Épicardique Excroissance Culture Assay et

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Une seule couche de lignées de cellules épicardiques du coeur, en fournissant des facteurs paracrines qui stimulent la prolifération des cardiomyocytes et en contribuant directement progéniteurs cardiovasculaires au cours du développement et de la maladie. Bien qu'un certain nombre de facteurs ont été impliqués dans la cellule (EPDC) mobilisation des épicarde dérivés, les mécanismes qui régissent leur migration ultérieure et la différenciation sont mal comprises. Ici, nous présentons in vitro et ex vivo pour étudier les stratégies EPDC motilité et la différenciation. Tout d'abord, nous décrivons une méthode d'obtention de cellules épicardiques primaires par la culture excroissance du coeur de la souris embryonnaire. Nous présentons également un protocole détaillé pour évaluer la migration tridimensionnelle de EPDC marquée dans un système de culture d'organe. Nous fournissons des preuves à l'aide de ces techniques que la suppression génétique des facteurs de transcription liés Myocardin-dans l'épicarde atténue la migration EPDC. Cette approche sert de plateforme pour évaluer les modificateurs de candidats de EPDCbiologie et pourrait être utilisé pour développer des écrans génétiques ou chimiques pour identifier les nouveaux régulateurs de mobilisation EPDC qui pourraient être utiles pour la réparation cardiaque.

Introduction

L'épicarde est une seule couche de cellules mésothéliales que les lignes du cœur et impacts cardiaque le développement, la maturation et de réparation. Grâce à un échange hautement coordonnée de signaux paracrines, le dialogue intime entre l'épicarde et le myocarde est indispensable pour la croissance cardiaque et la formation de non-myocytes cardiaques lignées 1. Des cellules épicardiques dérivées (EPDC) émergent d'un sous - ensemble de cellules épicardiques par l' intermédiaire d' un épithéliale-mésenchymateuse transition (EMT) 2, envahissent l'espace sous - épicardiques et du myocarde sous - jacente, et se différencient principalement dans les cellules murales vasculaires coronaires et des fibroblastes cardiaques et à un moindre mesure, les cellules et les cardiomyocytes 3-9 endothéliales.

Les mécanismes de régulation de l' EMT épicardique et l' invasion EPDC ont été attribués à l'action coordonnée de diverses molécules , y compris des ligands sécrétés 10-13, des récepteurs de surface cellulaire et des molécules d'adhésion 14,15, réglelateurs de polarité apicale-basale 16,17, petites GTPases 18,19 et facteurs de transcription 2,20,21. Bien que plusieurs des effecteurs moléculaires de la migration EPDC ont été définis, une meilleure compréhension des signaux physiologiques qui stimulent la mobilisation EPDC dans l'embryon peut accélérer le développement de stratégies pour manipuler ce processus chez l'adulte pour une meilleure réparation cardiaque.

Des études visant à identifier de nouveaux régulateurs de mobilisation EPDC comptent sur la purification de cette population de cellules ou localiser la migration des cellules épicardiques individuelles. Ou une combinaison de gènes marqueurs, y compris WT1 Tcf21, Tbx18 et / ou Aldh1a2, est couramment utilisé pour identifier l'épicarde du foetus 1. Cependant, l'utilisation de ces marqueurs pour suivre la migration EPDC est pas optimale comme expression de marqueurs épicardiques diminue au cours du développement du cœur et est souvent perdue lorsque les cellules épicardiques subissent transdifrenciation dans des cellules mésenchymateuses.

L'application du système Cre / loxP, en collaboration avec les journalistes de la lignée de traçage, a été utile dans l' étiquetage de façon permanente l'épicarde et ses descendants au cours du développement du cœur et suite à une lésion ischémique chez l'adulte 7,22,23. Plusieurs lignes Cre épicardiques restreint ont été générés et sont largement utilisés pour étiqueter EPDC et géniques conditionnelle des stratégies de suppression 1. Ces études ont abouti à la caractérisation des différentes lignées épicardique et l'identification des médiateurs essentiels de EPDC motilité et la différenciation. Cependant, l' accumulation de preuves suggère également l'épicarde est une population hétérogène de cellules progénitrices 4,24,25. Ainsi, seul un sous-ensemble de cellules épicardiques sera ciblé en utilisant un pilote Cre donné.

Afin de marquer l'ensemble épicarde indépendamment de la spécificité Cre, un certain nombre de laboratoires ont utilisé cul excroissancesystèmes de ture ou ex vivo des méthodes de culture d'organes pour isoler ou étiqueter les cellules épicardiques sans dépendre de l'expression d'une lignée génétique les marqueurs 26-28 fidèlement. Pour ex vivo études sur la migration, les cœurs embryonnaires sont isolées avant EMT épicardique et cultivées dans un milieu supplémenté avec une protéine fluorescente verte (GFP) exprimant l'adénovirus (Ad / GFP) 9,18. Cette approche permet un marquage efficace de la totalité épicarde plutôt que d'un sous-ensemble de cellules par recombinaison à médiation par Cre. Cultures cardiaques sont ensuite exposés à des inducteurs connus de EMT pour stimuler la mobilisation de EPDC 28,29. Ex vivo et in vivo des analyses sont complétées par des cultures in vitro d' explants épicardiques, qui sont une approche particulièrement utile pour explorer des mécanismes détaillés de conduite migration EPDC.

Ici, nous décrivons les méthodes pour isoler des cellules épicardiques primaires pour les études in vitro de epicardial EMT, ainsi que d' un système de culture d'organes ex vivo analyses de EPDC motilité. Nous avons récemment démontré l'utilité et la robustesse de cette méthode en modulant génétiquement le facteur lié myocardin-transcription (MRTF) / facteur de réponse sérique (SRF) axe de signalisation pour manipuler la migration basée actine de EPDC 9. Bien que nos résultats mettent en évidence une voie nécessaire pour la régulation de la migration EPDC de signalisation, ces méthodes sont appropriées pour démêler les mécanismes qui orchestrent collectivement la migration EPDC et la différenciation. En outre, l'expiant et ex vivo des systèmes de culture pourraient être mises en œuvre dans les écrans fonctionnels pour identifier les nouveaux régulateurs de mobilisation EPDC pour des applications thérapeutiques dans la régénération cardiaque.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTE: Toutes les expériences avec des souris ont été approuvées par le Comité de l'Université sur les ressources animales de l'Université de Rochester.

1. Essai de culture épicardique excroissance (figure 1A)

  1. Les préparatifs
    1. Préparer 5 ml de milieu A pour l'isolement des cellules épicardiques primaire en complétant le milieu 199 (M199) avec 5% de sérum bovin fœtal (FBS) et 1% de pénicilline / streptomycine (Pen / Strep).
    2. Préchauffer le milieu A et 100 ml d'une solution saline équilibrée de Hanks (HBSS) dans un bain-marie à 37 °.
    3. Permettre aux lames creuses revêtu de collagène se réchauffer à la température ambiante pendant 30 min.
    4. Ajouter 100 pi de milieu A à chaque puits de la lame de chambre et faire tourner doucement pour bien enrober la surface de collagène. Répétez l'opération pour 8-12 puits. Retirez le support après chambres de revêtement.
    5. Aliquoter pré-chauffé HBSS en deux 10 cm 2 plaques contenant 50 ml de HBSS.
  2. Isoler Coeurs embryonnaires de Pregnant Dam à 11,5 jours après le coït (dpc).30
    1. Anesthésier souris avec 0,5 ml de 13 mg / ml de kétamine / 0,88 mg / ml de cocktail de xylazine dans une solution saline tamponnée au phosphate (DPBS) 1x Dulbecco par injection intrapéritonéale. Confirmer anesthetization appropriée à l'aide d'un test orteil de pincement. Une pincée douce est suffisante pour déterminer si la souris est sensible. Tout mouvement ou la patte retirer indique que l'animal ne soit pas suffisamment anesthésiés pour faire de la chirurgie. Euthanize par dislocation cervicale.
    2. Placez la souris face à face ventrale et pulvériser l'abdomen avec 70% d'éthanol pour réduire la contamination par les cheveux.
    3. Pincer la peau avec des pinces et couper une incision latérale à l'abdomen avec des ciseaux chirurgicaux. Tenez fermement la peau et tirez dans des directions vers la tête et la queue adverse.
    4. Pincez le péritoine avec des pinces et couper avec des ciseaux pour exposer la cavité abdominale.
    5. Retirez délicatement le decidua en coupant le long de la mésomètre. Transférez le decidua disséqués pré-chauffé HBSS dans le premier10 cm 2 plaques.
    6. Séparez le decidua en coupant entre les embryons.
    7. Transférer un embryon à la seconde plaque 10 cm 2 avec du HBSS préchauffé sous un microscope à dissection. Retirez délicatement le tissu et le sac vitellin extra-embryonnaire, puis décapiter l'embryon.
    8. Pincez la paroi thoracique avec une pince et déchirer le tissu à part sur la ligne médiane, l'exposition de la cavité thoracique.
    9. Placez la pince derrière le cœur. Attrapez la voie d'éjection et tirez le coeur loin de l'embryon. Séparer les voies pulmonaires et les poumons du cœur, si elle est encore attaché.
  3. Transférer le cœur à un seul puits de la lame revêtue de collagène et le placer côté dorsale vers le bas (figure 1B). Répétez les étapes 1.2.7-1.3 pour chaque embryon.
  4. Une fois que tous les cœurs ont été transférés à des puits individuels, incuber la glissière de la chambre pendant 30 min à 37 ° C, 5% de CO2 pour permettre une adhérence suffisante à la matrice de collagène.
  5. ajouter avec précaution20-50 ul du préchauffée milieu explant A autour de chaque coeur. Important: Ne pas ajouter le moyen trop rapidement ou à un niveau au-dessus du cœur, sinon les cœurs peuvent se détacher du substrat de collagène.
  6. Culture le cœur à 37 ° C, 5% de CO 2 pendant environ 24 heures pour permettre l' excroissance épicardique. Remarque: Les excroissances peuvent être observées dès 3-4 h de culture (figure 1C) et se compose principalement de cellules mésothéliales présentant la morphologie cobblestoned, avec la contamination des cellules mésenchymateuses minimale (figures 1D, E). Des résultats représentatifs ont été acquises à l'aide d'un microscope à dissection équipé d'une caméra.

2. Ablation génétique et Induction de EMT dans épicardiques excroissances

Attention: Manipuler adénovirus avec soin selon les directives de biosécurité approuvés.

  1. Préparer 15 ml de milieu B (M199 supplémenté avec 1% de FBS et 1% de Pen / Strep) et pré-chauffer à 37 ° C dans un bain d'eau.
  2. Pour l'excisionallèles floxés, préparer explant milieu B additionné de 2,5 x 10 4 pfu / ml d'adénovirus exprimant Cre recombinase (Ad / Cre) ou le virus de contrôle.
    Remarque: adénoviral à médiation par surexpression des gènes candidats peut également être réalisée afin d'évaluer le gain de phénotypes de fonction. Les titres viraux devraient être déterminés par l'utilisateur final.
  3. Retirez délicatement les cœurs de épicarde appauvri à partir de cultures excroissance en utilisant une pince. coeurs de transfert aux tubes de 1,5 ml avec 800 ul Trizol et conserver à -80 ° C pour l'isolement d'ARN plus tard et l'analyse de l'expression des gènes.
  4. Laver chaque puits avec DPBS pour éliminer les cellules sanguines et l'excès de débris cellulaires.
  5. Ajouter 500 ul expiant du milieu B supplémenté avec un adenovirus (s) à chaque culture de l' excroissance et laisser incuber pendant 24 heures à 37 ° C, 5% de CO 2.
  6. Pour EMT induction, retirer les médias et de reconstituer avec 37 ° C explant B milieu supplémenté avec le facteur de croissance transformant recombinant (TGF) -β1 [10 ng / ml] ou d'un véhicule (4 mM hydrochloric acide (HCl) contenant 1 mg / ml de sérum-albumine bovine (SAB)). Des explants de culture pour une 24 heure supplémentaire à 37 ° C, 5% de CO 2. Procéder avec le gène / protéine analyse expression ou immunocytochimie comme détaillé dans les protocoles ultérieurs.
    Remarque: L' induction de l' EMT épicardique a été stimulées avec diverses concentrations de TGF-β1 allant de 0,5 ng / ml - 10 ng / ml 26,31-33. Des concentrations plus élevées de ligand peuvent donner lieu à une liaison non spécifique à tous les récepteurs de TGF-β. La concentration de TGF-β1 doit refléter les objectifs expérimentaux spécifiques.

3. Gene Expression Analyse des épicardiques excroissances

  1. coeurs épicarde appauvri Décongeler préalablement stockées dans Trizol (2.2).
  2. Aspirer le milieu de cultures EPDC et laver deux fois avec DPBS.
  3. Ajouter 800 ul Trizol de la température ambiante à explanter cultures.
  4. Incuber coeurs épicarde appauvri et cultures EPDC en Trizol pendant 5 min à la chambre tempéra ré. Pipeter vers le haut et vers le bas dix fois pour homogénéiser l'échantillon lysé.
    Remarque: Hearts peuvent nécessiter des pipetage pour homogénéiser complètement.
  5. Transfert lysats tubes de 1,5 ml et procéder à un isolement total de l'ARN selon les instructions du fabricant. Ajouter 10 pg de glycogène avant la précipitation pour augmenter le rendement de l'ARN. Un explant donné produira environ 0,5-1,0 pg d'ARN.
  6. Retirer l'ADN contaminant avec de la DNase I et transcription inverse 0,5 pg d'ARNm selon les instructions du fabricant.
  7. Valider la pureté des explants et / ou l' induction de l' EMT avec inverse quantitative transcription épicardiques (qRT) -PCR 34 en utilisant SYBR vert et les marqueurs décrits dans le tableau 1. Normaliser les niveaux d' ARNm de la glycéraldéhyde 3-phosphate déshydrogénase (GAPDH) et calculer l' expression relative à l' aide 2 - méthode de ΔΔCt 35. Des résultats typiques sont présentés dans la figure 2A.
title "> 4. Protein Analyse des épicardiques excroissances

  1. Aspirer le milieu de cultures EPDC et laver deux fois avec DPBS.
  2. Ajouter 10 ul de tampon protéine lyse glacé (Tris 50 mM, pH 7,5, chlorure de sodium 150 mM, 1 mM d'acide éthylènediaminetétraacétique, pH 8,0, 1% de Triton X-100, un inhibiteur de protéase 1x cocktail) pour chaque chambre de puits et placer la lame de chambre à de la glace. Coupez environ ¼ du fond sur une pointe de pipette P200 et utiliser le morceau restant pour gratter les cellules hors de la diapositive. Pipette haut et bas pour les cellules épicardiques lysent et transfert à un tube de 1,5 ml.
  3. Soniquer explants lysées sur faible (160 W) pendant 5 min dans un bain d'eau glacée avec 30 sec ON et OFF cycles.
  4. lysats de centrifugation pour 10 min à 10000 xg, 4 ° C. Transférer le surnageant dans un tube frais , et déterminer la concentration en protéine en utilisant un dosage de protéines 36.
    Note: Un explant donné produira jusqu'à 1,5 pg de protéine totale. Nous avons constaté que la mise en commun des explants de deux cœurs uned loading protein 2 pg par puits est suffisante pour détecter le muscle lisse α-actine (ACTA2) et GAPDH 9. La détection d'autres protéines cibles peut nécessiter la mise en commun des échantillons multiples explants telle que déterminée par l'utilisateur final.

5. Immunocytochimie de épicardiques excroissances

  1. Retirez le support de cultures explants et laver deux fois avec DPBS.
  2. Ajouter doucement 500 pl de 4% (v / v) de paraformaldehyde ou du methanol glacé à chaque puits et fixer les explants pendant 5 min à température ambiante ou 10 minutes à -20 ° C, respectivement. Fixer selon les spécifications d'anticorps tel que recommandé par le fabricant.
  3. Retirer fixateur et rincer chaque puits avec DPBS trois fois pendant 5 min.
  4. Perméabiliser les cellules avec 500 ul de 0,1% (v / v) de Triton X-100 dans du DPBS pendant 5 min.
  5. Enlever la solution de perméabilisation et rincer à l'DPBS trois fois pendant 5 min.
  6. Bloquer les cellules avec du sérum de 10% dans DPBS pendant 30 min à la chambre tempéraré.
  7. Procéder à la coloration de l'anticorps primaire par les recommandations du fabricant et des conditions optimales déterminées par l'utilisateur final.
  8. Retirer la solution d'anticorps et rincer à l'DPBS trois fois pendant 5 min.
  9. Appliquer l'anticorps secondaire selon les instructions du fabricant et de contraste avec un colorant nucléaire approprié.
  10. Retirer la solution d'anticorps et rincer à l'DPBS trois fois pendant 5 min.
  11. Retirer les murs chambre de diapositives selon les instructions du fabricant et ajouter du milieu de montage aqueux directement aux cellules. Placez une lamelle sur les cellules et sceller avec du vernis à ongles. Les résultats typiques sont présentés dans la figure 2B - 2D inversée en utilisant la microscopie confocale à balayage.

6. Culture ex vivo de dosage (figure 3A)

  1. Les préparatifs
    1. Préparer 12 ml ex vivo , le milieu de culture en utilisant un (1: 1) mélange de milieu d'Eagle modifié par Dulbecco (DMEM): M199 additionné de 10%FBS et 1% Pen / Strep.
    2. Dans un bain d'eau à 37 °, ex vivo milieu de culture pré-chaud et 100 ml de HBSS.
    3. Aliquote de 1 ml de milieu préchauffé dans 8-12 puits d'une plaque 24 puits.
    4. Transfert préchauffée HBSS deux 2 plaques de 10 cm, contenant 50 ml chacun.
  2. Isoler souris coeurs embryonnaires dans HBSS (comme décrit dans 1.2) des barrages enceintes à 12,5 dpc.
  3. Transfert chaque cœur à un seul puits de la plaque 24 puits contenant ex vivo milieu de culture. Incuber la plaque à 37 ° C, 5% de CO 2 avec doux balancement manuellement ou en utilisant une plate - forme à bascule pour empêcher l' adhérence. Passer immédiatement à l'étape 7.1.

7. épicardique Étiquetage et EMT Induction dans des cultures ex vivo

  1. Pour marquer l'épicarde, de préparer 12 ml de 37 ° C , ex vivo , le milieu de culture additionné de 3,0 x 10 6 pfu / ml de Ad / GFP. Ciblé pour l'ablation d'allèles floxés transfert 6 ml d'uned / GFP a complété le milieu de culture dans un nouveau tube de 15 ml conique. Ajouter une annonce / Cre ou contrôler l' adénovirus à une concentration finale de 1,5 x 10 6 pfu / ml.
    Note: Gain de la fonction des analyses peut également être effectuée avec la livraison de gènes à médiation adénovirale approprié.
  2. Retirez délicatement le milieu de culture de chaque puits de la plaque 24 puits en utilisant une pointe P1,000 de pipette.
  3. ajouter doucement le milieu de culture complémenté avec un adenovirus (s) à chaque puits.
  4. Incuber la plaque à 37 ° C, 5% de CO 2 pendant 24 heures avec doux balancement.
  5. Pour EMT induction, préparer 12 ml de 37 ° C , ex vivo , le milieu de culture contenant 10 ng / ml de TGF-β1 et 20 ng / ml de facteur de croissance dérivé des plaquettes (PDGF) -BB ou le véhicule (HCl 4 mM contenant 1 mg / ml de SAB ).
  6. Retirez délicatement le milieu de culture de chaque puits de la plaque 24 puits en utilisant une pointe P1,000 de pipette. Rincer délicatement les coeurs avec 1 ml DPBS.
  7. Retirez les DPBS et reconstituer les cœurs avec ex vivo culture medium contenant TGF-β1 et PDGF-BB ou d'un véhicule.
  8. Incuber pendant 24 heures à 37 ° C, 5% de CO 2 avec doux balancement.

8. Cryoconservation et immunohistochimie des cultures ex vivo

  1. Préparer les coeurs pour cryoconservation.
    1. Retirez le milieu de culture et laver les cœurs deux fois avec DPBS glacées.
    2. Ajouter 1 ml de 4% (v / v) paraformaldehyde à chaque coeur et fixer pendant 2 heures à 4 ° C avec doux balancement.
    3. Retirer le fixateur et laver les cœurs deux fois avec DPBS. Transférer les coeurs des puits frais avec 1 ml de 10% (p / v) de saccharose préparé dans du DPBS. Incuber la plaque pendant une nuit à 4 ° C avec doux balancement.
    4. Transférer délicatement les cœurs à de nouveaux puits avec 18% (p / v) de saccharose préparé dans DPBS. Incuber la plaque pendant une nuit à 4 ° C avec doux balancement.
    5. Transfert chaque cœur à un cryomoule contenant du tissu milieu de congélation. geler immédiatement les blocs à l'aide de l'azote liquide et conserver à -80 & #176; C.
  2. Section coeurs à 5 um en utilisant une des coupes de tissus cryostat et placer sur des lames de microscope chargées positivement. Magasin glisse à -80 ° C jusqu'à coloration.
  3. Effectuer immunohistochimie sur coupes pour la détection de la membrane basale sous-épicardiques.
    1. Décongeler les lames pendant au moins 30 min à température ambiante.
    2. Réhydrater les sections en lavant deux fois dans DPBS pendant 5 min avec doux balancement.
    3. perméabiliser section avec 0,1% (v / v) de Triton X-100 dans du PBS pendant 5 min à température ambiante.
    4. Laver les lames deux fois dans DPBS pendant 5 min avec doux balancement.
    5. Éponger DPBS excès et définir la zone de coloration avec un stylo de marquage hydrophobe. des sections de bloc avec 10% de sérum dans du DPBS pendant 30 minutes à température ambiante.
    6. Retirer le bloc et appliquer IV anticorps de collagène de type (ColIV, 1: 200) dilué dans le bloc. Incuber une nuit à 4 ° C dans une chambre à humidité contrôlée.
    7. Laver les lames trois fois en DPBS pour5 min avec doux balancement.
    8. Diluer anticorps par fluorescence conjugué secondaire (1: 500) et DAPI (1: 5000) dans DPBS et appliquer aux diapositives. Incuber pendant 1 heure à température ambiante. Choisissez un anticorps secondaire approprié avec une longueur d'onde d'émission et d'excitation distincte de la GFP.
    9. Laver les lames trois fois dans du PBS pendant 5 min avec doux balancement. Mont glisse avec un milieu de montage.

9. L' imagerie et la quantification des cultures ex vivo

  1. Avoir une image de l'utilisateur aveugle et quantifier les coupes colorées. au moins cinq sections de tissus non consécutifs image d'un coeur donné dans 4-5 emplacements arbitraires le long de l'épicarde (bord du coeur) en utilisant un microscope à fluorescence ou confocal à 40X. Les résultats typiques sont présentés sur la figure 3B en utilisant la microscopie inversée à balayage confocal.
  2. compter manuellement le nombre total de cellules GFP-positives dans une image donnée. Identifier la migration EPDC comme GFP pocellules sibles situées à l'intérieur ou au-delà de la membrane basale épicardique ColIV. Déterminer le pour cent de la GFP migration des cellules que le nombre de migration GFP cellules positives sur le nombre total de cellules GFP-positives dans une image donnée. Les résultats typiques sont présentés dans la figure 3C-D en utilisant la microscopie inversée à balayage confocal.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Le épicarde peut être efficacement isolé en utilisant un essai de culture de l'excroissance en tirant parti de son emplacement extérieur et exploitant la plasticité du développement et le comportement migratoire intrinsèque de EPDC. Coeurs embryonnaires murines sont isolés à E11.5 avant l'EMT épicardique et du côté dorsal vers le bas en culture sur des lamelles à chambre revêtues de collagène 26 (figure 1A, B). coeurs explantés vont continuer à se contracter; cependant, l'épicarde adhère à la matrice de collagène et de migrer hors du myocarde dans les 24 heures de la culture (figure 1C). Cellules épicardiques peuvent être observées émanant du coeur avec pavé comme la morphologie, indicative de l' identité mésothéliales (Figures 1C-E). Après 24 heures de culture, coeurs de épicarde appauvri sont prélevés pour analyse génétique ou expression de la protéine.

En plus d'observer epithelial morphologie, la pureté des cultures de cellules épicardiques peut encore être validée par l'expression de marqueurs de gènes et des protéines restreintes épicardiques. Explants de cellules épicardiques affichent une expression robuste de marqueurs épicardiques et mésothéliales (Aldh1a2, Tcf21 et WT1) et une faible expression des gènes de cardiomyocytes (NKX2-5 et myh7) par rapport aux coeurs épicarde appauvri (Figure 2A). Continuer à vérifier l' identité, des cultures de cellules épicardiques sont fixées 48 heures après le retrait du coeur et co-colorées avec des anticorps dirigés contre la tumeur de Wilm 1 (WT1) et la protéine 1 (la DO1) du zona pour marquer des cellules mésothéliales et des jonctions serrées intercellulaires, respectivement 37,38 ( La figure 2B). Cette méthode de culture de l'excroissance donne une pureté relativement élevée des cellules mésothéliales; Toutefois, l'utilisateur peut observer un petit pourcentage de contamination cellulaire. Les fibroblastes et les cellules musculaires lisses présentent un phénotype mésenchymateuses allongé avec une absence notable de Nuclear WT1 et des jonctions serrées organisées (figure 2C). Dépannage techniques pour limiter la quantité de contamination de cellules non-épicardique sont étendus dans la discussion.

Le dosage de l' excroissance explant est un système de culture utile pour interroger la biologie épicardique in vitro. Pour démontrer la plasticité des cellules épicardiques, des explants ont été stimulées avec du TGF-β1 [10 ng / ml] pour induire la transdifférenciation des cellules mésenchymateuses dans 26,28. Après 24 heures de stimulation, EPDC adopter un phénotype mésenchymateuses à une diminution de la coloration de ZO1 et robuste formation de novo de muscle lisse des fibres de stress positifs a-actine (ACTA2 ou SMA), en particulier à la périphérie de la culture 39 (figure 2D, rouge). Par contraste avec l' accent sur ​​l' assemblage de fibres à la périphérie des explants, des cellules épicardiques confluentes avec des contacts intercellulaires plus définies (ZO1, vert) au centre d'une monolayeAffichage r expression de la protéine dans ACTA2 actine corticale.

En plus de subir EMT, EPDC va envahir le myocarde et différencier, ce qui constitue une proportion importante des populations non-cardiomyocytes. La motilité des EPDC peut être évaluée à l' aide d' un organe ex vivo système de culture préalablement établi , selon lequel l'extérieur des cœurs E12.5 sont marqués avec un adénovirus exprimant GFP 9,18 (figure 3A). coeurs marqués sont ensuite mis en culture pendant trois jours en présence de TGF-β1 [10 ng / ml] et PDGF-BB [20 ng / ml] pour promouvoir la migration EPDC. Cultures d'organes sont périodiquement mis en rotation pour empêcher l' adhésion des ex vivo coeurs à la surface des plaques de culture. Ce système permet un marquage efficace de l'ensemble de l' épicarde et l' évaluation de la mobilité EPDC dans un modèle en trois dimensions par rapport à la migration directionnelle avec des essais in vitro de grattage. La migration des EPDC est observed que l'invasion de la GFP cellules épicardiques positives dans ou au - delà du ColIV (rouge) de la membrane basale épicardique 16 (figures 3B, C). Afin d' illustrer l'utilité de ce système, nous avons récemment montré que la manipulation de l'axe de signalisation MRTF / LSR peut influencer la mobilité des EPDC 9. Suppression de Mrtfa et Mrtfb par excision Cre-médiation des allèles floxés (MRTFdKO) atténue la migration des EPDC dans l'espace sous - épicardique. A l' inverse, l' expression forcée de MRTF-A (Ad / MRTF-A) dans C57BL / 6 coeurs entraîne une augmentation de la migration EPDC et rupture de la membrane ColIV du sous - sol (Figures 3C, D).

Gène Vers l'avant Sens inverse NCBI
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
Gapdh CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
NKX2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
Wt1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tableau 1: Séquences de amorces sens et antisens utilisées pour la validation de épicardique Excroissance Culture Pureté par Analyse des Epicardium et Myocarde Restricted Gene Expression L' expression des gènes est déterminée par le wi qRT-PCR.e les paramètres suivants: dénaturation à 95 ° C pendant 10 secondes; annelage à 60 ° C pendant 30 secondes; répéter 50x cycles.

Figure 1
Figure 1: Isolement des cellules épicardiques primaire à l' aide d' une culture de dosage excroissance (A) Une représentation schématique du dosage excroissance explant épicardique avec une ligne de temps recommandé pour la modulation et l' analyse épicardique.. (B - E) des images en fond clair représentatifs des divers points de temps au cours de l'essai d'explant. (B) Embryonic jour E11.5 de souris coeurs sont placées côté dorsal vers le bas , sur un substrat de collagène. Cellules (C) épicardiques (pointes de flèche blanche) vont commencer à migrer hors du cœur dans les 3-4 h de culture. Les cellules sanguines (flèches noires) peuvent accumuler à proximité ou couvrir explants pendant excroissance épicardique. (D, E) Aprèsenviron 24 h de culture, coeurs sont enlevés et monocouches épicardiques reste collée à la lame de la chambre. excroissances cellulaires présentent une morphologie épithéliale avec un agencement de pavés comme des cellules. Les barres d'échelle = 250 um (BD) ou de 50 um (C, E). H = coeur, LA = oreillette gauche, LV = ventricule gauche, OFT = sortie des voies, RA = oreillette droite, RV = ventricule droit. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2: Evaluation de la cellule épicardique Excroissance Pureté (A) la validation qRT-PCR de marqueurs limité épicardiques (Tcf21, Aldh1a2 et WT1) dans des cultures excroissance par rapport à l' expression du gène du myocarde (NKX2-5 et myh7) dans l' épicarde appauvrie E11.. 5 coeurs. représen donnéest la moyenne ± SEM (n = 8 par groupe). Les astérisques indiquent la signification statistique en utilisant un T-test de Student avec **** P <0,0001. (B) représentant la coloration de co-immunofluorescence des excroissances non stimulées pour l' expression épicardique (WT1, rouge), les jonctions serrées intercellulaires (de ZO1, vert), et les noyaux (DAPI, bleu). (C) Un exemple d' une contamination cellulaire dans une culture de l' excroissance. Cellules épicardiques (astérisque) sont observés à la droite du panneau avec l' identité caractéristique mésothéliales (WT1 nucléaire, rouge) et les jonctions épithéliales organisés serrés (de ZO1, vert). Les cellules adjacentes dans le centre (têtes de flèches blanches) présentent une morphologie mésenchymateuses allongée, montré par contraste interférentiel différentiel (DIC) imagerie, avec un minimum de protéine WT1 nucléaire et inorganisé coloration ZO1. (D) des cultures de cellules épicardiques ont été stimulées avec le véhicule (HCl 4 mM dans 1 mg / ml BSA) ou de TGF-β1 [10 ng / ml] pour induire épicardiqueEMT. la stimulation de TGF-β1 favorise l'expression robuste de ACTA2 (rouge) dans les régions corticales de cellules confluentes au centre d'expiants ou en fibres de stress de cellules qui migrent au niveau du bord ou de la périphérie de la monocouche. adhérences cellulaires sont marqués par ZO1 (vert). Les barres d'échelle = 25 um (BD). S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3: Évaluation ex vivo de EPDC motilité (A) Une chronologie schématique du coeur test ex vivo de la culture.. (B) A 5 um représentatif d'un C57BL / 6 E12.5 coeur transduites avec Ad / GFP (vert) pendant 24 heures pour étiqueter l'extérieur du cœur. Ex vivo coeurs ont ensuite été cultivées pendant une 48 heures supplémentaires avec TGF β1 [10 ng / ml]et PDGF-BB [20 ng / ml] pour stimuler la migration EPDC. Les sections ont été co-colorées pour ColIV (rouge) pour marquer la membrane et les noyaux (DAPI, bleu). Ex vivo coeur culture morphologie est représenté par DIC sous - sol épicardique. LV = ventricule gauche, RV = ventricule droit, RA = oreillette droite. (C, D) Un exemple d'application de l'ex vivo migration test en modulant l'axe réglementaire MRTF / SRF. Ce chiffre a été modifié à partir de [9]. Coeurs E12.5 ont été isolés à partir de Mrtfa - / -;. Mrtfb fl / fl embryons et transduites avec Ad / GFP et un virus de contrôle ou un adénovirus exprimant Cre recombinase pendant 24 heures ex vivo cultures ont ensuite été stimulées avec le TGF-β1 [10 ng / ml] et PDGF-BB [20 ng / ml] pendant une 48 heure supplémentaire. EPDC motilité (flèches blanches) est observé que la migration des GFP cellules positives (vert) dans ou au-delà du ColIV (rouge). Suppression de Mrtfb Cre-médiation dans le <em> Mrtfa - / - fond (MRTFdKO) se traduit par une atténuation de la migration EPDC par rapport à contrôler les cœurs. A l'inverse, l'expression forcée de MRTF-A (Ad / MRTF-A) dans E12.5 C57BL / 6 coeurs améliore la migration EPDC. (D) Quantification de% GFP migration cellulaire positive. Les données sont présentées comme la moyenne ± SEM (n = 4 coeurs pour chaque condition). Les données ont été analysées à l'aide d'une ANOVA à une voie avec des astérisques indiquant la signification statistique par des tests post-hoc de Tukey avec **** P <0,0001. Les barres d'échelle = 200 pm (B) ou 25 um (C). Toutes les images ont été acquises à l' aide inversée microscopie à balayage laser confocal. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nous présentons ici des méthodes détaillées pour isoler la cellule épicardique primaire en excroissance et suivre la migration EPDC en ex vivo cultures cardiaques. Pour les cultures excroissance, le moment approprié pour retirer le coeur de épicarde appauvri varie légèrement entre les expériences. Une surveillance périodique des explants après une nuit d'incubation est recommandé de mesurer l'ampleur de la croissance des épicardique et d'extraire le cœur avant fibroblastes apparaissent. Pour assurer la pureté, les cœurs doivent être retirés dans les 24 heures de l'explantation pour empêcher l'accumulation de lignées non-épicardiques. Découper loin des voies de sortie et les deux oreillettes avant le transfert du coeur à une diapositive de chambre peut également réduire les types de cellules contaminantes 27,40. Puisque les coeurs foetaux sont isolés à partir d'une litière de souris au cours d'une étroite fenêtre de temps et cultivée dans les mêmes conditions, le temps de excroissances apparaissent est relativement similaire d'un cœur à un autre dans une expérience. Par conséquent, tous les cœurs devraient be retiré lorsque la majorité des explants présentent des excroissances épicardiques. Dans certains cas, les cellules épicardiques ne migrent pas de manière efficace à partir d'un cœur qui se contracte plus vigoureusement que les autres, auquel cas ce explant doit être exclu de l'expérience.

L'accumulation de cellules sanguines peut souvent cacher une monocouche plane de cellules épicardiques (flèches, Figure 1C), ce qui rend difficile la visualisation des excroissances. Afin d'éviter une contribution excessive des cellules du sang, les cœurs peuvent rester dans HBSS pendant quelques minutes lors de la dissection de l'embryon. Cela laisse suffisamment de temps pour le cœur du fœtus à pomper le sang résiduel dans les cavités cardiaques avant d'être transféré à une diapositive de chambre. Vous pouvez également compléter les cultures avec un milieu de explant A après la première nuit d'incubation aidera à évacuer un peu de sang en excès et révéler excroissances; cependant, le niveau des médias ne doit pas dépasser le cœur comme la tension superficielle peut causer le coeurà se détacher du substrat. excroissances épicardiques robustes sont observées à l'aide de collagène de type I comme substrat de culture; cependant, d' autres substrats ont été rapportés en fonction de l'organisme et / ou à l' application 27,40-42. En utilisant ce protocole, les cellules épicardiques fœtales primaires peuvent prospérer pendant 4 jours après le retrait du cœur et la reconstitution moyenne quotidienne; Cependant, les modèles expérimentaux nécessitant des périodes de culture plus longues doivent être déterminées par l'utilisateur final. Etant donné que EMT épicardique est fortement activée pendant le développement embryonnaire, cette technique de culture excroissance est limitée à l'enrichissement de cellules foetales épicardiques. D' autres groupes ont décrit des méthodes pour isoler les cellules adultes épicardiques 43,44.

Pour ex vivo des essais de migration, extraction du cœur et de l' étiquetage des cellules épicardique sont recommandées à E12.5 pour deux raisons. Tout d'abord, les cœurs isolés après E12.5 sont plus grandes et donc nécessitent plus de perfusion pour soutenir la viabilité. la simple diffusion d'éléments nutritifss est insuffisante pour maintenir les cultures d'organes de plus grands coeurs. Deuxièmement, EMT épicardique et la migration EPDC se produisent autour de E12.5. Par conséquent, l'épicarde doit être étiqueté avec un adénovirus exprimant une protéine fluorescente immédiatement après l'extraction de coeur pour maximiser la détection de EPDC. En variante, l' ester de succinimidyle de carboxyfluorescéine diacétate (CFSE) a été rapporté précédemment pour étiqueter l'extérieur du cœur et de tracer la migration EPDC 10,45.

Contrairement aux analyses excroissance, ex vivo cultures devraient être secoué périodiquement afin d' éviter l' attachement du cœur et l' excroissance des cellules épicardique. Les cultures peuvent aussi être agités en continu dans un incubateur équipé d'une bascule sur le réglage de la vitesse la plus basse. Les utilisateurs pourront remarquer des changements dans la morphologie cardiaque en quelques jours de culture d'organes et doivent éviter les analyses au-delà de 72 heures d'isolement cardiaque. L'utilisation de ce test, l'invasion EPDC est observée dans les 48 à 72 heures de culture. Bien que le système Cre-loxPa été utilisé in vivo pour cartographier la localisation des EPDC à la vasculature coronaire, le tissu interstitiel du myocarde, et la cloison interventriculaire 7,22, cette technique ex vivo est limitée à la migration EPDC dans quelques couches de cellules de l'espace sous-épicardiques. Ainsi, cette méthode est plus appropriée pour déterminer les régulateurs de EPDC motilité et l'invasion plutôt que de définir la destination finale de la migration EPDC.

Isolements cellulaires épicardiques et ex vivo des essais de migration, en combinaison avec un gain ou une perte d'approches de fonction, ont déjà prouvé utile pour évaluer les gènes candidats qui pourraient avoir un impact sur ​​la biologie EPDC 9,18,46. Ces méthodes fournissent également une plate-forme pour le gain de fonction ou des écrans de perte de fonction pour identifier les nouveaux régulateurs de la migration EPDC. Cette stratégie, en conjonction avec la fluorescence tri cellulaire activé ou d'une cellule unique ARN-séquençage, peut également fournir une occasion de sonder l'hétérogénéité épicardiqueet la différenciation EPDC plus en détail. Enfin, des modifications de ces procédures pourraient être utilisées pour développer des écrans pour les petites molécules qui ont un impact cellulaire épicardique et EPDC biologie dans le but de la médecine régénérative cardiaque.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ont rien à révéler.

Acknowledgements

EMS a été soutenu par des subventions des National Institutes of Health (NIH) [numéro de subvention R01HL120919]; l'American Heart Association [numéro de subvention 10SDG4350046]; Université de Rochester CSTC prix du NIH [numéro de subvention UL1 TR000042]; et les fonds de démarrage de la Aab CVRI. MAT a été soutenu en partie par une subvention à l'Université de Rochester School of Medicine et de dentisterie de l'Initiative Howard Hughes Medical Institute Med-Into-Grad; et un prix de service institutionnel Ruth L. Kirschstein national de recherche du NIH [numéro de subvention GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics