Epikardiyal dışsal gelişimi Kültürü Deneyi ve

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

epikardiyal hücreleri hatları bir tek katmanlı kalp, kardiyomiyosit çoğalmasını teşvik parakrin faktörler sağlanması ve gelişiminin doğrudan ve hastalık sırasında kardiyovasküler atalarıdır katkıda bulunmaktadır. bir dizi faktör epicardium-kaynaklı hücre (EPDC) harekete karışmış olsa da, bunların daha sonraki göç ve farklılaşmayı düzenleyen mekanizmalar tam olarak anlaşılamamıştır. Burada, EPDC motilite ve farklılaşma çalışma vitro ve ex vivo stratejileri sunuyoruz. İlk olarak, embriyonik fare kalp sonucudur kültürü birincil epikardiyal hücreleri elde etmek için bir yöntem açıklanmaktadır. Ayrıca, bir organ kültür sisteminde etiketli EPDC, üç boyutlu taşıma değerlendirmek için detaylı bir protokol getirmektedir. Biz epicardium içinde myocardin ilgili transkripsiyon faktörlerinin genetik silme EPDC göç zayıflatan bu teknikleri kullanarak kanıtlar sunmaktadır. Bu yaklaşım EPDC aday değiştiricileri değerlendirmek için bir platform olarak hizmet vermektedirbiyoloji ve kardiyak onarım için yararlı olabilir EPDC harekete yeni düzenleyici belirlemek için genetik veya kimyasal ekranlar geliştirmek için kullanılabilir.

Introduction

epicardium mezotel hücreleri tek bir tabaka olduğunu çizgiler kalp ve etkileri kalp gelişme, olgunlaşma ve onarım. Parakrin sinyaller son derece koordineli alışverişi yoluyla, myokard ve endokard arasındaki yakın diyalog kalp büyümesi ve non-miyosit kalp soy 1 oluşumu için vazgeçilmezdir. Epikardiyal türetilmiş hücreler (EPDC) epitelyal-to-mezenkimal geçiş (EMT) 2 ile epikardiyal hücrelerinin bir alt kümesi ile ilgili ortaya, subepikardiyal alanı ve temel miyokard işgal, ve büyük ölçüde, koroner vasküler duvar hücreleri ve kalp fibroblastlannın içine ayırt, ve a daha az bir ölçüde, endotelyal hücreler ve kardiyomiyositlerde 3-9.

Epikardiyal EMT ve EPDC istilası düzenleyen mekanizmaların salgı 10-13 hücre yüzeyi reseptörlerinin ve yapışma moleküllerinin 14,15, dede de dahil olmak üzere, çeşitli moleküllerin koordine hareket bağlanmıştırapikal-bazal polarite 16,17, küçük GTPases 18,19 ve transkripsiyon lators 2,20,21 faktörleri. EPDC göç moleküler efektör birçok tanımlanmış olmasına rağmen, stratejilerin gelişimini hızlandırmak olabilir embriyoda EPDC seferberlik teşvik fizyolojik sinyallerin daha iyi anlaşılması gelişmiş kardiyak onarım için yetişkin bu süreci manipüle etmek.

EPDC seferberlik yeni regülatörleri tespit etmeyi amaçlayan çalışmalar bu hücre popülasyonunun saflaştırılması veya bireysel epikardiyal hücrelerin göçünü izleme güveniyor. Bir veya WT1, Tcf21, Tbx18 ve / veya Aldh1a2 içeren işaretçi genler, bir arada, yaygın olarak fetal epikardiyumu 1 tanımlamak için kullanılır. Bununla birlikte, bu markerlerin kullanımı epikardiyal hücreleri transdif getirildiğinde epikardiyal markerlerin sentezlenmesi kalp gelişimi boyunca azalıyor ve genellikle kaybedilir EPDC optimal değildir göç izlemekmezenkimal hücreler içine ferentiation.

Cre / loxP sisteminin uygulanması, soy-izleme muhabirleri ile birlikte, kalıcı kalp gelişimi sırasında epikardiyumu ve kökenini etiketleme ve yetişkin 7,22,23 iskemik yaralanma aşağıdaki yararlı olmuştur. Çeşitli epikardiyal kısıtlı Cre hatları üretildiğini ve yaygın EPDC etiket ve koşullu gen silme stratejileri 1 için kullanılır. Bu çalışmalar çeşitli epikardiyal soylarının karakterizasyonu ve EPDC motilite ve farklılaşmasının önemli aracılar belirlenmesine yol açmıştır. Ancak, biriken kanıtlar da epicardium progenitör hücrelerin 4,24,25 heterojen bir nüfusu olduğunu göstermektedir. Böylece, epikardiyal hücrelerin sadece bir alt kümesi verilen Cre sürücüsü kullanılarak hedef olacaktır.

ne olursa olsun Cre özgüllük tüm epikardiyumu etiketlemek için, laboratuvarların sayısı akıbet cul kullanmış olmasıTure sistemleri veya ex vivo organ kültürü yöntemleri sadakatle izole veya 26-28 işaretleme kalemler genetik soy ifadesi bağlı olmaksızın epikardiyal hücreleri etiketlemek için. Ex vivo olarak taşıma çalışmaları için, oluşum safhasındaki kalpler epikardiyal EMT önce ve yeşil flüoresan proteini (GFP) -expressing adenovirüs (Ad / GFP) 9,18 ile takviye edilmiş ortam içinde kültürlendi izole edilir. Bu yaklaşım verimli, tüm epikardiyumun etiketleme ziyade Cre-aracılı rekombinasyon ile hücrelerin bir alt kümesi için izin verir. Kalp kültürler sonradan EPDC 28,29 seferber uyardığı EMT bilinen indükleyicileri maruz kalmaktadır. Ex vivo ve in vivo analizler EPDC göç sürüş detaylı mekanizmaları keşfetmek için özellikle yararlı bir yaklaşım olan in vitro epikardiyal eksplant kültürler tarafından tamamlanmaktadır.

Burada, epicardi in vitro çalışmalar için, birincil epikardiyal hücrelerin izole edilmesine yönelik yöntemleri tarif ederal EMT, hem de ex vivo olarak bir organ kültür sisteminde EPDC motilite analiz eder. Biz son zamanlarda genetik EPDC 9 aktin tabanlı göç işlemek için eksen sinyal myocardin ilgili transkripsiyon faktörü (MRTF) / serum yanıt faktörü (BAV) modülasyonu ile bu yöntemin yararını ve sağlamlığı olduğunu göstermiştir. Bulgularımız EPDC taşıma düzenleyen için gerekli bir sinyal yolunu vurgulamak da, bu yöntemler kolektif EPDC göç ve farklılaşma orkestra mekanizmaları çözülmesi için uygundur. Ayrıca, eksplant ve ex vivo kültür sistemleri kalp rejenerasyon terapötik uygulamalar için EPDC harekete yeni düzenleyici ortaya koymak için fonksiyonel ekranlarında uygulanabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOT: fare ile tüm deney Rochester Üniversitesi Hayvan Kaynakları Üniversitesi Komitesi tarafından kabul edildi.

1. Epikardiyal dışsal gelişimi Kültürü Deneyi (Şekil 1A)

  1. hazırlıklar
    1. % 5 fetal sığır serumu (FBS) ve% 1 penisilin / streptomisin (pen / strep) ile Medium 199 (M199) ilave birincil epikardiyal hücre izolasyonu için 5 mi ortam bir hazırlayın.
    2. karışımı önceden sıcak ve 100 mi, 37 ° C su banyosu içinde Hanks Dengelenmiş Tuz Çözeltisi (HBSS).
    3. kollajen kaplı bölmeli lamlar 30 dakika süreyle oda sıcaklığına ısınmaya bırakın.
    4. slaytı her bir kuyu için 100 ul ortam bir ekleyin ve yavaşça eşit şekilde kaplamak kolajen yüzeyine döner. 8-12 Kuyular için tekrarlayın. Kaplama odaları sonra ortamı çıkarın.
    5. Kısım 50 mi HBSS her biri iki adet 10 cm2'lik plakalara HBSS önceden ısıtılmıştır.
  2. 11.5 Gün Post Coitum (DPC) Gebe Barajı'ndan Embriyonik Kalpler izole edin.30
    1. intraperitonal enjeksiyon ile 13 mg / ml ketamin / 0.88 mg / 1 x Dulbecco Fosfat Tamponlu Salin (DPBS) içinde mi ksilazin kokteyl, 0.5 ml fare anestezisi. Bir ayak tutam testi kullanılarak uygun anesthetization onaylayın. Nazik tutam fare duyarlı olup olmadığını belirlemek için yeterlidir. Herhangi bir hareket veya pençe çekme hayvan yeterince ameliyat yapmak anestezi olmadığını gösterir. servikal dislokasyon ile euthanize.
    2. yukarı ventral tarafına bakan fare Lay ve saç kirlenmesini azaltmak için% 70 etanol ile karın püskürtün.
    3. forseps ile cilt sıkın ve cerrahi makas ile karın bir yan kesi kesti. sıkıca cildi tutun ve sonra baş ve kuyruk doğru yön karşıt olarak ayrı çekin.
    4. forseps ile periton sıkın ve karın boşluğuna maruz makasla kesti.
    5. Dikkatle mesometrium boyunca keserek desidua kaldırın. disseke desidua aktarın ilk HBSS önceden ısıtılmış10 cm 2 tabak.
    6. embriyoları arasında keserek desidua ayırın.
    7. Bir mikroskop altında önceden ısıtılmış HBSS ile ikinci 10 cm2 plakasına, bir embriyo transfer. Dikkatle sonra embriyoyu başını kesmek, extraembryonic doku ve yumurta sarısı kesesi çıkarın.
    8. forseps ile göğüs duvarı çimdik ve göğüs boşluğunu açığa orta hatta ayrı doku gözyaşı.
    9. kalp arkasında forseps yerleştirin. çıkış yolunu tutun ve embriyodan kalbini çekin. hala bağlı ise, kalpten akciğer yolu ve akciğerleri ayırın.
  3. Kollajen kaplı slayt tek bir kuyu kalp aktarın ve (Şekil 1B) o dorsal yüzü aşağıya bakacak şekilde yerleştirin. Her embriyo için adımları tekrarlayın 1.2.7-1.3.
  4. Bir kez tüm kalpler, tek tek oyuklara transfer edildi, 37 ° C 'de 30 dakika boyunca odası slayt inkübe,% 5 CO2 kollajen matris için yeterli yapışmayı sağlamak için.
  5. dikkatle eklemekHer kalbin etrafında önceden ısıtılmış eksplant orta A 20-50 ul. Önemli: çok hızlı ya da kalp üzerinde bir düzeye orta katmayın aksi kalpler kollajen substrat ayırmak olabilir.
  6. Kültür yaklaşık 24 saat boyunca 37 ° C'de,% 5 CO2 de kalpler epikardiyal büyümesine izin verilir. Not: çıkıntılar kültür gibi erken 3-4 olarak hr (Şekil 1C) gözlenen ve öncelikle en az mezenkimal hücre kontaminasyonu (Şekil 1D, E) Cobblestoned morfoloji, görüntüleme mezotel hücrelerden oluşur edilebilir. Temsilcisi sonuçları bir kamera ile donatılmış bir diseksiyon mikroskobu kullanılarak elde edildi.

Epikardiyal çıkıntılar 2. Genetik Ablasyon ve EMT indüksiyonu

Dikkat: onaylı biyogüvenlik kurallarına göre özenle adenovirüsler tutun.

  1. 15 ml ortam B Hazırlama bir su banyosu içinde 37 ° C'ye kadar ön-sıcak ve (M199,% 1 FBS ve% 1 Pen / Strep ile takviye edilmiş).
  2. çıkarılmasınınfloxed allel, Cre recombinase ifade adenovirüs 2.5 x 10 4 pfu / ml (Ad / Cre) veya kontrol virüsü ile desteklenmiş eksplant orta B hazırlar.
    Not: aday genlerin adenoviral aracılı aşırı ifadesi aynı zamanda fonksiyon fenotipleri kazancını değerlendirmek için yapılabilir. Virüs titrleri, son kullanıcı tarafından belirlenmelidir.
  3. Dikkatle forseps kullanarak akıbet kültürlerden gelen epicardium tükenmiş kalpleri kaldırın. Daha sonra RNA izolasyonu ve gen ekspresyon analizi için -80 ° C'de 1.5 mi, 800 ul Trizol tüpler ve mağaza transfer kalpler.
  4. kan hücreleri ve aşırı selüler artığın ayrılması için DPBS de her bir yıkama.
  5. Her bir sonucudur kültürüne 500 ul adenovirüs (ler) ile takviye edilmiş eksplant ortam B ekleyin ve 37 ° C'de,% 5 CO2 seviyesinde 24 saat süre ile inkübe edilir.
  6. EMT indüksiyonu için, ortamını çıkarın ve yeniden birleştirici transforme edici büyüme faktörü (TGF) ile desteklenmiş 37 ° C eksplant ortamı B -β1 [10 ng / ml] ya da taşıyıcı (4 mm H ile doldurmakydrochloric asit (HCl) içeren 1 mg / ml sığır serumu albümini (BSA)). 37 ° C'de ilave bir 24 saat boyunca kültür eksplantlar,% 5 CO2. Gen / ifadesi analizleri protein ya da daha sonraki protokollerde ayrıntılı olarak immünsitokimya ile devam edin.
    Not: epikardiyal EMT indüksiyonu 0.5 ng / ml arasında değişen, TGF-ß1 çeşitli konsantrasyonları ile stimüle edilmiş - 10 ng / ml 26,31-33. Ligand daha yüksek konsantrasyonları, TGF-β reseptörlerine spesifik olmayan bağlanma ile sonuçlanabilir. TGF-ß1 konsantrasyonu spesifik deneysel hedefleri yansıtmalıdır.

Epikardiyal çıkıntılar 3. Gen İfadesi Analizi

  1. Daha önce Trizol (2.2) saklanan Çözülme epicardium tükenmiş kalpler.
  2. EPDC kültürlerden aspire medya ve DPBS ile iki kez yıkayın.
  3. kültürleri eksplant 800 ul oda sıcaklığı Trizol ekleyin.
  4. Oda temperatu 5 dakika boyunca Trizol içinde epicardium-tükenmiş kalpleri ve EPDC kültürleri inkübe yeniden. yukarı pipet ve on kat aşağı parçalanmış örnek homojenize etmek.
    Not: Kalpler tamamen homojenize için daha fazla pipetleme gerektirebilir.
  5. 1.5 ml tüplere lizatları aktarın ve üreticinin talimatlarına göre toplam RNA izolasyonu ile devam edin. RNA verimi artırmak için önce yağış 10 ug glikojen ekleyin. Belirli bir eksplant yaklaşık 0.5-1.0 ug RNA verecektir.
  6. DNaz I ile kirletici DNA çıkarın ve üreticinin talimatlarına göre 0.5 mikrogram mRNA yazıya ters.
  7. Yeşil SYBR ve gliseraldehid 3-fosfat dehidrojenaz (GAPDH) için Tablo 1. Normale mRNA seviyelerini tarif belirteçleri kullanarak epikardiyal eksplantlar ve / veya kantitatif ters transkripsiyon ile EMT indüksiyonu saflığını (qRT) -PCR 34 doğrulayıp kullanarak göreceli ifade hesaplanması 2 - ΔΔCt yöntemi 35. Tipik sonuçlar Şekil 2A'da gösterilmiştir.
Epikardiyal çıkıntılar başlığı "> 4. Protein Analizi

  1. EPDC kültürlerden aspire medya ve DPBS ile iki kez yıkayın.
  2. 10 ul buz soğukluğunda bir protein lizis tamponu (50 mM Tris pH 7.5, 150 mM sodyum klorür, 1 mM etilendiamintetraasetik asit pH 8.0,% 1 Triton X-100, 1 x proteaz inhibitör kokteyli) her bölmeye ekleyin ve odasına slayt yer buz. P200 pipet yaklaşık alt ¼ kesti ve slayt kapalı hücreleri kazımak için kalan parçasını kullanın. Pipet yukarı ve lize epikardiyal hücreleri ve 1.5 ml tüp transfer aşağı.
  3. 30 saniye ve KAPALI döngüsü ile bir buzlu su banyosu içinde 5 dakika için düşük (160 W) ile lize eksplantlar sonikasyon.
  4. 10,000 x, 4 ° C'de 10 dakika süreyle santrifüj lizatları. Bir tüpe süpernatantı aktarın ve bir protein tahlili 36 kullanarak protein konsantrasyonunu belirleyin.
    Not: Belirli eksplant kadar 1.5 ug toplam protein verecektir. Biz bulduk iki kalpleri havuzu eksplantlar biroyuk başına D Yükleme 2 ug protein düz kas α-aktin (ACTA2) ve GAPDH 9 tespit etmek için yeterlidir. Diğer hedef proteinlerin tespiti, son kullanıcı tarafından belirlenen çok eksplant örnekleri havuzu gerektirebilir.

Epikardiyal çıkıntılar 5. İmmünositokimya

  1. eksplant kültürlerden ortamı çıkarın ve DPBS ile iki kez yıkayın.
  2. Yavaşça sırasıyla o C -20 ° C'de, oda sıcaklığında 5 dakika ya da 10 dakika için eksplantlar her kuyuya% 4 (hacim / hacim) paraformaldehid ve buz soğukluğunda metanol 500 ul ekleyin ve düzeltin. üretici tarafından tavsiye edildiği gibi antikor şartnamesine uygun sabitleyin.
  3. 5 dakika boyunca üç kez Fiksatif çıkarın ve DPBS ile de her durulama.
  4. 5 dakika boyunca DPBS'de% 0.1 500 ul (hac / hac) Triton X-100 hücreleri geçirgenliği.
  5. 5 dakika boyunca üç kez geçirimli hale çözeltisi çıkarın ve DPBS ile durulayın.
  6. Oda temperatu 30 dakika boyunca DPBS içinde% 10 serum ile bloke ediliryeniden.
  7. üreticinin tavsiyelerine ve son kullanıcı tarafından belirlenen optimum koşullarda başına birincil antikor boyama ile devam edin.
  8. 5 dakika boyunca üç kez antikor çözüm çıkarın ve DPBS ile durulayın.
  9. Uygun bir nükleer boya ile üreticinin talimatlarına ve karşıt başına sekonder antikoru uygulayın.
  10. 5 dakika boyunca üç kez antikor çözüm çıkarın ve DPBS ile durulayın.
  11. üreticinin talimatlarına göre bölme slayt duvarları kaldırmak ve hücrelere doğrudan sulu montaj orta ekleyin. hücreler üzerinde lamel yerleştirin ve tırnak cilası ile mühür. Ters konfokal tarama mikroskobu kullanarak 2D - Tipik sonuçları Şekil 2B gösterilmiştir.

6. ex vivo kültür deneyi (Şekil 3A)

  1. hazırlıklar
    1. Hazırlama 12 mi EX kullanılarak kültür ortamı in vivo: Dulbecco'nun Modifiye Edilmiş Eagle Ortamı (DMEM) (1 1) karışımı: M199,% 10 ile takviye edilmişFBS ve% 1 Pen / Strep.
    2. 37 ° C su banyosu içinde ön-sıcak ex vivo kültür ortamı ve 100 ml HBSS.
    3. Kısım 1 mi 24 plaka 8-12 kuyu içine orta ısıtılmış ön.
    4. Başına 50 mi, her biri, iki adet 10 cm2'lik plakalara HBSS önceden ısıtılmıştır.
  2. 12.5 DPC'de hamile barajlardan (1.2 anlatıldığı gibi) HBSS fare embriyonik kalpleri izole edin.
  3. Ex vivo kültür ortamı içeren 24 çukurlu bir levhanın tek bir kuyusuna Her kalp aktarın. 37 ° C'de, hafif bir el sallanan ve yapışmasını engellemek için bir sallanan platform kullanılarak,% 5 CO2 inkübe plakası. Hemen 7.1 adıma geçin.

7. Ex Vivo Kültürleri Epikardiyal Etiketleme ve EMT İndüksiyon

  1. , Epikardiyumu etiket Reklam / GFP 3.0 x 10 6 pfu / ml ile desteklenmiş 37 ° C ex vivo kültür ortamı 12 ml hazırlamak. floxed alellerin hedeflenen ablasyon, A transferi 6 ml içind / GFP yeni bir 15 ml konik tüp kültür ortamı desteklenmiştir. Reklam / Cre ekleme veya 1.5 x 10 6 pfu / ml'lik bir nihai konsantrasyona kadar adenovirüs kontrol eder.
    Not: fonksiyon kazancı, aynı zamanda, uygun bir adenoviral aracılığıyla gen teslimi ile gerçekleştirilebilir analizleri.
  2. Dikkatlice P1,000 pipet kullanılarak 24 çukurlu bir levhanın her çukuruna kültür ortamının çıkarın.
  3. Yavaşça her oyuğa adenovirüs (ES) ile takviye edilmiş kültür ortamı ilave edin.
  4. Hafifçe çalkalanarak 24 saat boyunca 37 ° C'de,% 5 CO2 inkübe plakası.
  5. EMT indüksiyonu için, 37 ° C, ex vivo 10 ng / ml TGF-ß1 ve 20 ng / ml trombosit türevi büyüme faktörü (PDGF) -BB veya aracına ihtiva eden kültür ortamı (4 mM HCI ihtiva eden 1 mg / ml BSA 12 mi hazırlanması ).
  6. Dikkatlice P1,000 pipet kullanılarak 24 çukurlu bir levhanın her çukuruna kültür ortamının çıkarın. Yavaşça 1 ml DPBS kalpleri durulayın.
  7. DPBS kaldırmak ve ex vivo kültür kalpleri doldurmak banaTGF-ß1 ve PDGF-BB veya araç içeren dium.
  8. Hafifçe çalkalanarak 37 ° C'de 24 saat,% 5 CO2 inkübe edin.

8. Soğukta Saklama ve İmmünohistokimya Ex Vivo Kültürlerin

  1. Kiropresarvasyon için Kalpler hazırlayın.
    1. Kültür Ortamı çıkarın ve buz-soğuğu DPBS ile iki kez kalpleri yıkayın.
    2. Her bir kalp% 4 (hacim / hacim) paraformaldehit 1 ml ilave edilir ve hafifçe çalkalanarak 4 ^ 'de 2 saat süre ile düzeltin.
    3. Fiksatif çıkarın ve DPBS ile iki kez kalpleri yıkayın. 1 mi,% 10 DPBS hazırlandı (ağırlık / hacim) sukroz ile taze oyuklara kalpleri aktarın. hafifçe çalkalanarak 4 ^ 'de bir gece boyunca inkübasyona bırakılır.
    4. Dikkatle% 18 DPBS hazırlandı (ağırlık / hacim) sukroz ile yeni kuyu kalpleri aktarın. hafifçe çalkalanarak 4 ^ 'de bir gece boyunca inkübasyona bırakılır.
    5. Doku donma orta içeren bir cryomold her kalbi aktarın. Hemen -80 & # sıvı azot ve mağaza kullanarak blokları dondurmak176 ° C.
  2. Pozitif yüklü mikroskop lamı üzerine Kriyostaz ve yer doku bölümleri kullanılarak 5 mikron de bölüm kalpler. Mağaza boyama kadar -80 ° C 'de kayar.
  3. alt epikardiyal bazal membran tespiti için bölümlerinde immünohistokimya gerçekleştirin.
    1. Oda sıcaklığında, en az 30 dakika boyunca slaytlar çözülme.
    2. hafifçe çalkalanarak 5 dakika boyunca DPBS içinde iki kez yıkanarak bölümleri rehidrate.
    3. Oda sıcaklığında 5 dakika boyunca PBS içinde% 0.1 (h / h) Triton X-100 ile birlikte Permeabilize bölümü.
    4. hafifçe çalkalanarak 5 dakika boyunca DPBS içinde iki kez slaytlar yıkayın.
    5. Fazla DPBS kapalı leke ve bir hidrofobik etiketleme kalemle boyama bölgeyi tanımlamak. Oda sıcaklığında 30 dakika boyunca DPBS içinde% 10 serum ile blok bölümleri.
    6. blok içinde seyreltilmiş kolajen tip IV antikoru (200 ColIV, 1) blok çıkarın ve uygulanır. nem kontrollü bir odacıkta 4 ° C'de gece boyunca inkübe edilir.
    7. için DPBS slaytlar üç kez yıkayınhafifçe çalkalanarak 5 dak.
    8. DPBS ve slaytlar için geçerlidir: ve DAPI (5.000: 1) floresan konjuge sekonder antikor (500 1) seyreltin. Oda sıcaklığında 1 saat inkübe edin. GFP farklı emisyon ve uyarım dalga boyu ile uygun bir ikincil antikor seçin.
    9. hafifçe çalkalanarak 5 dakika boyunca PBS içinde kayan üç kez yıkayın. Montaj orta montaj slaytlar.

9. Görüntüleme ve Niceleme Ex Vivo Kültürlerin

  1. bir kör kullanıcı imaja sahip ve lekeli bölümleri ölçmek. epikardiyumun (kalbin kenar) 40X büyütme floresan veya konfokal mikroskop kullanılarak boyunca 4-5 keyfi yerlerde belirli bir kalp Image en az beş ardışık olmayan doku bölümleri. Tipik sonuçlar ters konfokal tarama mikroskobu kullanılarak Şekil 3B gösterilmiştir.
  2. El ile belirli bir görüntüde GFP pozitif hücrelerin toplam sayısını. GFP po olarak EPDC göç tespitiçinde veya ColIV subepikardiyal bazal membran dışında bulunan, pozitif hücreler. GFP, belirli bir görüntüde GFP pozitif hücrelerin toplam sayısı üzerinden GFP pozitif hücrelerin göç sayısı gibi hücrelerin göç yüzde belirleyin. Tipik sonuçlar ters konfokal tarama mikroskobu kullanarak Şekil 3C-D gösterilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

epicardium verimli onun dış konumu yararlanarak ve gelişimsel plastisite ve EPDC içsel göç davranışı istismar ederek bir sonucudur kültür testi kullanılarak izole edilebilir. Fare embriyonik kalpleri önce aşağı kollajen kaplı odasına slaytlar epikardiyal EMT ve kültürlü dorsal tarafına E11.5 izole edilmiştir 26 (Şekil 1A, B). Eksplante kalpleri sözleşme devam edecek; Ancak, epicardium kollajen matriks uymak ve kültür 24 saat (Şekil 1C) içinde miyokardın kapalı göç edecek. Epikardiyal hücreler mezotel kimlik (Şekil 1C-E) gösterge arnavut gibi morfolojisi ile kalp uzak yayılan görülebilir. Kültür 24 saat sonra, epikardiyum tükenmiş kalpler geni veya protein ifadesi analizi için alınır.

epitheli gözlemlenmesine ek olarakal morfolojisi, epikardiyal hücre kültürlerinin saflığı daha epikardiyal kısıtlı gen ve protein belirteçlerinin ifadesi ile doğrulanabilir. Epikardiyal hücre eksplantlar epikardiyal ve mezotel belirteçleri (Aldh1a2, Tcf21 ve WT1) ve endokard-tükenmiş kalpleri (Şekil 2A) ile karşılaştırıldığında kardiyomiyosit genin (Nkx2-5 ve Myh7) düşük ekspresyon sağlam ekspresyonunu gösterir. Ayrıca kimliğini doğrulamak için, epikardiyal hücre kültürleri sonra 48 saat sabit kalp kaldırma ve sırasıyla mezotel hücreleri ve hücreler arası sıkı kavşaklar, 37,38 etiketlemek için Wilm tümörü 1 (WT1) ve zona occludens protein 1 (ZO1) karşı antikorlar (co-lekeli Şekil 2B). Bu sonucudur kültür metodu mezotel hücreleri, nispeten yüksek bir saflık elde edilir; Ancak, kullanıcılar hücre kontaminasyon küçük bir yüzdesini gözlemek. Fibroblastlar ve yumuşak kas hücrelerinin Nükleofilik bir kayda değer olmaması ile ince uzun bir mezenkimal fenotip sergileyenWT1 ve organize sıkı kavşaklar (Şekil 2C) ar. teknikleri Giderme olmayan epikardiyal hücre kontaminasyonu miktarı tartışma genişletilmiş sınırlamak için.

Eksplant akıbet tahlil in vitro epikardiyal biyoloji sorguya için yararlı bir kültür sistemidir. Epikardiyal hücre plastisite göstermek için, eksplantlar mezenkimal hücreler 26,28 içine transdiferansiyonun indükleme [10 ng / ml], TGF-ß1 ile uyarıldı. Stimülasyon 24 saat sonra, EPDC, özellikle kültürün 39 (kırmızı Şekil 2B) çevresine, indirgenmiş ZO1 boyama ve düz kas α-aktin Pozitif stres elyafların (ACTA2 ya SMA) sağlam de novo oluşumu ile mezenkimal fenotip kabul eder. Bunun aksine, eksplant çevresinde bir monolaye merkezinde fazla tarif arası kontaklar (ZO1, yeşil) olan birleşik epikardiyal hücreleri fiber düzeneğinin streskortikal aktin r ekran ACTA2 protein ekspresyonu.

EMT geçiren yanı sıra, EPDC olmayan kardiyomiyosit popülasyonlarının önemli bir bölümünü oluşturan, miyokard istila ve ayırt edecektir. EPDC motilite E12.5 kupa dış GFP 9,18 (Şekil 3A) sentezleyen bir adenovirüs ile etiketlenir, böylece, önceden belirlenmiş eks vivo organ kültürü sistemi kullanılarak değerlendirilebilir. Etiketli kalpler EPDC taşıma teşvik etmek için, TGF-ß1 [10 ng / ml] ve PDGF-BB [20 ng / ml] varlığında üç gün daha kültürlenmiştir. Organ kültürleri periyodik kültür plakalarına yüzeyine eks vivo kalplerin yapışmasını önlemek için döndürülür. In vitro sıfırdan tahlillerle yönlü göç karşı Bu sistem, üç boyutlu bir model, tüm epikardiyumun ve EPDC motilite değerlendirilmesi etkin etiketlenmesi için izin verir. EPDC göç glikozu olanved pozitif epikardiyal hücreler içine veya ColIV (kırmızı) subepikardiyal bazal membran 16 (Şekil 3B, C) ​​ötesinde GFP işgali olarak. Bu sistemin yararlarını göstermek için, son zamanlarda EPDC 9 motilitesini etkileyebilir MRTF / SRF sinyal ekseninin manipülasyonunun göstermiştir. Floxed alellerin Cre-aracılı eksizyon (MRTFdKO) tarafından Mrtfa ve Mrtfb silinmesi subepikardiyal uzaya EPDC göç zayıflatır. Tersine, artan EPDC göç ve ColIV temel zarın (Şekil 3C, D) bozulması, C57BL / 6 kupa sonuçlarında MRTF-A (Ad / MRTF-A) ifade zorladı.

Gen ileri Geri NCBI Katılım
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

. Tablo 1: epikardiyumun Analizi ve Miyokard Kısıtlı Gene Expression Gen ifadesi QRT-PCR wi tarafından belirlenir tarafından Epikardiyal akıbet Kültür Saflık Doğrulama Kullanılan İleri dizileri ve ters primerleraşağıdaki parametrelerle TH: 10 saniye boyunca 95 ° C'de denatüre; 30 saniye için 60 ° C de tavlama, 50x döngüleri tekrarlayın.

Şekil 1
Şekil 1:. Bir akıbet Kültür Assay (A) epikardiyal modülasyon ve analiz için önerilen zaman çizelgesi ile epikardiyal akıbet eksplant tahlil bir şematik kullanma İlköğretim Epikardiyal Hücreleri İzolasyon. (B - E) eksplant tahlil sırasında çeşitli zaman noktalarında Temsilcisi aydınlık görüntüler. (B) Embriyonik gün E11.5 fare kalpleri bir kollajen tabaka üzerinde aşağı dorsal yüzü yerleştirilir. (C) Epikardiyal hücreleri (beyaz ok başları) kültür 3-4 saat içinde kalbi kapalı göç etmeye başlayacak. Kan hücreleri (siyah oklar) yakın birikir ya da epikardiyal akıbet sırasında eksplantlar kapsayabilir. (D, E) AkşamKültür yaklaşık 24 saat, kalpleri kaldırılır ve epikardiyal tek tabakaları odası slayt yapıştırılır kalır. Hücresel çıkıntılar hücrelerin kaldırım taşı gibi düzenleme ile epitel morfolojisi gösterir. Ölçek çubukları = 250 um (BD) ya da 50 um (c, e). H = kalp, LA = sol atrium, LV = sol ventrikül, OFT = çıkış yolu, RA = sağ atrium, RV = sağ ventrikül. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Şekil 2: Epikardiyal Hücre akıbet Saflık Değerlendirilmesi (A) epicardium tükenmiş E11 miyokard gen ifadesinin (Nkx2-5 ve Myh7) ile karşılaştırıldığında akıbet kültürlerde epikardiyal kısıtlı belirteçlerin (Tcf21, Aldh1a2 ve WT1) ve QRT-PCR doğrulama.. 5 kalpler. veri Temsilci VekiliSEM ± (n = 8 grup başına) ortalama t. Yıldız **** P <0.0001 ile Öğrenci T-testi kullanılarak istatistiksel anlamlılık ifade ediyor. (B) uyarılmamış çıkıntılar epikardiyal ifade (kırmızı WT1), hücreler arası sıkı kavşaklar (ZO1, yeşil) ve çekirdeklerin Temsilcisi ko-immunofluorescent boyama (DAPI, mavi). (C) bir sonucudur kültüründe hücre kontaminasyonu bir örnek. Epikardiyal hücreler (yıldız) karakteristik mezotel kimlik (nükleer WT1, kırmızı) ve organize epitel sıkı kavşaklar (ZO1, yeşil) ile panelin sağında görülmektedir. merkezi (beyaz ok başları) komşu hücreler minimal nükleer WT1 protein ve örgütsüz ZO1 boyama ile diferansiyel girişim kontrast (DIC) görüntüleme ile gösterilen bir uzatılmış mezenkimal morfolojisi, sergilerler. (D) Epikardiyal hücre kültürleri (1 mg / ml BSA içinde 4 mM HCl), araç ile uyarıldı ve TGF-β1 [10 ng / ml] epikardiyal indüklemeEMT. TGF-β1 stimülasyon eksplantlar ya da tek tabaka kenarı veya çevresinde yer değiştiren hücrelerin stres lifleri merkezde konfluent hücreler kortikal bölgelerinde ACTA2 (kırmızı) sağlam ekspresyonunu teşvik eder. Hücre yapışıklıklar ZO1 (yeşil) tarafından sınıflandırılmıştır. Ölçek çubukları = 25 mikron (BD). Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3: EPDC Motilitesi Ex Vivo Değerlendirilmesi (A) ex vivo kalp kültür testinin şematik bir zaman çizelgesi.. (B) 24 saat için Ad / GFP (yeşil) ile transduse bir C57BL / 6 E12.5 kalbin bir Örnek 5 um bölümü kalbin dış etiket. Ex vivo kalpler TGF-P ile ek bir 48 saat süre ile, daha sonra kültüre edildi β1 [10 ng / ml]ve PDGF-BB [20 ng / ml] EPDC taşıma teşvik etmek. Bölümler subepikardiyal bazal membran ve çekirdekleri (mavi DAPI). Ex vivo kalp kültür morfolojisi DIC gösterilir etiketlemek için ColIV (kırmızı) için birlikte boyandı. LV = sol ventrikül, RV = sağ ventrikül, RA = sağ atrium. (C, D) MRTF / SRF düzenleme ekseni düzenlenmesiyle ex vivo geçiş tahlilinin bir örneği, uygulaması. Bu rakam, [9] değiştirildi. - / - E12.5 kalpler Mrtfa izole edildi;. Mrtfb fl / fl embriyolar ve Reklam / GFP ve bir kontrol virüs veya 24 saat Cre rekombinaz sentezleyen bir adenovirüs ile dönüştürülmüş ex vivo kültür daha sonra, TGF-ß1 ile uyarıldı [10 ng / ml] ve PDGF-BB ek bir 48 saat boyunca [20 ng / ml]. EPDC motilite (beyaz oklar) içine veya ColIV (kırmızı) dışına GFP pozitif hücreler (yeşil) ve göç görülmektedir. Bölgesindeki Mrtfb silme Cre aracılı <em> Mrtfa - / - kalpleri kontrol grubuna göre EPDC göç zayıflama arka plan (MRTFdKO) sonuçları. Tersine, E12.5 C57BL / 6 kalplerinde MRTF-A (Ad / MRTF-A) ekspresyonu ile zorla EPDC taşıma artırır. (D)% GFP pozitif hücre göçü miktarının belirlenmesi. Veri SEM (her durumda n = 4 kupa) ± standart hata olarak sunulmaktadır. Veri yıldızlarla **** P <0.0001 ile Tukey post-hoc testleri ile istatistiksel anlamlılık gösteren bir tek-yönlü ANOVA kullanılarak analiz edildi. Ölçek çubukları = 200 um (B) ya da 25 um (C). Tüm görüntüler ters konfokal lazer tarama mikroskobu kullanılarak elde edildi. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Burada akıbet birincil epikardiyal hücreyi izole etmek ve ex vivo kalp kültürlerinde EPDC göç izlemek için ayrıntılı yöntemler özetlemektedir. akıbet kültürler için, epicardium tükenmiş kalp kaldırmak için uygun zaman deneyler arasında biraz değişir. bir gecede inkübasyon sonrasında eksplant periyodik izleme epikardiyal akıbet kapsamını ölçmek için ve fibroblastlar görünmeden önce kalbini çıkarmak için tavsiye edilir. saflık sağlamak için, kalpleri olmayan epikardiyal soy birikmesini önlemek için eksplantasyonu 24 saat içinde çıkarılmalıdır. Çıkış yolunu ve aynı zamanda kirletici hücre tipleri 27,40 azaltabilir bir oda slayt kalbi transfer öncesinde her iki atrial uzak Kırpma. Fetal kalpler zaman dar aralığı içinde, bir fare çöp izole edildi ve aynı koşullar altında kültürlenir yana görünmesi çıkıntılar zaman bir kalp bir deney içinde bir nispeten benzer. Bu nedenle, tüm kalpler b gerekireksplantlar çoğunluğu epikardiyal çıkıntılar arzeden e çıkarılır. Bazı durumlarda, epikardiyal hücreleri bu eksplant deney dışında tutulmalıdır ki bu durumda diğerlerinden daha fazla gayretle sözleşme bir kalp verimli bir şekilde göç yok.

Kan hücrelerinin birikimi sıklıkla böylece zor çıkıntılar görselleştirmek için yapım, epikardiyal hücreleri (oklar, Şekil 1C) düz bir tek tabaka gizleyebilir. aşırı kan hücresi katkı önlemek için, kupa embriyodan diseksiyon sonra birkaç dakika HBSS içinde kalabilir. Bu fetal kalp bir oda slayt transfer edilmeden önce kalp odalarında kalan kanı dışarı pompalamak için yeterli zaman sağlar. Alternatif olarak, ilk gecede inkübasyon sonrasında eksplant orta A kültürleri tamamlayan bazı aşırı kan fışkırma uzağa ve çıkıntılar ortaya çıkarmak için yardımcı olacaktır; Yüzey gerilimi kalbi neden olabilir ancak, medyanın seviyesi kalp üzerine çıkmamalıdıralt tabakadan uzak çekin. Sağlam epikardiyal çıkıntılar kültür substrat olarak kolajen tipi I ile gözlenir; Bununla birlikte, diğer substratlar organizma ve / veya uygulama 27,40-42 bağlı olarak bildirilmiştir. Bu protokolü kullanarak, birincil fetal epikardiyal hücreler kalp kaldırılması ve günlük orta ikmal izleyen 4 gün boyunca gelişmek; Ancak, kültür daha uzun süreli gerektiren deneysel tasarımlar, son kullanıcı tarafından belirlenmelidir. epikardiyal EMT kuvvetle embriyonik gelişim sırasında aktive olduğundan, bu akıbet kültür tekniği fetal epikardiyal hücrelerin zenginleşmesine sınırlıdır. Diğer gruplar yetişkin epikardiyal hücreleri 43,44 izole etmek yöntemler tarif etmişlerdir.

Ex vivo göç deneyleri, kalp çıkarma ve epikardiyal hücre etiketleme için iki nedenden dolayı E12.5 tavsiye edilir. İlk olarak, E12.5 sonra izole kalpler daha büyük olan ve bu nedenle canlılığı desteklemek için daha fazla perfüzyon gerektirir. besin basit difüzyons büyük kalpleri organ kültürleri korumak için yeterli değildir. İkincisi, epikardiyal EMT ve EPDC göç E12.5 etrafında meydana gelir. Bu nedenle, epikardiyum EPDC algılanmasını arttırmak için, kalp çıkarımı hemen sonra bir flüoresan proteini sentezleyen bir adenovirüs ile etiketlenmesi gerekir. Alternatif olarak, carboxyfluorescein diasetat süksinimidil ester (KAKE) daha önce kalp dış etiket ve EPDC göç 10,45 izlemek için rapor edilmiştir.

Aşırı büyüme deneylerinde aksine, ex vivo kültür kalp bağlantı elemanı ve epikardiyal hücre gelişimini önlemek için periyodik olarak sarsan edilmelidir. Kültürler ayrıca sürekli en düşük hız ayarında bir rocker ile donatılmış bir kuluçka makinesi içinde ajite edilebilir. Kullanıcılar organ kültürü bir kaç gün içinde kardiyak morfoloji değişiklikleri fark edeceksiniz ve kalp izolasyonu 72 saat ötesinde analizler kaçınmalısınız. Bu analiz kullanılarak, EPDC istilası kültür, 48 ila 72 saat içinde görülmektedir. Kre-loxP sistemi ikenKoroner damar, miyokard intertisyumda interventriküler septum 7,22, bu ex vivo tekniği alt-epikardiyal alan bir kaç hücre tabakaları içinde EPDC geçiş sınırlı olduğu EPDC lokalizasyonunu harita in vivo kullanılmıştır. Böylece, bu yöntem EPDC motilite ve invazyon regülatörleri belirlenmesi yerine EPDC göç nihai hedef tanımlanması için daha uygundur.

Epikardiyal hücre izolasyon ve ex vivo geçiş deneyleri, kazanç veya işlev yaklaşımları kaybı ile kombinasyon halinde, daha önce EPDC biyoloji 9,18,46 etkileyebilir aday genlerin değerlendirilmesi için yararlı olduğu kanıtlanmıştır. Bu yöntemler aynı zamanda EPDC göç yeni düzenleyicileri tanımlamak için kazanç fonksiyon-ya da zarar-fonksiyon ekranlar için bir platform sağlar. Bu strateji, floresan aktive hücre sıralama ya da tek hücreli RNA-dizisi ile bağlantılı olarak, aynı zamanda epikardiyal heterojen araştırmak için bir fırsat sağlayabilirdaha detaylı bir şekilde ve EPDC farklılaşması. Son olarak, bu prosedürlerin değişiklikler kardiyak rejeneratif tıp amaçlı epikardiyal hücre ve EPDC biyoloji darbe küçük moleküller için ekranlar geliştirmek için kullanılan olabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgements

EMS Sağlık (NIH) National Institutes of hibe ile desteklenmiştir [hibe sayısı R01HL120919]; Amerikan Kalp Derneği [hibe sayısı 10SDG4350046]; NIH [hibe sayısı UL1 TR000042] Rochester CTSA ödülü Üniversitesi; ve Aab CVRI gelen başlangıç ​​fonları. MAT Howard Hughes Tıp Enstitüsü Med-içine-Grad Girişimi'nden Tıp ve Diş Hekimliği Rochester Okulu Üniversitesi hibe kısmen desteklenmiştir; ve NIH [hibe sayısı GM068411] bir Kurumsal Ruth L. Kirschstein Ulusal Araştırma Hizmet Ödülü.

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics