إنشاء السرطان الجذعية الثقافات خلية من ساركوما العظام التقليدية الإنسان

Cancer Research
 

Summary

وجود الخلايا الجذعية السرطانية (الخلايا الجذعية السرطانية) في الأورام اللحمية العظام في الآونة الأخيرة تم ربط المرضية الخاصة بهم. في هذه المقالة، نقدم عزل الخلايا الجذعية السرطانية من الثقافات الخلية الأولية التي تم الحصول عليها من الخزعات الإنسان من عظمية التقليدي (OS) باستخدام قدرة الخلايا الجذعية السرطانية على النمو في ظل الظروف غير ملتصق.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وقد طالت التحسينات الحالية في العلاج ضد عظمية (OS) حياة مرضى السرطان، ولكن يبقى معدل البقاء على قيد الحياة لمدة خمس سنوات الفقراء عند حدوث ورم خبيث. و(CSC) نظرية سرطان الخلايا الجذعية ترى أن هناك مجموعة فرعية من الخلايا السرطانية داخل الورم أن لها خصائص تشبه خصائص الجذعية، بما في ذلك القدرة على الحفاظ على الورم ومقاومة للأدوية المتعددة العلاج الكيميائي. لذلك، هناك حاجة إلى فهم أفضل لنظام التشغيل البيولوجيا والمرضية من أجل المضي قدما في تطوير علاجات تستهدف القضاء على هذه فرعية معينة وخفض معدلات المراضة والوفيات بين المرضى. عزل الخلايا الجذعية السرطانية، وإنشاء مزارع الخلايا الخلايا الجذعية السرطانية، ودراسة علم الأحياء هم خطوات مهمة لتحسين فهمنا للبيولوجيا نظام التشغيل والمرضية. أحرز إنشاء المستمدة الإنسان OS-الخلايا الجذعية السرطانية من الخزعات من نظام التشغيل من الممكن استخدام العديد من الطرق، بما في ذلك القدرة على إنشاء 3 الابعاد الثقافات الخلايا الجذعية تحت nonadhereشروط الإقليم الشمالي. في ظل هذه الظروف، الخلايا الجذعية السرطانية قادرة على إنشاء المستعمرات العائمة الكروية التي شكلتها الخلايا الجذعية ابنة. وتسمى هذه المستعمرات "مجالات الخلوية". هنا، نحن تصف طريقة لإنشاء الثقافات ديوان الخدمة المدنية من الثقافات الخلية الأولية من نظام التشغيل التقليدية التي تم الحصول عليها من الخزعات نظام التشغيل. نحن تصف بوضوح العديد من المقاطع المطلوبة لعزل وتوصيف الخلايا الجذعية السرطانية.

Introduction

الأورام اللحمية هي مجموعة غير متجانسة من أورام الأنسجة الضامة الخبيثة النادرة التي تنشأ في الغالب من الطبقة الجرثومية الجنينية 1. وتشمل أنواع مختلفة من الأورام اللحمية العظام والأورام اللحمية الأنسجة اللينة. الأورام اللحمية للعظام، وهي مجموعة من الأورام الأولية غير شائعة نسبيا، تتكون من عدة أنواع فرعية، بما في ذلك عظمية (OS). نظام التشغيل، واحدة من الأورام الأولية الأكثر شيوعا من العظم، هي خباثة الوسيطة التي يسلك اسعة السريرية والنسيجية، والتغاير الجزيئية 2 و 3. لسوء الحظ، يحدث التشغيل في الغالب في الأطفال وصغار البالغين 4 و 5 و يمثل 60٪ من الأنواع الفرعية النسيجية المشتركة لساركوما العظام في مرحلة الطفولة 6 و 7. يؤثر نظام التشغيل عادة المناطق الهيكل العظمي، والتي تتميز نمو العظام السريع (على سبيل المثال، والكردوس من العظام الطويلة). ومن بين أنواع فرعية مختلفة تشريحيا من نظام التشغيل، ونظام التشغيل التقليدي، كما دعا النخاع أو نظام التشغيل المركزي، لديها درجة عالية من الأورام الخبيثة وشاء الحصصإعادة 80٪ 8. وتتكون هذه 80٪ من 60٪ نظام التشغيل التقليدي بانيات العظم، و 10٪ نظام التشغيل للغضروف، و 10٪ نظام التشغيل أرومي ليفي 6، 10/8. وتشمل الأنواع الفرعية التشغيل الأخرى كشمي، الشعيرات المتوسعة، خلية الغنية العملاقة وOS الخلايا الصغيرة. على الرغم من التقدم في الجراحة والعلاج الكيميائي مجتمعة في إدارة نظام التشغيل، وتبقى النتيجة سيئة، مع معدل البقاء على قيد الحياة على المدى الطويل من 65-70٪ في المرضى دون الانبثاث 11 و 12. تكرار البعيدة في كثير من الأحيان تحدث باسم الانبثاث الرئة، أو أقل في كثير من الأحيان، كما الانبثاث لعظام بعيدة وتكرار المحلية 13. الانبثاث غالبا ما تكون مقاومة للعلاجات التقليدية. هذه المقاومة هي السبب في بقاء خالية من المرض لمدة 10 سنوات ما يقرب من 30٪ في المرضى الذين يعانون من المرض المنتشر عند التشخيص 14 و 15.

كما هو الحال مع الأنسجة الطبيعية، وتتكون الأنسجة السرطانية من مجموعة غير متجانسة من أنواع الخلايا. ويبدو أن الخلايا داخل الورم لتتوافق مع مراحل مختلفة من التنمية. ضمن أي نالأنسجة أرمال تكمن جزء من السكان من الخلايا مع القدرة على selfrenew، وبالتالي توفير الأسلاف والخلايا الناضجة لتوازن الأنسجة. وبالمثل، يتكون السرطان من السكان غير متجانسة مماثل من الخلايا في مراحل مختلفة من التنمية، مع درجات مختلفة من انتشار الأسلحة النووية وإمكانية مكون للأورام. مجموعة فرعية من هذه الخلايا السرطانية، ويطلق عليه خلايا السرطان الجذعية (الخلايا الجذعية السرطانية)، يشكل مخزونا من selfsustaining الخلايا مع القدرة الحصرية لselfrenew والحفاظ على القدرة الخبيثة من الأورام، وبالتالي توليد الأنساب مختلفة من الخلايا التي تشكل الورم الأكبر 16. في 1990s، قدمت دراسات حول سرطان الدم النخاعي الحاد أول أدلة دامغة على وجود مجموعات سكانية فرعية CSC 17 و 18. ومنذ ذلك الحين تم عزل الخلايا الجذعية السرطانية من عدد كبير من الأورام الصلبة 19، لتصبح بذلك واحدة من أكثر المواضيع التي بحثت في أبحاث السرطان. الخلايا الجذعية السرطانية قد تنشأ في الواقع من الخلايا الجذعية الطبيعية من الطفرات في الجينات التي تجعل وضعها الطبيعيالخلايا الجذعية السرطانية 20-23. الطفرات تحويل متعددة والتفاعل مع المكروية يمكن أن يسهم أيضا إلى الأسلاف السليمة والخلايا الناضجة اكتساب القدرة selfrenewal والخلود الذي يصنف الخلايا الجذعية السرطانية. وهناك العديد من الفرضيات حول هذا التحول. الأسلاف صحية، والخلايا الناضجة صحية، والخلايا السرطانية، ويمكن dedifferentiate إلى الخلايا الجذعية، والحصول على النمط الظاهري مثل الجذعية عن طريق تنشيط الجينات المرتبطة selfrenewal 24-28. وعلى الرغم من العديد من الدراسات الأخيرة، بعد أن اكتشف أصول الخلايا الجذعية السرطانية.

ومن المميزات الخاصة الخلايا الجذعية السرطانية هي أن قدرتها على مقاومة نهج متعدد العلاج، والذي يتألف من جراحة جنبا إلى جنب والعلاج الكيميائي مع الأدوية المختلفة. وقد أظهرت الدراسات الحديثة أن الخلايا الجذعية السرطانية قد تحصل أيضا مقاومة للالسامة للخلايا وكلاء العلاج الكيميائي. التفسيرات المحتملة لهذه المقاومة تشمل overexpression من ATP ملزم كاسيت (ABC) أدوية المتعددة نقل (أي،MDR1 وBCRP1)، overexpression من العلاج الكيميائي أنزيمات استقلاب مثل ألدهيد نازعة 1 (ALDH1)، و / أو تغييرات في حركية دورة الخلية 30-33. والنتيجة المباشرة لكل هذه المفاهيم التي تم وصفها حتى الآن هي أن علاج السرطان أن تكون فعالة إلا إذا تم القضاء حيوانية CSC تماما، في حين يمكن أن يحدث تكرار المحلية أو ورم خبيث بعيد إذا نجا حتى CSC واحد.

اكتشاف الخلايا الجذعية السرطانية في الأورام اللحمية الإنسان 34، وخاصة نظام التشغيل 35، أو في أي العظام والأنسجة اللينة أنواع أخرى من السرطان، له أهمية سريرية كبيرة لأنه يقدم تفسيرا محتملا لماذا يبدو العديد من العلاجات لتكون فعالة في البداية، ولكن في وقت لاحق من المرضى الانتكاس. ولذلك، فإن الأمل للمعركة القادمة ضد نظام التشغيل التقليدي هو إيجاد علاجات جديدة ومحددة وموجهة على أساس تطوير العقاقير المبتكرة التي تستهدف OS-الخلايا الجذعية السرطانية بفضل التوصيف الجزيئي لهذا البند الفرعيالسكان ولدراسة البيولوجيا ديوان الخدمة المدنية.

في عام 1992، رينولدز والزملاء، الذين كانوا يحققون ما إذا كانت مجموعة فرعية من الخلايا الجذعية الموجودة في البالغين أدمغة الثدييات، وضعت طريقة لعزل خلايا يشتبه في أنها خلايا 36، 37 الجذعية مثل. ويستند هذا الأسلوب على القدرة الخاصة ل هذه الخلايا لتشكيل مستعمرات كروية عندما نمت في ظل ظروف غير ملتصق. كانوا يعملون تقنيات مشابهة من قبل جيبس وزملاؤه في عام 2005 لدراسة جزء من السكان من خلايا شبيهة بخلايا المنشأ في العظام الأورام اللحمية 38. عزل وتوصيف OS-الخلايا الجذعية السرطانية من الثقافات الخلية الأولية من أنواع مختلفة من نظام التشغيل التقليدية، قررنا أن تتكيف مع هذه التقنية لخطوط الخلايا OS.

هنا، نحن تصف هذه الطريقة مقتبسة من الفحص تشكيل المجال، يسمى "فحص sarcosphere"، والتي يمكن استخدامها لعزل OS-الخلايا الجذعية السرطانية من خطوط الخلايا الأولية محدودة مستمدة من الخزعات الإنسان من نظام التشغيل التقليدية. وصفنا أيضا جميع التقنيات شالحوار الاقتصادي الاستراتيجي للتحقق من صحة CSC النمط الظاهري مثل تنبع من خطوط الخلايا المعزولة من هذا الاختبار: 1) تقييم التعبير عن الجينات التي تميز المحفزة الخلايا الجذعية الجنينية (المجالس الاقتصادية والاجتماعية) ومن الجين CD133، الذي هو علامة الخلايا الجذعية السرطانية. 2) (كفو) فحص وحدة تشكيل مستعمرة. 3) تقييم قدرة هذه الخلايا على التمايز إلى خلايا بناء العظم والخلايا الشحمية في ظل ظروف التمايز المناسبة؛ 4) دراسة علامات سطح الخلايا الجذعية الوسيطة (اللجان الدائمة) (أي، CD44، CD105 وSTRO-1) من خلال تلطيخ المناعي وتحليل cytometric تدفق. 5) تقييم النشاط ALDH من هذه الخلايا.

Protocol

وقد وافق جميع التجريب باستخدام الأنسجة البشرية الموصوفة هنا من قبل اللجنة الأخلاقية المحلية (الريف. N. 141/12). تم الحصول على الموافقة المسبقة لجمع عينات الأنسجة واستخدام وتخزين العينات من الجهات المانحة في AOUC.

1. إعداد للثقافة

  1. إعداد ثقافة النمو المتوسطة (GM) وذلك بإضافة 10٪ الجنين مصل بقري (FBS)، و 100 وحدة دولية / مل البنسلين و 100 ميكروغرام / مل الستربتومايسين والمتوسطة F12 الراكون لتعديل هام ل. تصفية وتعقيم جنرال موتورز باستخدام فلتر 0.22 ميكرون. متجر جنرال موتورز ما يصل إلى 1 في الشهر في 4 درجات مئوية.
  2. إعداد المتوسطة كولاجيناز (CM) وذلك بإضافة 20٪ FBS، و 100 وحدة دولية / مل البنسلين، 100 ميكروغرام / الستربتومايسين مل و 3 ملغ نوع / مل كولاجيناز الثاني والمتوسطة F12 الراكون لتعديل هام ل. تصفية وتعقيم سم باستخدام فلتر 0.22 ميكرون. متجر سم إلى 1 شهر في -20 درجة مئوية.
  3. إعداد المتوسطة للخلية تجميد (FM) وذلك بإضافة 40٪ FBS، و 100 وحدة دولية / مل البنسلين، 100 ميكروغرام / الستربتومايسين مل و 60.5٪ ثنائي ميثيل سلفوكسيد (DMSO) إلى متوسطة F12 الراكون لتعديل هام ل. تصفية وتعقيم FM باستخدام فلتر 0.22 ميكرون. متجر FM تصل إلى 1 في الشهر في 4 درجات مئوية.
  4. إعداد المتوسطة لكفو فحص (CFUM) وذلك بإضافة 20٪ FBS، و 100 وحدة دولية / البنسلين مل و 100 ميكروغرام / مل الستربتومايسين والمتوسطة F12 الراكون لتعديل هام ل. تصفية وتعقيم CFUM باستخدام فلتر 0.22 ميكرون. متجر CFUM تصل إلى 1 في الشهر في 4 درجات مئوية.
  5. إعداد التربسين عن طريق إذابة 400 ملغ التربسين، 200 ملغ EDTA و 1،000 ملغ D (+) - الجلوكوز اللامائية في 1000 مل Dulbecco والفوسفات مخزنة المالحة (DPBS) بدون الكالسيوم والمغنيسيوم 2+ 2+.
    ملاحظة: تقسيم جديد التربسين- EDTA إلى 50 مل قسامات في 25 سم 2 قوارير باستخدام 0.22 ميكرون تصفية والتجميد عند درجة حرارة -20 درجة مئوية لمدة تصل إلى 3 أشهر. متجر إذابة قسامات فلتر تعقيم عند 4 درجات مئوية دون فقدان النشاط.
  6. إعداد المتوسطة نمو الخلايا الجذعية (SCGM) وذلك بإضافة 10٪ FBS، و 100 وحدة دولية / مل البنسلين، 100 ميكروغرام / مل streptomycin، و 10 نانوغرام / مل bFGF (25 ميكروغرام / مل الأسهم) إلى متوسطة F12 الراكون لتعديل هام ل. تصفية SCGM باستخدام 0.22 ميكرون تصفية وتخزين SCGM لتصل إلى 2 أسابيع في 4 درجات مئوية.
  7. إعداد 2٪ ميثيل (MC) عن طريق إذابة MC في عالى النقاء H 2 O في 4 درجة مئوية لمدة 3 د. عندما يذوب MC تماما، الأوتوكلاف عليه وتخزينها في 4 درجات مئوية.
    ملاحظة: بعد تعقيمها MC، يصبح صلبا. لجلب MC إلى حالة سائلة، تخزين عند 4 درجات مئوية.
  8. إعداد متوسط ​​النمو sarcosphere (SGM). يعد هذا طازجة المتوسط ​​(ليس قبل أكثر من 2 أسابيع الاستخدام) وذلك بإضافة 100 وحدة دولية / البنسلين مل، 100 ميكروغرام / مل الإنسان bFGF (25 ميكروغرام / مل الأسهم)، و 20 نانومتر البروجسترون (10 ميكرومتر الأسهم)، و 100 بوتريسين ميكرومتر، 30 نانومتر سيلينات الصوديوم (30 ميكرومتر الأسهم)، و 25 ميكروغرام / مل ترانسفيرين (25 ملغ / الأسهم مل)، و 20 ميكروغرام / الانسولين مل (20 ملغ / الأسهم مل)، و 10 نانوغرام / مل EGF البشري (10 ميكروغرام / الأسهم مل) إلى 2X والراكون تعديل المتوسطة F12 هام ل. تصفية وتعقيم SGM باستخدام 0.22 ميكرون سن الفيلثالثا. تخزين لمدة تصل إلى 2 أسابيع في 4 درجات مئوية.
  9. إعداد المتوسطة عظمي المنشأ (OM) وذلك بإضافة 10٪ FBS (الأصل في أمريكا الجنوبية)، و 100 وحدة دولية / البنسلين مل، 100 ميكروغرام / مل الستربتومايسين، 10 نانومتر ديكساميثازون (100 ميكرومتر الأسهم)، 0.2 ملي الصوديوم L-اسكوربيل-2-الفوسفات (1 الأسهم M)، 10 ملي β-سكرولي (5 ملغ / مل الأسهم) و 1 ميكروغرام / مل calcein (200 ميكروغرام / مل الأسهم) إلى متوسطة F12 الراكون لتعديل هام ل. تصفية وتعقيم OM باستخدام فلتر 0.22 ميكرون. تخزينها في 4 درجات مئوية.
    ملاحظة: مخزن الحلول الأسهم ديكساميثازون تحت النيتروجين السائل للحفاظ على نشاطهم. إعداد OM جديدة كل 2 أسابيع للحفاظ على نشاط ديكساميثازون من أجل الحفاظ على إمكانية التفريق بين المتوسطة.
  10. إعداد عازلة كرات الدم الحمراء تحلل (ELB) عن طريق إذابة 1.66 ملغ NH 4 CL، 0.2 ملغ ك 2 هبو 4 و 0.007 EDTA ملغ في 200 مل من الماء المقطر (DH 2 O). تصفية وتعقيم ELB باستخدام فلتر 0.22 ميكرون. تخزينها في 4 درجاتC.
  11. إعداد المتوسطة مكون الشحم (ص) وذلك بإضافة 10٪ FBS (أمريكا الجنوبية المنشأ)، و 100 وحدة دولية / البنسلين مل، 100 ميكروغرام / مل الستربتومايسين، 1 ميكرومتر ديكساميثازون (1 الأسهم ملم)، 1 ميكرومتر البقري الانسولين (10 الاسهم ملم)، و 0.5 ملم isobutylmethylxanthine (IBMX) (500 سهم ملم)، و 100 الاندوميتاسين ميكرومتر (200 ملم) والمتوسطة F12 الراكون لتعديل هام ل. تصفية وتعقيم AM باستخدام فلتر 0.22 ميكرون. تخزينها في 4 درجات مئوية.
    ملاحظة: مخزن الحلول الأسهم ديكساميثازون تحت النيتروجين السائل للحفاظ على نشاطهم. إعداد AM الطازج كل 2 أسابيع للحفاظ على نشاط ديكساميثازون من أجل الحفاظ على إمكانية التفريق بين المتوسطة.
  12. إعداد 2٪ الأبقار مصل الزلال (BSA) في DPBS (BSA / DPBS). حل 10 ز BSA في 500 مل DPBS وإعداد حل الأوراق المالية من قبل aliquotting 50 مل من محلول الأسهم في 50 مل أنابيب مخروطية. تخزين في درجة حرارة -20 درجة مئوية.
  13. يعد حل بارافورمالدهيد 4٪ (PFA) في DPBS (منهاج العمل / DPBS). في الفصلغطاء محرك السيارة ال-، يخفف امتصاص العرق في DPBS وإعداد حل الأوراق المالية من قبل aliquotting 50 مل من محلول الأسهم في 50 مل أنابيب مخروطية. تخزينها في 4 درجات مئوية.

2. إنشاء الثقافات OS الخلية الأولية ونظام التشغيل خطوط الخلايا المتناهية (OSA)

ملاحظة: تم إعداد الثقافات الخلية نظام التشغيل الأساسي من عينات جديدة من الخزعات نظام التشغيل التقليدية التي تم جمعها في "يونيتا ORTOPEDIA Oncologica ه Ricostruttiva"، AOUC Careggi، فلورنسا. جميع الخزعات، التي تم الحصول عليها عن طريق الرشف بالإبرة أو الاستئصال الجراحي لجزء صغير من الورم (الشكل 1A، B)، وضعت على الفور في مستنبت تستكمل مع 100 وحدة دولية / مل البنسلين و 100 ميكروغرام / مل الستربتومايسين (7.4 درجة الحموضة) و نقلها إلى المختبر حيث تم معالجتها. وقد أجريت جميع التلاعبات صفها تحت ظروف معقمة باستخدام غطاء تدفق الصفحي.

  1. عزل الخلايا OS
    1. وضع خزعة في100 مم طبق بيتري مع كمية صغيرة من جنرال موتورز. مع مشرط معقم وملاقط بيري، تخطر على عينات الأنسجة OS بالقص إلى قطع صغيرة قدر الإمكان (0،5-1 ملم) (الشكل 2A، B).
    2. تغطية أجزاء الأنسجة مع 10 مل سم لعملية الهضم الأنزيمي (الشكل 2B)، واحتضان لمدة 3 ساعات في 37 درجة مئوية، و 5٪ CO 2 الحاضنة. إزالة بلطف تعليق شظايا باستخدام ماصة وتحويلها إلى أنبوب مخروطي 15 مل الطرد المركزي على الفور (400 x ج لمدة 5 دقائق) لتكوير شظايا.
      ملاحظة: بعد الطرد المركزي، إذا الخزعات غنية في كريات الدم الحمراء، وديعة الأحمر يتكون من كريات الدم الحمراء يمكن أن ينظر إليه على شظايا. لذلك، قبل الشروع في تشتت الميكانيكية، علاج عينة العازلة مع كرات الدم الحمراء تحلل. تجاهل طاف بواسطة الطموح وإضافة 5 مل ELB.
    3. تعليق شظايا بيليه لمدة 1 دقيقة وأجهزة الطرد المركزي تعليق في 400 x ج لمدة 2دقيقة. إزالة طاف بواسطة الطموح. إضافة 5 مل جنرال موتورز وميكانيكيا تفريق شظايا باستخدام 10 مل ماصة المصلية (حجم الافتتاح، 1.5 مم Ø الداخلي) 10-20 مرات.
    4. الطرد المركزي تعليق في 400 x ج لمدة 5 دقائق. إزالة طاف بواسطة الشفط، تعليق بيليه خلية مع 10 مل جنرال موتورز، ومن ثم نقل تعليق الخلية مما يؤدي إلى 100 ملم طبق بيتري. احتضان طبق بيتري في 37 درجة مئوية، و 5٪ CO 2 الحاضنة واستبدال جنرال موتورز مع كامل جنرال موتورز جديدة كل 3 د.
      ملاحظة: في كثير من الأحيان، وعينات الأنسجة نظام التشغيل التي تم الحصول عليها بواسطة طموح إبرة صغيرة جدا وتحتوي على شظايا العظام، والتي لا يتم هضمها من قبل الهضم الأنزيمي مع كولاجيناز. ولذلك، بعد أن تمت إزالة طاف، محاولة لفصل الخلايا من أنسجة العظام التي يهرس شظايا بيليه مع ماصة.
  2. ثقافة فرعية
    ملاحظة:
    لإنشاء OSA، عندما تصل خلايا التقاء تقريبي، بإزالتها من theiص سفينة الثقافة، تمييع، ووضع في لوحة جديدة لتمكين مزيد من النمو. ويتحقق هذا الإجراء ثقافة فرعية باستخدام الإجراء الأنزيمية وصف trypsinization.
    1. إزالة المتوسطة التي كتبها الطموح. لفصل أحادي الطبقة الخلية، إضافة 2-3 مل التربسين في RT (ماكس 18-20 درجة مئوية)، يهز بلطف مرة واحدة، وإزالة التربسين على الفور بواسطة الطموح. كرر مرتين. احتضان الخلايا عند 37 درجة مئوية لمدة 3-4 دقائق حتى تبدأ لفصل.
      ملاحظة: trypsinization جيد يمكن أن ينظر إليه من قبل المستخدم ذوي الخبرة كما الثقوب الصغيرة التي تشكل في أحادي الطبقة مبهمة قليلا عندما يقام الطبق إلى النور. ويمكن أيضا أن تراقب هذا التفكك باستخدام مجهر مقلوب. ويوصى هذا النهج للمبتدئين.
    2. وقف رد الفعل التربسين بإضافة 10 مل جنرال موتورز وغسل الطبق جيدا باستخدام ماصة لفصل كل الخلايا. نقل 1 مل من تعليق لجديد 100 ملم طبق بيتري وإضافة 9 مل جنرال موتورز (1/10 انقسام الخلايا).
      ملاحظة:
  3. الحفظ بالتبريد من الثقافات الأولية نظام التشغيل وOSA
    ملاحظة: تجميد متموجة واحد 100 مم طبق بتري إلى 4-5 cryovials. يجب إجراء عملية الحفظ بالتبريد بسرعة لأن DMSO، والذي يحمي أغشية الخلايا أثناء التجميد، غير سامة للخلايا في درجات حرارة غير التجمد.
    1. فصل مزارع الخلايا من أحادي الطبقة التي trypsinization (انظر القسم 2.2)، وخلايا بيليه بواسطة الطرد المركزي في 400 x ج لمدة 5 دقائق، وإزالة طاف بواسطة الشفط، ثم سرعان ما تعليق بيليه خلية في FM.
    2. قسامة 1 مل من هذا التعليق في القارورة المبردة. المكان على الفور قارورة مملوءة في مربع المجمد مع سترة من 2-بروبانول وتخزين immediately في -80 درجة CO / N. نقل cryovials إلى النيتروجين السائل في اليوم التالي للتخزين على المدى الطويل.
  4. خطوط الخلايا تذويب نظام التشغيل والثقافات الأولية
    1. خطوط الخلايا تذويب نظام التشغيل من تخزين النيتروجين السائل، cryovials ذوبان بسرعة عن طريق وضعها في حمام مائي المختبر عند 37 درجة مئوية. نقل محتويات cryovials إلى 15 مل أنبوب مخروطي الشكل وإضافة حوالي 10 مل من جنرال موتورز (انظر القسم 2.3 لإزالة DMSO). إزالة طاف بواسطة الطموح وتعليق بيليه خلية في 10 مل جنرال موتورز. تعليق لوحة خلية في صحن 100 ملم بيتري واحتضان في 37 درجة مئوية، و 5٪ CO 2 الحاضنة.

3. Sarcosphere الفحص لعزل OS-الخلايا الجذعية السرطانية

ملاحظة: يتم تنفيذ هذه التجربة على OSA. يرتبط مدة هذه التجربة لقدرة الخلايا على تشكيل هذه المستعمرات المجال (sarcospheres)، ومجموعة من الوقت 7، 14، 21، و 28 د.

  1. إنشlishment من فحص sarcosphere
    1. إعداد غرفة عداد خلايا الدم وجميع الكواشف مقدما.
    2. إزالة المتوسطة التي كتبها طموح وفصل الخلايا من أحادي الطبقة التي trypsinization (انظر القسم 2.2). مزيج تعليق الخلية جيدا، pipetting للتفريق أي كتل، وجمع 10 ميكرولتر باستخدام 20 ميكرولتر ماصة.
    3. نقل تعليق خلية 10 ميكرولتر على الفور إلى غرفة حافة عداد خلايا الدم، وطرد تعليق، والسماح لها التي يمكن استخلاصها تحت ساترة من العمل الشعري.
    4. مراقبة غرفة عداد خلايا الدم تحت النقيض من المرحلة. حدد الهدف 10X والتركيز على خطوط الشبكة في الغرفة. عد الخلايا الكذب في هذا المجال 1 مم 2 باستخدام التقسيمات الفرعية (ملزمة أيضا بثلاثة خطوط متوازية) وخطوط الشبكة واحدة كعامل مساعد لفرز الأصوات.
    5. قياس تركيز وتطبيق المعادلة التالية: 1 مل = ن * 10 4 / ض (ن: مجموع عدد الخلايا في جميع تحسبالساحات 1 مم 2. ض: عدد من الساحات عد 1 مم 2). حساب حجم تعليق الخلية ضروري لوحة بمبلغ إجمالي قدره 240،000 الخلايا تنقسم إلى 40000 خلايا لكل بئر في 6 جيدا لوحة مرفق منخفضة للغاية.
      ملاحظة: تأكد من لوحة العدد الصحيح من الخلايا عن طريق طلاء الخلايا في بئر إضافي واحد. وبالتالي، فإن المبلغ الإجمالي من الخلايا لتكون مطلية هو 280،000 الخلايا.
    6. إعداد 35 مل SGM بإضافة 50٪ من 2٪ MC (SGM-MC) في 25 سم 2 قارورة. إعداد الحجم الكلي للSGM النظر 5 مل إضافية من أجل لوحة جيدا إضافي واحد.
    7. إضافة حجم المحسوبة لتعليق الخلية إلى SGM-MC أعدت في قارورة وتخلط بلطف باستخدام ماصة لتفريق أي كتل. لوحة الخلايا في 6 جيدا لوحة مرفق منخفضة للغاية واستخدام مجهر مقلوب لمراقبة كيفية ظهور الخلايا بعد أن مطلي.
    8. احتضان الخلايا في 37 درجة مئوية، و 5٪ CO 2 الحاضنة. كل 3 د، إضافة الابقسامات العش من bFGF وEGF إلى كل بئر لتحديث تركيز عوامل النمو. إضافة 2 ميكرولتر bFGF و 5 ميكرولتر EGF للحفاظ على حد سواء في التركيز النهائي من 10 نانوغرام / مل في كل بئر.
  2. عزل sarcospheres
    ملاحظة: مراقبة حسن سير الفحص sarcosphere في 7 و 14 و 21 و 28 د لاتخاذ قرار عندما يكون ذلك ضروريا لعزل sarcospheres التي شكلت.
    1. إعداد جميع الكواشف والمعدات في غطاء تدفق الصفحي (الشكل 3A، B). تجميع وحدة الترشيح عن طريق وضع مرشح صافي بقطر 25 ملم وشبكة 40 ميكرون إلى حامل مرشح غشاء. تعقيم بواسطة التعقيم (الشكل 4A-E).
    2. لكل بئر، ونقل المتوسط ​​تحتوي على sarcospheres إلى حقنة مع حامل مرشح غشاء معقمة باستخدام ماصة معقمة مع طرف 1000 ميكرولتر. بعد إزالة تماما المتوسط ​​تحتوي على sarcospheres، وغسل جيدا قبل إضافةجي 5 مل جنرال موتورز للتأكد من نقل كافة المجالات لحقنة. استخدام المجهر لتأكيد ما إذا كان قد تم انتشال جميع sarcospheres. إن لم يكن، والمضي قدما بتكرار هذه الخطوة.
    3. تصفية تعليق مع حامل مرشح غشاء فقط عن طريق الجاذبية دون ضغط من أجل منع الإضرار المجالات ولتجنب الاضطرار sarcospheres عبور من خلال مرشح، وبالتالي تجنب فقدان المجالات. إزالة فقاعات الهواء باستخدام بلطف العقيمة ماصة باستير الزجاج.
      ملاحظة: في بعض الأحيان يتم حظر الترشيح من قبل وجود فقاعة الهواء في حامل مرشح غشاء.
    4. غسل وحدة الترشيح بإضافة 10 مل جنرال موتورز إلى الحقنة والسماح لها تصفية دون الضغط للتأكد من القضاء على الخلايا وحيدة. اتخاذ ما عدا وحدة مرشح من حقنة ووضعها في طبق بيتري.
    5. إزالة عامل التصفية صافي من صاحب غشاء باستخدام الملقط بيري، وأغسلها عن طريق هز بلطف مع ملاقط في 60 ملمطبق بتري للافراج عن sarcospheres من كومة من الغشاء. ثم، وضع الغشاء في بئر وتأكيد عن طريق الملاحظة المجهرية أن لم تكن هناك مجالات متشابكة في الغشاء. إذا لا تزال متشابكة المجالات في الغشاء، والمضي قدما مع غسل آخر كما هو موضح في الخطوة 3.2.4.
    6. مراقبة sarcospheres أفرج عنه باستخدام المجهر. احتضان sarcospheres صدر في 37 درجة مئوية، و 5٪ CO 2 الحاضنة. كرر جميع الخطوات لكل بئر من 6 جيدا لوحة مرفق منخفضة للغاية.

خطوط 4. OS-CSC

ملاحظة: OS-الخلايا الجذعية السرطانية يتم الحصول عليها من sarcospheres التي تظهر توسع تمسكا باعادة طرح وreculturing هذه الخلايا في أحادي الطبقة بعد ومطلي هم في الصغيرة 60 مم أطباق بتري لم تعد في ظل ظروف مرفق منخفضة للغاية.

  1. الثقافات OS-CSC
    1. لتمكين مزيد من النمو، وخلايا فرعية عند وصولها إلى ما يقرب من 90٪ التقاء في 60طبق بيتري ملم. كرر الخطوة 2.2.1 لإنشاء الثقافات OS-CSC.
    2. وقف trypsinization بإضافة 4 مل SCGM وغسل الطبق بشكل جيد، وذلك باستخدام ماصة لفصل كل الخلايا. نقل تعليق خلية إلى الجديد 100 ملم طبق بيتري وإضافة 6 مل SCGM. عندما تصل OS-الخلايا الجذعية السرطانية بنسبة 90٪ التقاء، ثقافة فرعية بتكرار القسم 2.2.
      ملاحظة: للفي المختبر تحليل لتوصيف النمط الظاهري تشبه الخلايا الجذعية من معزولة OS-الخلايا الجذعية السرطانية، ويمكن مطلي الخلايا في أنواع مختلفة من لوحات.
    3. الحفاظ على تأسيس خطوط OS-CSC من الحفظ بالتبريد (تكرار جميع الخطوات من القسم 2.3). تذويب cryopreserved OS-الخلايا الجذعية السرطانية من خلال تكرار جميع الخطوات من القسم 2.4.

5. في المختبر وnalysis لوصف OS-الخلايا الجذعية السرطانية:

  1. إعداد الخلايا لالمناعي
    يتم إصلاح الخلايا في امتصاص العرق عندما تصل إلى درجة الصحيح من التقاء في كل بئر من جيش التحرير الشعبى الصينى 24-جيدا ملاحظة:الشركة المصرية للاتصالات. يرتبط الصف التقاء لنوع من التجارب.
    1. لوحة OS-الخلايا الجذعية السرطانية في 24 لوحة جيدا لدراسة الخلايا الجذعية (MSC) علامات الوسيطة سطح المناعي. إصلاح الخلايا في كل بئر عند بلوغهم 50 - 60٪ التقاء. إزالة SCGM بواسطة الشفط، ويغسل مرتين في DPBS 24 لوحة جيدا.
    2. تحت غطاء الكيميائية، إضافة 500 ميكرولتر 4٪ PFA / DPBS إلى كل بئر. في احتضان RT لمدة 10 دقيقة. إزالة PFA / DPBS وغسل 3X مع عالى النقاء درهم 2 O. السماح لل24 لوحة جيدا حتى يجف في غطاء الدخان.
  2. المناعي للعلامات السلامة البحرية
    ملاحظة: المناعي تلطيخ للOS-الخلايا الجذعية السرطانية ثابتة في 4٪ PFA / DPBS يمكن استخدامها للتحقيق في النمط الظاهري مثل MSC من OS-الخلايا الجذعية السرطانية باستخدام الأجسام المضادة الموجهة ضد CD44، STRO-1 و CD105. يتم استخدام الطريقة التالية بشكل روتيني من قبل المؤلفين.
    1. في غطاء الكيميائية، permeabilize الخلايا التي تم إصلاحها في 4٪ PFA / DPBS بإضافة 500 ميكرولتر 0.2٪ تريتون X-100 / DPBS إلى كل بئر. احتضان الخلايا عند 37 درجة مئوية لمدة 30 دقيقة. يغسل بلطف الخلايا 3X مع DPBS. إضافة 300 ميكرولتر ريبونوكلياز المخفف 1/1000 مع 2٪ BSA / DPBS إلى الخلايا واحتضان عند 37 درجة مئوية لمدة 30 دقيقة.
    2. يغسل بلطف الخلايا 3X مع 2٪ BSA / DPBS. وصمة عار على الخلايا للعلامات السلامة البحرية. إضافة الأجسام المضادة الأولية فقط إلى آبار اختياره الضوابط الإيجابية لكل الأجسام المضادة.
      1. إضافة 300 ميكرولتر مكافحة CD105 تضعف 10/01 مع 2٪ BSA / DPBS، 300 ميكرولتر مكافحة CD44 المخفف 10/01 مع 2٪ BSA / DPBS، 300 ميكرولتر مكافحة STRO-1 المخفف 10/01 مع 2٪ BSA / DPBS وفقط 200 ميكرولتر 2٪ BSA / DPBS إلى آبار اختياره ضوابط السلبية لكل الأجسام المضادة.
      2. احتضان الخلايا في بيئة رطبة عند 4 درجة CO / N. غسل الآبار 3X مع DPBS ثم مرتين مع 2٪ BSA / DPBS.
    3. الكشف عن الأجسام المضادة الأولية بإضافة الأجسام المضادة الثانوية محددة.
      1. إضافة 300 ميكرولتر المضادة للأرنب مفتش (حمار المضادة للأرنب مفتش [H + L]) مخففة 1/100مع 2٪ BSA / DPBS في كل المختار كذلك مراقبة إيجابية وسلبية على CD44 وCD105. إضافة 300 ميكرولتر FITC مكافحة فأر IG (FITC أرنب لمكافحة فأر مفتش [H + L]) المخفف 1/100 مع 2٪ BSA / DPBS في كل المختار كذلك السيطرة الإيجابية والسلبية لSTRO-1. احتضان خلايا في الظلام في RT لمدة 60 دقيقة. غسل الآبار 6X مع DPBS.
    4. وصمة عار MSC الخلايا إيجابية علامة للحصول على الأكتين هيكل الخلية وذلك بإضافة 300 ميكرولتر phalloidin المخفف 1/100 مع 2٪ BSA / DPBS في كل الملون جيدا لMSC علامة المناعي.
    5. احتضان الخلايا لمدة 40 دقيقة في RT. غسل الآبار 3X مع DPBS ثم غسلها مرتين مع عالى النقاء درهم 2 O. انتقل إلى counterstaining من نوى بعد تلطيخ المناعي هو موضح أعلاه. إعداد يوديد propidium حل 10 -5 M في DPBS (الأسهم 1.5 × 10 -3 م) في غطاء الدخان.
      1. إضافة 200 ميكرولتر حل يوديد propidium لكل الملونة بشكل جيد كما هو موضح أعلاه. احتضان الخليةالصورة عن 2-3 دقائق على RT. يغسل الآبار مرتين مع عالى النقاء درهم 2 O.
        ملاحظة: تكرار جميع الخطوات من أقسام 5،1-5،2 على HCT8 خط الخلية، وهو خط متباينة المستمر الأساسي سرطان القولون الخلايا التي يتم استخدامها كوسيلة لمراقبة سلبية.
  3. عظمي المنشأ فحص التمايز
    يستمر المكونة للعظم التمايز لمدة 20 د: ملاحظة.
    1. لوحة OS-الخلايا الجذعية السرطانية في 24 لوحات جيدا في مناطق ذات كثافة خلية من 1 × 10 4 خلية / سم 2 في SCCGM. السماح للخلايا أن تنمو في SCGM حتى تصل إلى 80-90٪ confluency في كل بئر.
    2. بدء التمايز عظمي المنشأ عن طريق تغيير SCGM إلى OM. السماح للخلايا أن تنمو في OM وتجديد المتوسط ​​كل 3-4 د. وقف فحص التمايز عظمي المنشأ في 10 د لتقييم وجود الفوسفاتيز القلوية (ALP).
    3. إصلاح الخلايا في 4٪ PFA / DPBS (انظر القسم 5.1). تقييم النمط الظاهري بانية للعظم من تلطيخ cytochemical لحزب العمال الاسترالى وHAباستخدام الصبغ الأحمر S تلطيخ.
    4. ALP تلطيخ cytochemical
      ملاحظة: إعداد خليط الصبغة في غطاء الكيميائية فورا قبل البدء في التلوين.
      1. حل 40 ملغ سريع الأزرق BB أو سريع الملح الأحمر البنفسج LB في 50 مل تريس، حمض الهيدروكلوريك، ودرجة الحموضة 9 (الحل A). حل 5 ملغ النفثول-AS-MX ملح فوسفات الصوديوم في 1 مل DMSO (الحل B). إضافة الحل B تماما إلى الحل ألف وتخلط جيدا، والحصول على خلايا الحل جيم غسل مرتين مع DPBS.
      2. إضافة 500 ميكرولتر - 1 مل الحل مئوية إلى كل بئر واحتضان عند 37 درجة مئوية و 5٪ CO 2. مراقبة سير تلطيخ كل 10 دقيقة خلال مراقبة الخلايا تحت المجهر.
      3. وقف تلطيخ عندما تصبح الخلايا ALP إيجابية الملونة بشكل مكثف (الأزرق مع الأزرق السريع BB الملح أو الأحمر مع السريعة الأحمر البنفسج LB الملح)، والذي يحدث عادة في غضون 30 دقيقة. غسل الخلايا 3X مع DH عالى النقاء 2 O لإزالة جميع المخلفات من الحل C. إذا راسب من أنا وصمة عارحاضر، وغسل الخلايا بسرعة مرة واحدة مع الايثانول المطلق.
      4. انتقل إلى counterstaining من نوى بعد تلطيخ ALP كما هو موضح في الخطوات 5.2.5 و5.2.5.1.
    5. الصبغ الأحمر الأحمر S تلطيخ cytochemical
      ملاحظة: إعداد خليط الصبغة قبل بدء التجربة.
      1. إعداد 2٪ الصبغ الأحمر S (2 ز الصبغ الأحمر S في 100 مل من عالى النقاء H 2 O). إضافة 2.5٪ NH 3-2٪ الصبغ الأحمر S لتصل إلى 6.0 درجة الحموضة. مخزن 2٪ محلول الصبغ الأحمر S في 4 درجات مئوية. غسل خلايا مرة واحدة مع DPBS.
      2. إضافة الصبغ الأحمر S إلى الخلايا لمدة سوى عدد قليل من ثانية.
      3. غسل الآبار مع DH عالى النقاء 2 O للسيطرة على درجة من تلطيخ. إذا كانت الودائع HA ليست الملونة بشكل مكثف، كرر الخطوة 5.3.5.2. وقف تلطيخ عندما تصبح الودائع HA الحمراء بشكل مكثف اللون، والذي يحدث عادة في غضون دقائق قليلة. غسل الآبار مع عالى النقاء درهم 2 O.
    6. التمايز مكون الشحم
      ملاحظة: الفحص مدة يعتمد على خطوط OS-CSC. الفحص يمكن أن تستمر 14-30 د.
      1. لوحة OS-الخلايا الجذعية السرطانية في 24 لوحات جيدا في مناطق ذات كثافة خلية من 1 × 10 4 خلية / سم 2 في SCGM. السماح للخلايا أن تنمو في SCGM حتى تصل إلى 80-90٪ confluency في كل بئر. بدء التمايز مكون الشحم عن طريق تغيير SCGM إلى AM. السماح للخلايا أن تنمو في AM وتجديد صباحا مرتين في الأسبوع.
      2. وقف فحص التمايز مكون الشحم عندما الحويصلات الدهنية مرئية. تقييم النمط الظاهري مكون الشحم من الزيت الأحمر يا تلطيخ وhaematoxylin counterstaining للنواة.
      3. Haematoxylin counterstaining للنوى
        ملاحظة: إعداد خليط الصبغة قبل بدء التجربة.
        1. إعداد الحل haematoxylin 5٪، ودعا Emallume Carazzi 39. تخزين الحل في 4 درجات مئوية. إضافة Emallume Carazzi فقط 2 دقيقة. غسل الآبار مع الموجrapure درهم 2 O.
    7. كفو فحص
      ملاحظة: يجب إجراء هذه التجربة في يثلث.
      1. لوحة OS-الخلايا الجذعية السرطانية في 100 ملم أطباق بتري في مناطق ذات كثافة خلية من 450 خلية / سم 2 في CFUM. احتضان الخلايا في 37 درجة مئوية، و 5٪ CO 2 الحاضنة لمدة 4 أسابيع. تحديث CFUM مرتين في الأسبوع.
      2. وصمة عار على CFUs مع طولويدين الأزرق. عدد المستعمرات الملونة باستخدام مجهر مقلوب. حساب الكفاءة كفو وفقا للمعادلة التالية: (عدد المستعمرات شكلت / عدد الخلايا المصنف) * 100.
    8. تحليل النشاط ALDH
      وقد تم تقييم ALDH النشاط باستخدام ALDH آخر اللونية الفحص كيت على خطين OS-ديوان الخدمة المدنية وعلى خط الخلايا الليفية محدود، والتي كانت تستخدم كقاعدة للسيطرة سلبية: ملاحظة. هذه المجموعة يقيس النشاط الأنزيمي ALDH الامتصاصية القراءة في 450 نانومتر. وقد أجريت جميع الاختبارات في يثلث.
      1. فصل مزارع الخلايا من أحادي الطبقة التي trypsinization (انظر القسم 2.2). بيليه الخلايا بواسطة الطرد المركزي في 400 x ج لمدة 5 دقائق. اتبع بروتوكول الشركة الصانعة.
    9. تحليل تدفق cytometric:
      ملاحظة: يطلب تعليق خلية واحدة لتلطيخ الأمثل للعينات لالتدفق الخلوي. يجب أن يكون تعليق خلية واحدة مستعدة لكل الأجسام المضادة لفحصها. فصل مزارع الخلايا من أحادي الطبقة التي trypsinization (انظر القسم 2.2).
      1. ضع تعليق الخلية في أنبوب مخروطي الشكل، إجراء تعداد خلايا باستخدام Bürker عد الغرفة، وخلايا الطرد المركزي في 400 x ج و resuspend في حجم مناسب من العازلة الفصل للحصول على تعليق خلية في تركيز الخلية النهائي 1 × 5 10 خلايا / مل.
      2. الطرد المركزي تعليق خلية لمدة 5 دقائق في 4 درجات مئوية. تجاهل طاف ويغسل بيليه مع العازلة الفصل. كرر هذه الخطوة مرتين.
      3. خلايا وصمة عار لمرض التصلب العصبي المتعددعلامات C (أي، CD44، CD105 وSTRO-1) 40.
      4. تحليل تعليق خلية الملون بشكل إيجابي في عداد الكريات التدفق. تحليل عينات وضع علامة داخل 1 د. احتضان هذه العينات في 4 درجات مئوية حتى التحليل.
    10. RT-PCR
      1. استخراج وعزل الحمض النووي الريبي
        1. إضافة 1 مل تحلل كاشف لالعينات المجمدة الخلوية معبأة من OS-الخلايا الجذعية السرطانية وليز الخلايا مباشرة في الأنبوب قبل pipetting بيليه صعودا وهبوطا عدة مرات.
        2. الطرد المركزي العينات في 12000 x ج لمدة 1 دقيقة على 4 درجات مئوية. إزالة بلطف طاف. طاف لنقل أنبوب جديد، إضافة 200 ميكرولتر الكلوروفورم، وغطاء الأنبوب بشكل آمن. هز أنبوب بقوة لمدة 15 ثانية، واحتضان العينة لمدة 5 دقائق على RT.
        3. الطرد المركزي العينات في 12000 x ج لمدة 15 دقيقة على 4 درجات مئوية. الخليط يفصل في ثلاث مراحل مختلفة. الحمض النووي الريبي هو حصرا في المرحلة المائية العليا عديم اللون.
        4. يجري سنوياالحذر rticularly، فقط إزالة المرحلة المائية ونقل هذه المرحلة في أنبوب جديد للمضي قدما عزل الحمض النووي الريبي. إضافة 500 ميكرولتر الأيسوبروبانول إلى الأنبوب الذي يحتوي على المرحلة المائية. هز أنبوب بلطف باليد. احتضان العينة على RT لمدة 10 دقيقة. أجهزة الطرد المركزي في العينة 12000 x ج لمدة 10 دقيقة على 4 درجات مئوية.
          ملاحظة: بعد طرد العينة، فمن الممكن رؤية RNA، الذي يشكل بيليه يشبه الجل على الجانب وعلى الجزء السفلي من الأنبوب.
        5. إزالة طاف من الأنبوب، والحرص على ترك بيليه من الحمض النووي الريبي في القاع. إضافة 1 مل 75٪ من الإيثانول إلى الأنبوب. دوامة أنبوب باليد لمدة بضع ثوان ثم الطرد المركزي الأنبوب في 7500 x ج لمدة 5 دقائق في 4 درجات مئوية.
        6. تجاهل الايثانول والهواء الجاف بيليه الحمض النووي الريبي. عندما بيليه جاف، resuspend وبيليه الحمض النووي الريبي في ريبونوكلياز خالية من الماء (10-50 ميكرولتر) من قبل pipetting الحل صعودا وهبوطا عدة مرات.
        7. تحديد العائد ونقاء من الحمض النووي الريبي عن طريق الاتفاقات البيئية المتعددة الأطرافأورينغ الامتصاصية في 260 نانومتر و 280 نانومتر باستخدام مطياف. تقييم سلامة الحمض النووي الريبي كامل على معيار الجل الاغاروز 1٪. تخزين الحمض النووي الريبي في -80 درجة مئوية.
      2. تفاعل البلمرة المتسلسل العكسي
        1. توليف cDNAs المنطلق الأول من 500 عينة نانوغرام الحمض النووي الريبي باستخدام مجموعة النسخ العكسي. عينات الحمض النووي الريبي ذوبان الجليد على الجليد وذوبان الجليد الحلول اللازمة في الطقم في RT. الشروع في تجميع cDNAs بعد بروتوكول الشركة الصانعة.
      3. نصف الكمية عكس الناسخ، البلمرة المتسلسل (RT-PCR)
        1. أداء جميع تقارير إتمام المشروعات باستخدام 1 ميكرولتر كدنا] لكل عينة كنموذج في حجم رد الفعل النهائي من 24 ميكرولتر. استخدام تسلسل التمهيدي المدرجة في الجدول (1) لتضخيم NANOG، أكتوبر 3/4، SOX2 وCD133 الجينات.
        2. فصل المنتجات RT-PCR بنسبة 1.8٪ الاغاروز الكهربائي للهلام وصمة عار مع بروميد إيثيديوم. صورة تحت ILLUM الأشعة فوق البنفسجيةination.

Representative Results

عينات نظام التشغيل التي تم الحصول عليها بواسطة البزل بالإبرة أو الاستئصال الجراحي لجزء صغير من الورم (الشكل 1A، B) تسمح عزل OSA واحدة فقط إذا تم علاجها على وجه التحديد، كما هو موضح في قسم البروتوكول (الشكل 2A، B). وللأسف، فإن عدد الخلايا المعزولة من الخزعات منخفضة، مع مجموعة والانتاج 30-50٪. يعتمد الإخراج على نوع والبعد من الخزعات (الشكل 5A، B). ويجب أن يعامل هذه الخلايا على وجه التحديد. ونتيجة لذلك، ما يقرب من شهر واحد ضروري للثقافات الأولية للوصول إلى confluency في 100 مم طبق بيتري. بعد هذا الوقت، ويتم الحصول على OSA من عينتين OS ملحوظ OSA5 وOSA6 (الشكل 6A، B). ثم، فمن الضروري أن ثقافة فرعية خط الخلية الأساسي للحصول على عدد كاف من الخلايا لإجراء تحليل وتوصيف ولcryopreserve الخلية لينوفاق. في مرور 3 الثالثة من ثقافة فرعية، عند كل OSA خطوط الخلايا الأولية تصل confluency، ومطلي انهم في 6 جيدا لوحات مرفق منخفضة للغاية لفحص sarcosphere. ويستخدم هذا النوع من لوحة لأنه يسمح لنا للحفاظ على الخلايا في دولة مع وقف التنفيذ، لمنع الخلايا الجذعية من التمايز بوساطة المرفق، لمنع الخلايا التي تعتمد على مرسى من الانقسام، وأخيرا، للحد من التعلق الركيزة. وبالتالي، فإن استخدامها يسمح لنا لخلق حالة ضاغطة للحصول على الخلايا السرطانية، وهو أمر ضروري لاختيار الخلايا الجذعية السرطانية. في 24 ساعة بعد بدء الفحص، تظهر خلايا معزولة عن بعضها البعض (الشكل 7). بعد 7 أيام من مراقبة تطور الفحص، بدأت المستعمرات كروية صغيرة لتشكيل ومرئية (الشكل 8). في 28 د، عدة مستعمرات كروية كبيرة التي شكلت في كل بئر يمكن ملاحظتها (الشكل 9A، B). بعد sarcospheres هفتم مثقف ه لمدة 28 د، هذه المستعمرات كروية كبيرة يمكن أن تكون معزولة. ويبين الشكل 10 خطوات لعزل sarcospheres من 6 جيدا لوحات مرفق منخفضة للغاية وreculturing منها في ظل الظروف ملتصقة الشكل 11 يبين مستعمرات كروية العائمة بعد العزلة. المستعمرات كروية كبيرة مطلية في لوحات مرفق العادية تظهر توسع ملتصقة بعد العزلة (الشكل 12A، B). الخلايا التي توسع من sarcospheres احد وربما الخلايا السرطانية مع الجذعية تشبه الخلايا النمط الظاهري. وبالتالي، بعد العزلة، وربما كانت حصلت OS-الخلايا الجذعية السرطانية. تتم تسمية هذه الخلايا الجذعية السرطانية OSA5-وOSA6-الخلايا الجذعية السرطانية (الشكل 13A، B).

في هذه المرحلة، لا بد من المضي قدما في توصيف الجذعية تشبه الخلايا النمط الظاهري لاثنين من خطوط OS-CSC التي تم الحصول عليها، كما هو موضح أعلاه. التحليلات لتوصيف ور النمط الظاهري تشبه الخلايا الجذعيةيقوم الإلكترونية على مرور ال 4 من ثقافة فرعية بعد أن تم عزل sarcospheres لكل خط OS-CSC. أظهرت خطوط الخلايا اثنين، OSA5-الخلايا الجذعية السرطانية وOSA6-الخلايا الجذعية السرطانية، إيجابية قوية للعلامات السلامة البحرية السطحية (CD105 وCD44) (الشكل 14A، B) والشكل (15A، B)، في حين أنها أظهرت إيجابية معتدلة للعلامة MSC سطح Stro- 1 (الشكل 16A، B). وقد تأكدت لدينا ملاحظات نتائج سلبية حصلت مع الخط التجاري ومتباينة خلية سرطان القولون HCT8 (الشكل 14C، 15C الشكل، الشكل 16C). وقد لوحظ انعدام تام للتلطيخ محددة وغير محددة لهذه العلامات السطحية في خط الخلية HCT8.

لتقييم النمط الظاهري MSC من اثنين OS-الخلايا الجذعية السرطانية، ونحن أيضا يحلل أداء cytometric التدفق. كل من خطوط OS-CSC أعربت مستويات عالية من CD44 وCD105. ومع ذلك، من الخلايا في كل من خطوط الخلايا، أعربت٪ فقط 1.14 STRO-1. لذلك، هذا إعادةأكد السلط وجود معتدلة من STRO-1 كما يتضح من تلطيخ المناعي. في المقابل، أعربت 99.62٪ من OSA5-الخلايا الجذعية السرطانية CD44 وأعرب 87.38٪ من هذه الخلايا CD105. وأعرب 99.88٪ من OSA6-الخلايا الجذعية السرطانية CD44 في وأعرب 95.79٪ من هذه الخلايا CD105. بالإضافة إلى ذلك، كل من خطوط الخلايا هي CD45-.

قمنا بتقييم التعبير عن 3 علامات ESC (NANOG، أكتوبر 3/4، Sox2) ومن الجين CD133، علامة الخلايا الجذعية السرطانية آخر، عن طريق RT-PCR. لاحظنا أن كل من هذه الجينات وأعرب في كلا الخطين OS-CSC (الشكل 17). أظهرت فحوصات التمايز مكون الشحم والمكونة للعظم قدرة على حد سواء معزولة خطوط OSA-CSC على التمايز إلى بانيات (الشكل 18A - D والشكل 19A - D) وفي الخلايا الشحمية (الشكل 20A - D).

وعلاوة على ذلك، وكفو على أظهرت ssay (الشكل 21) على نسبة جيدة من الكفاءة مولد الرمع، مع 13٪ للOSA5-الخلايا الجذعية السرطانية و 14٪ للOSA6-CSC. وقد أظهرت عدة دراسات حديثة أن مستويات عالية من النشاط ALDH هي سمة من أنواع مختلفة من السرطان. هذه المعلمة يمكن استخدامها بوصفها علامة الخلية الجذعية السرطانية ويرتبط ارتباطا مع بسوء التشخيص. أظهر فحص النشاط ALDH أن كلا الخطين OS-CSC لديهم مستويات عالية من النشاط ALDH (الشكل 22)، في حين لوحظ نشاط ALDH في الحد الأدنى للقياس الكمي في خط الليفية التي تم استخدامها كعنصر تحكم السلبية في هذا الاختبار.

شكل 1
الشكل 1. أمثلة من عينات الخزعة نظام التشغيل. (A). عينة الخزعة التي تم الحصول عليها بواسطة البزل بالإبرة. (B). عينة الخزعة التي حصلت عليها الاستئصال الجراحي لجزء من الورم.884 / 53884fig1large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. تبويب الميكانيكية من عينة نظام التشغيل. (A) تجزئة عينة باستخدام الملقط بيري وانسيت. (ب) شظايا معلقة في CM (الذي يشير إليه السهم). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. المعدات والمستهلكات اللازمة لعزل Sarcospheres. (A). جميع المعدات اللازمة لعزل الخلايا. 1. محقنة معقمة مع حامل مرشح غشاء العقيم. 2. اثنان وسائل الإعلام المختلفة: جنرال موتورزالثانية SCGM. 3. معقم الزجاج ماصة باستير. (ب) تفاصيل عن حقنة تجميعها على الدعم، مع حامل تصفية الغشاء. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (4)
الرقم 4. وحدة الترشيح. العديد من العناصر اللازمة لتجميع وحدة الترشيح (A) (يشار تصفية صافي بالسهم). الملاحظة النقيض المرحلة من 40 ميكرون تنسجم (يشار شبكة واحدة بواسطة السهم) من صافي مرشح (B). التكبير الأصلي: 10X. وحدة الترشيح تجميعها (C - D). وحدة الترشيح تعقيمها (E). الرجاء انقر هنا لعرض أكبر هاءrsion من هذا الرقم.

الرقم 5
الرقم 5. الثقافات الخلية الأولية من نظام التشغيل التقليدية. الملاحظة المرحلة تباين الثقافات الخلية الأولية من ارتفاع OS الصف. في الفقرة (أ)، عدة شظايا العظام مشرقة واضحة، بينما في (B)، وجود عدة كرات الدم الحمراء مدورة وصغيرة عائمة. التكبير الأصلي: 10X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (6)
الشكل 6. التقليدية ساركوما العظام خطوط الخلايا المتناهية (OSA). (A) OSA5 و (ب) OSA6. الملاحظة في المرحلة التباين.التكبير الأصلي: 10X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 7
الرقم 7. Sarcosphere الفحص من OSA5 وOSA6. وبعد 24 ساعة من بدء فحص الخلايا ويتحرك ومعزولة عن بعضها البعض (يشار إلى الخلايا عن طريق السهام). المراقبة في مرحلة التباين. الأصلي التكبير: 20X الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

شكل 8
الرقم 8. Sarcosphere الفحص من OSA5 وOSA6 في 7 د 7 د في الفحص، والعديد من spherica صغيرويمكن ملاحظة المستعمرات ل محاطة الخلايا وحيدة. وsarcospheres (بعض هذه sarcospheres بالرمز الأسهم) تبدو عائمة في وسط أو تسوية قليلا الى اسفل قاع البئر. المراقبة في مرحلة التباين. التكبير الأصلي: 20X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 9
الرقم 9. Sarcosphere الفحص من OSA5 وOSA6 في 28 د بعد 28 يوما، لوحظ العديد sarcospheres العنبر كبيرة في كل بئر من لوحات لكل خط الخلية OSA، OSA5 (A) وOSA6 (B). حجم شريط: 100 ميكرون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم. </ P>

الرقم 10
الرقم 10. ممرات لعزل Sarcospheres خطوات sarcospheres عزل من 6 جيدا لوحات مرفق منخفضة للغاية وreculturing في ظل ظروف تمسكا ترد (A) جميع المعدات اللازمة لعزل.: 1. واحد 6 جيدا لوحة منخفضة للغاية مع sarcospheres شكلت في كل بئر، 2. حقنة مع حامل تصفية صافي، 3. ماصة، 4. 1000 ميكرولتر نصائح عقيمة، 5. 2 ملاقط معقمة بيري، 6. 2 وسائل الإعلام ثقافة مختلفة ، 7. معقم ماصة باستير 8. أطباق بتري. (ب) جمع sarcospheres. المتوسط ​​الواردة في كل بئر يتم جمعها باستخدام ماصة مع معقم طرف 1000 ميكرولتر. (ج) جمع تعليق في المحقنة. يتم نقل تعليق جمعها إلى حقنة لبدء عملية الترشيح الطبيعية باستخداممرشح حامل الغشاء. (D) الترشيح الطبيعي. (E) تفكيك حامل تصفية غشاء من الحقنة. بعد يتم تصفية كل تعليق، يتم أخذ صافي حامل مرشح على حدة ووضعها في طبق بتري. (F) تفكيك حامل تصفية الغشاء. وترد Sarcospheres في المسام من صافي مرشح في حامل تصفية صافي، لذلك لا بد من الافراج عن استخدام ملاقط بيري. (G، H) إزالة sarcospheres من غشاء. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 11
الرقم 11. Sarcosphere العزلة. تطفو sarcospheres معزولة في المتوسط في طبق بتري 60 مم. المراقبة في مرحلة التباين.التكبير الأصلي: 40X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 12
الرقم 12. Sarcosphere بعد عزل. Sarcospheres من OSA5 (A) وOSA6 (ب) خطوط الخلايا في بداية التوسع ملتصقة التالية إعادة وreculturing في أحادي الطبقة في ظل ظروف ملتصقة في 48 ساعة بعد العزلة. المراقبة في مرحلة التباين. التكبير الأصلي: 20X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 13 الرقم 13. Sarcospheres في 7 D بعد عزل. أظهرت Sarcospheres من OSA5 (A) وخطوط الخلايا OSA6 (ب) التوسع ملتصقة التالية إعادة وreculturing في أحادي الطبقة في ظل ظروف ملتصقة في 7 أيام بعد العزلة. المراقبة في مرحلة التباين. التكبير الأصلي: 20X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 14
الرقم 14. المناعي تلطيخ لCD105. تلطيخ المناعي للCD105 في خطوط OSA-CSC-OSA5 الخلايا الجذعية السرطانية (A) وOSA6-الخلايا الجذعية السرطانية (ب) وفي خط الخلية المستمر HCT8 (C)، والذي تم استخدامه كوسيلة لمراقبة سلبية. LSCM في اللون التقليدي : أخضر لCD105 والأحمر للالهيكل الخلوي. التكبير الأصلي: 10X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 15
الرقم 15. المناعي تلطيخ لCD44. تلطيخ المناعي للCD44 في خطوط OSA-CSC-OSA5 الخلايا الجذعية السرطانية (A) وOSA6-الخلايا الجذعية السرطانية (ب) وفي خط الخلية المستمر HCT8 (C)، والذي تم استخدامه كوسيلة لمراقبة سلبية. LSCM في الألوان التقليدية: أخضر لCD44 والأحمر للالهيكل الخلوي. التكبير الأصلي: 10X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

ضمن الصفحات = "1"> الرقم 16
الرقم 16. المناعي تلطيخ Stro1. تلطيخ المناعي للSTRO-1 في خطوط OSA-CSC-OSA5 الخلايا الجذعية السرطانية (A) وOSA6-الخلايا الجذعية السرطانية (ب) وفي خط الخلية المستمر HCT8 (C)، والتي كانت تستخدم كقاعدة للسلبية مراقبة. LSCM في الألوان التقليدية: أخضر لSTRO-1 والأحمر للالهيكل الخلوي. التكبير الأصلي: 10X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 17
الرقم 17. التعبير عن علامات ESC النووية ومن CD133 جين. RT-PCR تبين التعبير عن NANOG، أكتوبر 3/4، Sox2 وCD133 في OSA5-الخلايا الجذعية السرطانية (A) وفي OSA6-الخلايا الجذعية السرطانية ( الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (18)
الرقم 18. المكونة للعظم التمايز الفحص - ALP التمايز المكونة للعظم في 0 د (A، B) وبعد 10 د (C، D) الحث على النحو الذي يحدده تلطيخ cytochemical لحزب العمال الاسترالى باستخدام سريع الأزرق BB. في الزرقاء، ALP + الخلايا. في أحمر، counterstained النواة مع يوديد propidium. الملاحظة المركبة في brightfield وفي مضان. التكبير الأصلي: 20X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 19 الرقم 19. المكونة للعظم التمايز الفحص - HA التمايز المكونة للعظم في 0 د (A، B) وبعد 20 د (C، D) الحث على النحو الذي يحدده تلطيخ cytochemical لهيدروكسيباتيت (HA) مع الصبغ الأحمر الأحمر S. ويتناقض الخلايا في هي ملطخة الودائع الزرقاء / الرمادية، ومحبب من HA باللون الأحمر. المراقبة في مرحلة التباين. التكبير الأصلي: 40X. حجم شريط: 100 ميكرون الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 20
الرقم 20. مكون الشحم التمايز الفحص. التمايز مكون الشحم في 0 د (A، B) وبعد 14 د (C، D) الحث على النحو الذي يحدده cytochتلطيخ ال- مع النفط الأحمر O. والأحمر، والحويصلات شحمي (يشار إلى الحويصلات أكبر من السهام أسود / أحمر؛ ويشار إلى الحويصلات أصغر من السهام أبيض / أسود)؛ في الأزرق / البنفسجي، نوى counterstained بواسطة haematoxylin. المراقبة في brightfield. التكبير الأصلي: 40X. حجم شريط: 100 ميكرومتر الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 21
الرقم 21. كفو الفحص. كفو فحص خطوط OSA-CSC ملطخة طولويدين الأزرق. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 22 /> الشكل 22. ALDH آخر الفحص. مقايسة اللونية ALDH اكتشاف مستويات عالية من النشاط ALDH في خطين OS-CSC، OSA5-الخلايا الجذعية السرطانية وOSA6-الخلايا الجذعية السرطانية، في حين أن فحص الكشف عن عدم وجود هذا النشاط في خط خلية متمايزة محدود من الخلايا الليفية، الاكذوبه. أشرطة الخطأ: SD. **: ع <0.001 مقابل الاكذوبه. *: ص <0.01 مقابل الاكذوبه الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

2 "> GGTTCAGGATGTTGGAGAGTT CCCAGCTGTGTGTACTCAAT
جينة أليغنوكليوتيد] تسلسل (5¹-3¹) حجم Amplicon (بي بي) Tₐ (درجة مئوية)
NANOG إلى الأمام التمهيدي عكسي التمهيدي 87 60
أكتوبر 3/2 إلى الأمام التمهيدي عكسي التمهيدي GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 إلى الأمام التمهيدي عكسي التمهيدي TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 إلى الأمام التمهيدي عكسي التمهيدي CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
بي بي، بأزواج القواعد من حجم amplicon، Tₐ، الصلبدرجة الحرارة

الجدول 1. قائمة مفصلة من التمهيدي متواليات لNANOG، أكتوبر 3/4، Sox2 وCD133 مع حجم Amplicon ودرجة الحرارة التليين

Discussion

الخلايا الجذعية السرطانية لها العديد من الخصائص التي تسمح بتحديد هوية هذه المجموعة الفرعية الخلوية خاصة في الجزء الأكبر الورم. على أساس هذه الخصائص، مثل المقاومة المكتسبة لالسامة للخلايا وكلاء العلاج الكيميائي للoverexpression من ATP ملزم كاسيت المتعددة النقل هروب رأس المال 28، 32، 33، أو لupregulation من التعبير عن الانزيمات إزالة السموم مثل ALDH 32، للتعبير من علامة سطح معينة، مثل CD133، CD44، CD34، CD90، والبعض الآخر 30، 34، 35، 41، عدة أساليب مختلفة لعزل الخلايا الجذعية السرطانية وقد وضعت 42-44. واحدة من هذه التقنيات هو فحص تكوين المجال، والتي تقوم على قدرة الخلايا الجذعية السرطانية على النمو في ظروف غير ملتصقة.

وقد وصفت قدرة الخلايا الجذعية الأنسجة والخلايا الجذعية السرطانية لتشكيل المجالات للمرة الأولى في الدراسات على تحديد الخلايا الجذعية العصبية من قبل رينولدز وآخرون. 37. وفي وقت لاحق، جيبس وآخرون. 38 لناإد هذه الدراسات للبدء في عزل الخلايا الجذعية السرطانية من الأورام الصلبة، على وجه الخصوص، من الأورام اللحمية العظام. لقد قررت استخدام طريقة فحص تكوين المجال يتضح من جيبس وآخرون لعزل الخلايا الجذعية السرطانية من خطوط الخلايا OSA تم الحصول عليها من الخزعات نظام التشغيل التقليدية. نحن تكييف طريقة الأصلي لتحسين نتائج هذا الاختبار وتسهيل استنساخ من أجل خطوط الخلايا السرطانية الأخرى. مع الإشارة إلى إنشاء مقايسة تشكيل المجال، تحققنا من الطلاء 40000 خلية / جيدا هو ممارسة جيدة للحفاظ على الخلايا في عزلة في بداية الفحص. هذه الحيلة هي مهمة جدا لتجنب احتمال أن المستعمرات كروية تنشأ من تجميع الخلايا وليس من قدرة خاصة وحصرية لديوان الخدمة المدنية واحد لتنمو في ظل ظروف غير ملتصقة وتشكيل مستعمرة كروية. هذه القدرة هي النقطة الحرجة بشكل خاص من هذا الاختبار.

نحن أيضا شهادة أن الحصول على نسبة جيدة من تشكيل المجال، فإنه يكفي لتحديث aliquots من عوامل النمو كل 3 د وليس كل يوم كما هو موضح في طريقة الأصلي. في هذه الدراسة، ونحن كما أنشأت وصفت على نطاق واسع وسيلة جيدة لعزل المستعمرات الكروية التي شكلت عندما مثقف في ظل ظروف غير ملتصقة. هذه خطوة حاسمة في هذا الاختبار لأنه من المهم جدا لمحاولة عزل أكبر عدد ممكن من المجالات ممكن أن تتشكل في كل بئر من دون تعرضها للتلف. ومن المهم أيضا لعزل فقط المجالات وليس الخلايا واحد، والتي يمكن أن تبقى في تعليق لمدة الفحص. للتغلب على هذه النقاط الحرجة، قمنا بتطوير طريقة العزل معين، والتي، كما هو مبين أعلاه، أعطى نتائج جيدة لديوان الخدمة المدنية العزلة. ومن الواضح أن هناك إمكانية أن ليس كل المجالات التي شكلت يمكن استردادها، ولكن نسبة خسارة منخفضة جدا. في الواقع، لدينا أيضا إمكانية استخدام فلتر مع 40 ميكرون المسام لعزل المجالات بعد أن تصبح كبيرة (شكلإد حوالي 100-200 الخلايا).

توقف هذه العزلة تشكيل المجال ولكن يسمح للخلايا واحدة، وهي جزء من بقايا ميثيل، وأصغر المجالات لتتم تصفيته. يتم تنفيذ هذا القضاء عن طريق الترشيح شامل كما هو موضح في البروتوكول.

وعلاوة على ذلك، واختيار من أكبر مستعمرات كروية من خلال 40 ميكرون مع شبكة يترتب على ذلك من فقدان أصغر مستعمرات كروية يسمح احد لتحديد الخلايا الجذعية السرطانية مع قدرة أعلى على شكل مستعمرات كروية وبمزيد من stemness. تم تنفيذ كل هذه التعديلات لتحسين الفحص ومساعدة الباحثين على دراسة الخلايا الجذعية السرطانية لفهم وإنتاج الخطوة الأكثر أهمية من الأسلوب الأصلي للمقايسة تشكيل المجال.

من بين الدراسات المتعلقة في طرق المختبر لالخلايا الجذعية السرطانية عزل، فإن هذه الدراسة تهدف الى اظهار كيف ان هذه تكييفها مجال تشكيل الفحص يمكن أن يكون وسيلة جيدة لعزل الخلايا الجذعية السرطانية منخطوط الخلايا OSA. ووصفت التكيف مع أسلوب الأصلي وتقنية عزل مفصلة تحسين فعاليته. في وقت قصير، ويمكن الحصول على عدد لا بأس به من الخلايا الجذعية السرطانية، ويستخدم لعدة تجارب. لذلك، فمن الممكن لتأكيد بسرعة الظواهر مثل الجذعية، وعلى وجه الخصوص، لدراسة مثل الجذعية النمط الظاهري المزدوج الذي يميز OS-الخلايا الجذعية السرطانية. وبالتالي، يمكن لهذا الفحص المعدلة يكون أسلوب جيد لعزل الخلايا الجذعية السرطانية، ودراسة علم الأحياء الخاصة بهم. في المستقبل، وهذه الطريقة، مع تعديلات إضافية، ويمكن أيضا أن تستخدم لعزل الخلايا الجذعية السرطانية من خطوط الخلايا السرطانية محدود الأخرى التي حصلت عليها خزعات من الأورام الصلبة نادرة.

إمكانية عزل الخلايا الجذعية السرطانية من الأورام الصلبة نادرة، مثل نظام التشغيل، يسمح تحسن من الدراسات حول هذا السرطان معين فحسب، بل يمتد أيضا إلى دراسات من أنواع مختلفة من السرطان لتطوير طرق أفضل لعزلتهم وللدراسات المستقبلية للبيولوجيا هذه المجموعة الفرعية الخلوية الهامة. ولذلك، ونحنفعلت في هذه الدراسة، من المهم تحسين أساليب CSC العزلة من خلال دراسة علم الأحياء ديوان الخدمة المدنية، مع الهدف النهائي المتمثل في إيجاد أهداف جزيئية وتطوير علاج مضاد للسرطان محددة للغاية الموجهة ضد هذه المجموعة الفرعية الخلوية معينة، والتي ربما تكون مسؤولة عن الحفاظ على الورم الرئيسي، وتطوير تكراره، وأصل الانبثاث في عدة أجهزة. دراسة البيولوجيا CSC مهمة لإيجاد العلاجات التي يمكن أن تكون قاطعة في العلاج من السرطان، مثل نظام التشغيل، والتي ومعدل البقاء على قيد الحياة بعد العلاج المواد الجديدة المساعدة لا تزال سيئة للغاية أيضا.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics