sterkt aktivert under embryonal utvikling, er dette utvekst kulturen teknikken begrenset til berikelse av føtale epikardiale celler. Andre grupper har beskrevet metoder for å isolere voksne epikardiale celler 43,44.

For ex vivo migrasjonsanalyser, hjerte utvinning og epikardiell celle merking anbefales på E12.5 av to grunner. Først hjerter isolert etter E12.5 er større og dermed kreve mer perfusjon for å støtte levedyktighet. Enkel diffusjon av næringsstoffers er ikke tilstrekkelig til å opprettholde organkulturer fra større hjerter. For det andre, epikardiell EMT og EPDC migrasjon skje rundt E12.5. Derfor bør epikardet merkes med et adenovirus som uttrykker et fluorescent protein umiddelbart etter hjerte ekstraksjon for å maksimalisere deteksjon av EPDC. Alternativt har carboxyfluorescein diacetate succinimidyl ester (CFSE) tidligere blitt rapportert å merke utsiden av hjertet og spor EPDC migrasjon 10,45.

I motsetning til utvekst analyser, bør ex vivo kulturer bli vugget jevne mellomrom for å unngå hjerte vedlegg og epikardiell celle utvekst. Kulturer kan også være kontinuerlig opphisset i en inkubator utstyrt med en rocker på laveste hastighet. Brukerne vil merke endringer i hjerte morfologi i løpet av få dager med orgel kultur og bør unngå analyser utover 72 timer for hjerte isolasjon. Ved hjelp av denne analysen, er EPDC invasjon observert innen 48-72 timer av kultur. Mens Cre-loxP systemhar vært benyttet in vivo for å kartlegge lokalisering av EPDC til koronar blodkar, myokard interstitium, og det interventrikulære septum 7,22, dette ex vivo teknikken er begrenset til EPDC migrering løpet av noen få cellelagene i den under epikardiell plass. Dermed er denne metoden mer egnet for å bestemme regulatorer av EPDC motilitet og invasjon i stedet for å definere den endelige destinasjonen for trekkende EPDC.

Epikardiale celleisolasjoner og ex vivo migrasjon analyser, i kombinasjon med gevinst eller tap av funksjon nærmer seg, har allerede vist seg nyttig for å vurdere kandidat gener som kan påvirke EPDC biologi 9,18,46. Disse metodene gir også en plattform for gevinst-of-funksjon eller tap-av-funksjon skjermer for å identifisere nye regulatorer av EPDC migrasjon. Denne strategien, i forbindelse med fluorescens aktivert celle sortering eller enkelt celle RNA-sekvensering, kan også gi en mulighet til å sondere epikardiell heterogenitetog EPDC differensiering i større detalj. Endelig modifikasjoner av disse fremgangsmåtene kan brukes til å utvikle skjermer for små molekyler som påvirker epikardiell cellebiologi og EPDC i den hensikt å hjerte regenerativ medisin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noe å avsløre.

Acknowledgements

EMS ble støttet med tilskudd fra National Institutes of Health (NIH) [tilskuddet antallet R01HL120919]; American Heart Association [tilskuddet antallet 10SDG4350046]; University of Rochester CTSA pris fra NIH [tilskuddet antallet UL1 TR000042]; og oppstart midler fra Aab CVRI. MAT ble støttet delvis av et stipend til University of Rochester School of Medicine og odontologi fra Howard Hughes Medical Institute Med-Into-Grad Initiative; og en institusjonell Ruth L. Kirschstein National Research Service Award fra NIH [tilskuddet antallet GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics