הקמת סרטן גזע תא תרבויות מן האדם הקונבנציונלי אוסטאוסרקומה

Cancer Research
 

Summary

הנוכחות של תאי גזע סרטניים (CSCS) ב סרקומות עצם נקשר לאחרונה בפתוגנזה שלהם. במאמר זה, אנו מציגים את הבידוד של CSCS מתרבויות תא ראשוניים המתקבלות ביופסיות אדם של אוסטאוסרקומה קונבנציונלי (OS) באמצעות היכולת של CSCS לגדול בתנאי nonadherent.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

השיפורים הנוכחיים בטיפול נגד אוסטאוסרקומה (OS) הדבר מאריכים את חייהם של חולי סרטן, אך שיעור ההישרדות של חמש שנים נשאר עני כאשר גרורות התרחשו. לתאי גזע סרטן (CSC) התיאוריה גורסת כי יש תת של תאים סרטניים בתוך הגידול בעלות מאפיינים הגבעולי, הכולל יכולת לשמור על הגידול להתנגד כימותרפיה multidrug. לכן, הבנה טובה יותר של הביולוגיה בפתוגנזה OS נחוצה כדי לקדם את הפיתוח של טיפולים ממוקדים למגר משנה המסוים הזה כדי להפחית תחלואה ותמותה בקרב חולים. בידוד CSCS, הקמה בתרביות תאים של CSCS, ולומד הביולוגיה שלהם הם צעדים חשובים כדי לשפר את ההבנה שלנו של ביולוגית OS בפתוגנזה. הקמת CSCS-OS נגזרות אנושי ביופסיות של מערכת הפעלה כבר מתאפשרת באמצעות מספר שיטות, כולל את היכולת ליצור תרביות תאי גזע 3 ממדים תחת nonadhereתנאי NT. בתנאים אלה, CSCS מסוגל ליצור מושבות צפות כדוריות נוצרו על ידי תאי גזע בת; מושבות אלה מכונים "תחומי הסלולר". כאן, אנו מתארים שיטה להקים תרבויות CSC מתרבויות תא ראשוניות של מערכת הפעלה קונבנציונלית המתקבלת ביופסיות OS. אנו בבירור לתאר את כמה קטעים נדרש לבודד ולאפיין CSCS.

Introduction

סרקומות הן קבוצה הטרוגנית של גידולים ממאירים רקמת חיבור נדירים שמקורם בעיקר מן mesoderm העוברי 1. הסוגים השונים כוללים סרקומות עצם סרקומות של רקמות רכות. סרקומות עצם, קבוצה של גידולים ראשוניים נדירים יחסית, מורכבות תת שונים, וביניהם אוסטאוסרקומה (OS). OS, אחד הגידולים הראשוניים הנפוצים ביותר של העצם, היא סרטן mesenchymal שמספק היסטולוגית, קלינית נרחבת, ו heterogeneities המולקולרית 2, 3. למרבה הצער, מערכת הפעלה מתרחשת בעיקר אצל ילדים וגם אצל מבוגרים צעירים 4, 5 ו מייצגת 60% תת-הסוגים היסטולוגיים המשותפים של סרקומה עצם בילדות 6, 7. OS בדרך כלל משפיעים על אזורי השלד, המאופיינים צמיחת עצם מהיר (למשל, metaphysis של עצמות ארוכות). בין תת-הסוגים שונים היסטולוגית של OS, מערכת הפעלה קונבנציונלית, המכונית גם מדולרי או OS המרכזי, יש ציון גבוה של ממאירות וכן sha מכסהמחדש של 80% 8. 80% זה מורכב של מערכת ההפעלה osteoblastic קונבנציונאלי 60%, 10% OS chondroblastic, ו -10% 6 fibroblastic OS, 8-10. תת OS אחרות כוללות אנפלסטית, telangiectatic, תא עשירי ענק OS תאים קטנים. למרות התקדמות בניתוחים בשילוב וכימותרפיה בניהול OS, התוצאה נשארת עניה, עם שיעור הישרדות לטווח ארוך של 65-70% בחולים ללא גרורות 11, 12. הישנויות רחוקות להתרחש בתדירות גבוהה ככל גרורות ריאתי או, לעתים רחוקות יותר, כמו גרורות לעצמות רחוקות חזרות מקומיות 13. גרורות הן בדרך כלל עמידות לטיפולים קונבנציונליים. התנגדות זו הסיבה מדוע ההישרדות של 10 שנים ללא מחלה הוא כ 30% בחולים עם מחלה גרורתית בעת האבחנה 14, 15.

כמו רקמות בריאות, רקמת הסרטן היא מורכבת מאוסף הטרוגנית של סוגי תאים. תאים בתוך הגידול נראים מתאימים בשלבים שונים של פיתוח. בתוך כל nרקמת ormal מתגורר subpopulation של תאים עם היכולת selfrenew, ובכך לספק אבות ותאי בוגרת הומאוסטזיס רקמות. באופן דומה, הסרטן מורכב אוכלוסייה הטרוגנית דומה של תאים בשלבים שונים של פיתוח, עם דרגות שונות של התפשטות פוטנציאל tumorigenic. לתת-קבוצה של תאים סרטניים אלה, המכונים תאי גזע סרטניים (CSCS), מהווה מאגר של selfsustaining תאים עם היכולת הבלעדית selfrenew ולשמור על פוטנציאל ממאיר של גידולים, ובכך יצירת שושלות תאים שונים המהווים את עיקר הגידול 16. בשנת 1990, מחקרים על לוקמיה מיאלואידית חריפה ספקו את הראיות המשכנעות הראשונות לקיומה של תת-אוכלוסיות CSC 17, 18. CSCS מאז בודד ממספר רב של גידולים מוצקים 19, ובכך הופך לאחד הנושאים הנחקרים ביותר בחקר הסרטן. CSCS שעלולות להתעורר אכן מתאי גזע נורמליים ידי מוטציות בגנים שהופכים את נורמליתתאי גזע 20-23 סרטניים. מוטציות ואינטראקציות הפיכה מרובות עם microenvironment יוכל לתרום גם אבות בריאים ותאים בוגרים רכישת הקיבולת וחיי הנצח selfrenewal מאפייני CSCS. ישנן מספר השערות לגבי השינוי הזה. אבות בריאים, תאי בוגרים בריאים, תאים סרטניים, יכולים dedifferentiate לתאי גזע, קבלת פנוטיפ הגבעולי על ידי הפעלת הגנים הקשורים selfrenewal 24-28. למרות מספר מחקרים חדשים, את מקורותיה של CSCS טרם גילו.

מאפיין מסוים של CSCS הוא כי יכל להתנגד גישת רב-טיפול, אשר מורכבת של ניתוח משולב וכימותרפיה עם תרופות שונות. מחקרים שנעשו לאחרונה הראו כי CSCS רשאי לרכוש עמידות ציטוטוקסיות תרופות כימותרפיות. הסברים אפשריים התנגדות זו כוללים את ביטוי יתר של קלטת ATP מחייב (ABC) טרנספורטר multidrug (כלומר,MDR1 ו BCRP1), ביטוי יתר של אנזימים חילוף חומרים כימותרפיה כגון dehydrogenase אלדהיד 1 (ALDH1), ו / או שינויים קינטיקה מחזור התא 30-33. התוצאה הישירה של כל המושגים האלה כי תוארו עד כה היא כי טיפול בסרטן יהיה יעיל רק אם תת-אוכלוסיית CSC בוטלו לחלוטין, בעוד הישנות מקומית או גרורות מרוחקות עשויה להתרחש אם אפילו יחיד CSC שרד.

התגלית של CSCS ב סרקומות אדם 34, במיוחד OS 35, או בכל עצם אחר וסוגי סרטן של הרקמות רכות, יש חשיבות קלינית רבה כי הוא מציע הסבר אפשרי מדוע טיפולים רבים נראים יעיל בתחילה, אך החולים מאוחר להרע. לכן, בתקווה לקרב בעתיד נגד OS המקובלת היא למצוא טיפולים ממוקדים חדשים וספציפיים מבוססים על הפיתוח של תרופות חדשניות מכוונות הודות OS-CSCS לאפיון המולקולרי של משנה זוהאוכלוסייה לחקר הביולוגיה CSC.

בשנת 1992, ריינולדס ועמיתיו, שהיו חוקרת האם משנה של תאי גזע נכח במוח של יונקים בוגרים, פיתחו שיטה לבודד תאים חשודים להיות תאים דמויי גזע 36, 37. שיטה זו מבוססת על יכולת מסוימת של תאים אלה ליצור מושבות כדוריות כאשר גדלו בתנאי nonadherent. טכניקות דומות הועסקו על ידי גיבס ועמיתיו בשנת 2005 ללמוד subpopulation של תאים דמויי גזע עצם סרקומות 38. כדי לבודד ולאפיין OS-CSCS מתרבויות תא ראשוניות של סוגים שונים של מערכת הפעלה קונבנציונלית, החלטנו להתאים את הטכניקה הזו עבור שורות תאי OS.

כאן אנו מתארים שיטה המותאמת זה של assay היווצרות כדור, כינה "assay sarcosphere", אשר ניתן להשתמש בהם כדי לבודד OS-CSCS מקווי תא ראשוני סופי נגזר ביופסיות האדם של OS קונבנציונאלי. כמו כן, אנו מתארים את כל הטכניקות used כדי לאמת את הפנוטיפ CSC דמוי גזע של שורות תאים מבודדים על ידי assay זה: 1) הערכת הביטוי של גנים המאפיינות תאי גזע עובריים פלוריפוטנטיים (ESCs) ושל הגן CD133, אשר מהווה סמן של CSCS; 2) יחידת מושבת יוצרים (CFU) assay; 3) הערכת היכולת של תאים אלה להתמיין אוסטאובלסטים ו adipocytes בתנאי בידול מתאימים; 4) מחקר של סמנים משטח של בתאי גזע mesenchymal (MSCs) (כלומר, CD44, CD105 ו Stro-1) על ידי מכתים immunofluorescence ועל ידי ניתוח תזרים cytometric; 5) והערכה של פעילות ALDH של תאים אלה.

Protocol

כל הניסויים תוך שימוש ברקמות אדם מתואר במסמך זה אושר על ידי ועדת האתיקה המקומית (הרי"ף. נ 141/12). הסכמה מדעת לאיסוף דגימות רקמות לשימוש ואחסון של הדגימות התקבלה התורמים ב AOUC.

1. הכנה לתרבות

  1. הכן בינוני תרבות צמיחה (GM) על ידי הוספת 10% בסרום שור עוברי (FBS), 100 IU / פניצילין מ"ל ו 100 מיקרוגרם / מ"ל ​​סטרפטומיצין עד בינוני F12 של חם שונה של קון. סנן לעקר GM באמצעות מסנן 0.22 מיקרומטר. חנות GM עד חודש 1 על 4 מעלות צלזיוס.
  2. הכן בינוני collagenase (CM) על ידי הוספת FBS 20%, 100 IU / פניצילין מ"ל, 100 מיקרוגרם / סטרפטומיצין מ"ל וסוג collagenase 3 מ"ג / מ"ל ​​השנייה עד בינוני F12 של חם שונה של קון. סנן לעקר CM באמצעות מסנן 0.22 מיקרומטר. חנות CM עד חודש 1 ב -20 ° C.
  3. הכן בינוני עבור תא הקפאה (FM) על ידי הוספת FBS 40%, 100 IU / פניצילין מ"ל, 100 מיקרוגרם / מ"ל ​​סטרפטומיצין ו -6.5% Dimethylsulfoxide (DMSO) עד בינוני F12 של החם השונה של קון. סנן לעקר FM באמצעות מסנן 0.22 מיקרומטר. חנות FM עד חודש 1 על 4 מעלות צלזיוס.
  4. הכן בינוני עבור assay CFU (CFUM) על ידי הוספת FBS 20%, 100 IU / פניצילין מ"ל ו 100 מיקרוגרם / מ"ל ​​סטרפטומיצין עד בינוני F12 של חם שונה של קון. סנן לעקר CFUM באמצעות מסנן 0.22 מיקרומטר. חנות CFUM עד חודש 1 על 4 מעלות צלזיוס.
  5. הכן טריפסין על ידי המסת 400 מ"ג טריפסין, 200 EDTA מ"ג ו -1,000 מ"ג D (+) - נטול הגלוקוז 1,000 מ"ל פוספט שנאגרו מלוחים של Dulbecco (DPBS) ללא Ca 2 + ו Mg 2+.
    הערה: מחלקים טריפסין-EDTA טרי לתוך 50 מ"ל aliquots ב 25 ס"מ 2 צלוחיות באמצעות 0.22 מיקרומטר מסנן ולהקפיא ב -20 ° C עד 3 חודשים. חנות מופשרת aliquots מעוקר מסננת ב 4 ° C ללא הפסד של פעילות.
  6. כן בינוני צמיחה של תאי גזע (SCGM) על ידי הוספת 10% FBS, 100 IU / ml פניצילין, 100 מיקרוגרם / מיליליטר streptomycin, ו -10 ng / ml bFGF (25 מיקרוגרם / ml מלאי) עד בינוני F12 של החם השונה של קון. סנן SCGM באמצעות מסנן ולאחסן 0.22 מיקרומטר SCGM עד 2 שבועות 4 ° C.
  7. כן 2% methylcellulose (MC) על ידי המסת MC ב ultrapure H 2 O ב 4 מעלות צלזיוס במשך 3 ד. כאשר MC הוא נמס לגמרי, חיטוי אותו ולאחסן על 4 מעלות צלזיוס.
    הערה: לאחר MC מעוקר, הוא הופך להיות מוצק. כדי להביא MC למדינה, נוזלי חנות ב 4 מעלות צלזיוס.
  8. כן בינוני הצמיחה sarcosphere (SGM). הכן טרי המדיום הזה (לא יותר מ -2 שבועות לפני השימוש) על ידי הוספת 100 IU / פניצילין מ"ל, 100 מיקרוגרם / מ"ל ​​האדם bFGF (25 מיקרוגרם / ml המלאי), 20 פרוגסטרון ננומטר (10 מיקרומטר המניות), 100 פוטרסין מיקרומטר, 30 ננומטר סלניט נתרן (30 מיקרומטר המניות), 25 מיקרוגרם / מ"ל ​​transferrin (25 מ"ג / ml המלאי), 20 מיקרוגרם / אינסולין מ"ל (20 מ"ג / ml המלאי), ו -10 ng / EGF האדם מ"ל (10 מיקרוגרם / ml המלאי) כדי 2X קון של שונה בינוני F12 של חם. סנן לעקר SGM באמצעות fil 0.22 מיקרומטרter. אחסן עד 2 שבועות 4 ° C.
  9. הכן בינוני osteogenic (OM) על ידי הוספת 10% FBS (ממוצא דרום אמריקאי), 100 IU / פניצילין מ"ל, 100 מיקרוגרם / מ"ל ​​סטרפטומיצין, 10 dexamethasone ננומטר (100 מיקרומטר המניות), L-ascorbyl-2-פוספט נתרן 0.2 מ"מ (1 M המניות), 10 מ"מ β-glycerophosphate (5 מ"ג / ml המלאי) ו 1 מיקרוגרם / מ"ל ​​calcein (200 מיקרוגרם / מ"ל ​​המניות) עד בינוני F12 של חם שונה של קון. סנן לעקר OM באמצעות מסנן 0.22 מיקרומטר. חנות ב 4 מעלות צלזיוס.
    הערה: פתרונות מניות dexamethasone חנות תחת חנקן נוזלי כדי לשמור את פעילותם. כן OM הטרי כל 2 שבועות כדי לשמור על הפעילות של dexamethasone על מנת לשמור על פוטנציאל ההתמיינות של המדיום.
  10. הכן חיץ תמוגה כדורית אדומה (ELB) על ידי המסת 1.66 מ"ג NH 4 Cl, 0.2 מ"ג K 2 HPO 4 ו -0.007 EDTA מ"ג ב 200 מ"ל מים מזוקקים (DH 2 O). סנן לעקר ELB באמצעות מסנן 0.22 מיקרומטר. חנות ב 4 °ג
  11. הכן בינוני adipogenic (AM) על ידי הוספת 10% FBS (ממוצא דרום אמריקה), 100 IU / פניצילין מ"ל, 100 מיקרוגרם / מ"ל ​​סטרפטומיצין, 1 מיקרומטר dexamethasone (1 מלאי מ"מ), 1 מיקרומטר אינסולין שור (10 מ"מ המניות), 0.5 מ"מ isobutylmethylxanthine (IBMX) (מלאה 500 מ"מ), ו -100 אינדומטצין מיקרומטר (200 מ"מ) עד בינוני F12 של החם השונה של קון. סנן לעקר AM באמצעות מסנן 0.22 מיקרומטר. חנות ב 4 מעלות צלזיוס.
    הערה: פתרונות מניות dexamethasone חנות תחת חנקן נוזלי כדי לשמור את פעילותם. כן AM הטרי כל 2 שבועות כדי לשמור על הפעילות של dexamethasone על מנת לשמור על פוטנציאל ההתמיינות של המדיום.
  12. הכן 2% שור סרום אלבומין (BSA) ב DPBS (BSA / DPBS). ממיסים 10 גרם BSA ב 500 מ"ל DPBS ולהכין את הפתרון המניות על ידי aliquotting פתרון 50 מ"ל המניה ב 50 מ"ל צינורות חרוטי. חנות ב -20 מעלות צלזיוס.
  13. כן פתרון של 4% paraformaldehyde (PFA) ב DPBS (PFA / DPBS). בעוד chמכסה מנוע emical, לדלל paraformaldehyde ב DPBS ולהכין את פתרון המניות על ידי aliquotting 50 מ"ל פתרון מניות ב 50 מ"ל צינורות חרוטים. חנות ב 4 מעלות צלזיוס.

2. הקמת תא תרבויות OS ראשי שורות תאים סופיות OS (OSA)

הערה: בתרביות תאי OS ראשי הוכנו מ דגימות טריות של ביופסיות OS קונבנציונליות שנאספו ב "Ricostruttiva דואר אוניטה Ortopedia Oncologica", AOUC Careggi, פירנצה. כל ביופסיות, אשר התקבלו על ידי השאיפה מחט או כריתה כירורגית של חלק קטן של הגידול (איור 1 א ', ב'), הונחו מיד במדיום תרבות בתוספת 100 IU / פניצילין מ"ל ו 100 מיקרוגרם / מ"ל סטרפטומיצין (pH 7.4) ו מועבר למעבדה שבה הם עובדו. כל המניפולציות תארו נערכו בתנאי aseptic באמצעות מכסה מנוע זרימה למינרית.

  1. בידוד של תאי OS
    1. מניחים את הביופסיה בביתצלחת פטרי 100 מ"מ עם נפח קטן של GM. עם אזמל סטרילי פינצטה פרי, לרכך את דגימות רקמת OS ידי חיתוכם לחתיכות קטנות ככל האפשר (0.5 - 1 מ"מ) (איור 2 א ', ב').
    2. מכסים את שברי הרקמה עם 10 מ"ל CM עבור עיכול אנזימטי (תרשים 2B) ו דגירה במשך 3 שעות 2 באינקובטור 37 מעלות צלזיוס, 5% CO. הוצא בעדינות את ההשעיה של שברים בעזרת פיפטה ולהעביר אותו צינור חרוטים 15 מיליליטר עבור צנטריפוגה מיידית (400 XG במשך 5 דקות) עד גלולת הקרעים.
      הערה: לאחר צנטריפוגה, האם הביופסיות עשירות אריתרוציטים, פיקדון אדום המורכב אריתרוציטים ניתן לראות מעל גבי הקרעים. לכן, לפני שתמשיך פיזור מכני, לטפל המדגם עם חיץ תמוגה כדורית אדומה. בטל supernatant על ידי שאיפה ולהוסיף 5 מ"ל ELB.
    3. להשעות שברים גלולה דקות 1 ו צנטריפוגות ההשעיה ב 400 XG במשך 2דקות. הסר את supernatant על ידי שאיפה. הוסף 5 מ"ל GM מכנית לפזר את שברי בעזרת פיפטה סרולוגיות 10 מ"ל (גודל הפתיחה, 1.5 מ"מ Ø פנימי) 10 - 20 פעמים.
    4. צנטריפוגה ההשעיה ב 400 XG במשך 5 דקות. הסר את supernatant על ידי שאיפה, להשעות את התא גלולה עם 10 מ"ל GM, ולאחר מכן להעביר את ההשעיה תא שנוצר לתוך צלחת פטרי 100 מ"מ. דגירה צלחת פטרי ב CO 2 באינקובטור 37 מעלות צלזיוס, 5% ולהחליף את GM עם GM שלם טרי כל 3 ד.
      הערה: לעתים קרובות, דגימות רקמת OS מתקבלות על ידי שאיפת מחט הם קטנים מאוד ומכילות שברי עצמות, אשר אינו מתעכלים על ידי עיכול אנזימטי עם collagenase. לכן, לאחר supernatant הוסר, לנסות להפריד תאים מרקמות עצם מוחצים שברי גלולה עם טפטפת.
  2. תת
    הערה:
    כדי להקים OSA, כאשר התאים מגיעים למפגש המשוער, להסיר אותם מן theiכלי r תרבות, לדלל, ומניחים בצלחת טריה כדי לאפשר צמיחה נוספת. הליך תת זו מושגת באמצעות ההליך האנזימטית כינה trypsinization.
    1. הסר בינוני על ידי שאיפה. כדי לנתק את monolayer תא, להוסיף 2 - 3 מ"ל טריפסין ב RT (מקסימום 18 - 20 מעלות צלזיוס), ללחוץ בעדינות פעם, ולהסיר את טריפסין מיד על ידי שאיפה. חזור פעמיים. דגירת התאים ב 37 מעלות צלזיוס במשך 3 - 4 דקות עד שהם מתחילים לנתק.
      הערה: trypsinization הטוב ניתן לראות על ידי המשתמש המנוסה כמו חורים קטנים להרכיב בשכבה אטומה מעט כאשר את המנה מוחזקת אל האור. ניתוק זה יכול להיות פיקוח גם באמצעות מיקרוסקופ הפוכה; גישה זו מומלצת למתחילים.
    2. עצור את התגובה טריפסין על ידי הוספת 10 מ"ל GM ולשטוף את צלחת היטב בעזרת פיפטה כדי לנתק את כל התאים. העברת 1 מ"ל של השעיה על צלחת פטרי 100 מ"מ חדשה ולהוסיף 9 מ"ל GM (1/10 פיצול של תאים).
      הערה:
  3. Cryopreservation של תרבויות עיקריות OS ו- OSA
    הערה: להקפיא ומחוברות אחד 100 מ"מ צלחת פטרי לתוך 4-5 cryovials. תהליך cryopreservation חייב להתבצע במהירות בגלל DMSO, המגנה קרום התא במהלך ההקפאה, הוא רעיל לתאים בטמפרטורות בלתי מוקפאים.
    1. לנתק בתרביות תאים מן בשכבה ידי trypsinization (ראה סעיף 2.2), תאים גלולה על ידי צנטריפוגה ב 400 XG במשך 5 דקות, להסיר את supernatant על ידי שאיפה, ולאחר מכן במהירות להשעות את התא גלולה ב FM.
    2. Aliquot 1 מ"ל של השעיה זו לכל בקבוקון קריוגני. מיד למקם את צלוחיות ממולאות בקופסה במקפיא עם ז'קט של 2-propanol ו immedia החנותtely ב -80 ° CO / N. העברת cryovials לחנקן נוזלי למחרת עבור אחסון לטווח ארוך.
  4. פשרת OS שורות תאים ותרבויות עיקריות
    1. הפשרה OS שורות תאים אחסון חנקן נוזלי, cryovials ההפשרה במהירות על ידי הצבת אותם באמבט מים במעבדה על 37 מעלות צלזיוס. מעבירים את תכולת של cryovials לתוך צינור חרוטי 15 מ"ל ולהוסיף כ 10 מ"ל של GM (ראה סעיף 2.3 להסיר DMSO). הסר את supernatant על ידי שאיפה להשעות את התא גלולה ב 10 מ"ל GM. פלייט את ההשעיה תא בצלחת פטרי 100 מ"מ ו דגירה באינקובטור 37 מעלות צלזיוס, 5% CO 2.

3. Sarcosphere Assay לבודד OS-CSCS

הערה: ניסוי זה מתבצע על OSA. משך הניסוי הזה הוא נוגע לקיבולת של התאים ליצור מושבות כדור אלה (sarcospheres), ואת טווח הזמן הוא 7, 14, 21, ו -28 ד.

  1. establishment של assay sarcosphere
    1. להכין את חדר haemocytometer וכל ריאגנטים מראש.
    2. הסר בינוני על ידי שאיפה ו לנתק את התאים מן בשכבה ידי trypsinization (ראה סעיף 2.2). מערבבים את ההשעיה תא ביסודיות, pipetting לפזר כל גושים, ולאסוף 10 μL באמצעות קצה פיפטה 20 μL.
    3. מעביר את השעית תא 10 μL מייד לקצה תא haemocytometer, לגרש את ההשעיה, ולאפשר לו להיגרר תחת coverslip ידי פעולת נימים.
    4. שים את תא haemocytometer תחת בניגוד שלב. בחר מטרת 10X ולהתמקד קווי רשת בתא. ספירת התאים שוכבים זה אזור 1 מ"מ 2 באמצעות יחידות המשנה (חל עליהם שלושה קווים מקבילים) וקווי רשת אחת כעזר לספירה.
    5. למדוד את ריכוז ולהחיל את המשוואה הבאה: 1 מ"ל = n * 10 4 / z (n: מספר שלם של תאים בכל נספרריבועים 1 מ"מ 2; z: מספר ריבועים נספרו 1 מ"מ 2). חשבתי את הנפח של השעית תא צורך צלחת בסכום כולל של 240,000 תאים מחולקים 40,000 תאים עבור כל טוב בצלחת המצורפת 6-גם הנמוכה במיוחד.
      הערה: הקפד צולח את המספר הנכון של תאים על ידי תאי ציפוי לתוך היטב אחד נוסף. לפיכך, הסכום הכולל של תאים להיות מצופה הוא 280,000 תאים.
    6. הכן 35 מ"ל SGM ידי הוספת 50% של 2% MC (SGM-MC) בבקבוק 2 25 ס"מ. הכן את הנפח הכולל של SGM בהתחשב 5 מ"ל נוסף כדי צלחת אחת גם תוספת.
    7. מוסיפים את נפח מחושב של ההשעיה תא אל מוכן SGM-MC בבקבוק ומערבבים בעזרת פיפטה בעדינות כדי לפזר כל גושים. פלייט תאי צלחת מצורפת 6-גם אולטרה נמוך ולהשתמש מיקרוסקופ הפוכה כדי להבחין כיצד התאים להופיע לאחר מצופה.
    8. דגירת התאים CO 2 באינקובטור 37 מעלות צלזיוס, 5%. כל 3 ד, להוסיף fraliquots אש של bFGF ו EGF היטב כל לרענן את הריכוז של גורמי גדילה. הוסף 2 μL bFGF ו -5 μL EGF לשמור הן בריכוז סופי של 10 ng / ml בכל טוב.
  2. בידוד של sarcospheres
    הערה: המעקב אחר ההתקדמות הטובה של assay sarcosphere ב -7, 14, 21, ו -28 ד להחליט מתי יש צורך לבודד את sarcospheres שיצר.
    1. הכן את כל החומרים כימיים וציוד בשכונת הזרימה למינרית (איור 3 א ', ב'). להרכיב את יחידת סינון על ידי הצבת מסנן נטו של בקוטר 25 מ"מ ו רשת 40 מיקרומטר לתוך בעל מסנן הממברנה; לעקר ידי מעוקר (איור 4 א-ה).
    2. עבור כל טוב, להעביר המדיום המכיל את sarcospheres מזרק עם בעל מסנן קרום סטריליים בעזרת פיפטה סטרילית עם קצה 1,000 μL. לאחר ההסרה הבינונית לחלוטין המכיל את sarcospheres, לשטוף היטב על ידי הוספהing 5 מ"ל GM להיות בטוח להעביר את כל הכדורים אל מזרק. השתמש במיקרוסקופ כדי לאשר אם כל sarcospheres כבר התאושש. אם לא, להמשיך על ידי חזרה על שלב זה.
    3. סנן את ההשעיה עם בעל מסנן הממברנה רק על ידי כוח הכבידה ללא לחץ על מנת למנוע פגיעה הספירות להימנע sarcospheres שיש לחצות דרך הפילטר, ובכך למנוע אובדן של תחומים. הסר בועות אוויר באמצעות בעדינות פיפטה פסטר זכוכית סטרילית.
      הערה: לפעמים הסינון חסום על ידי הנוכחות של בועת אוויר בעל מסנן הממברנה.
    4. שטפו את יחידת סינון על ידי הוספת 10 מ"ל GM כדי המזרק לתת לה לסנן בלי הלחץ להיות בטוח לחסל תאים בודדים. לפרק את יחידת המסנן מן המזרק ולשים אותו לתוך צלחת פטרי.
    5. הסר את מסנן נטו מבעל מסנן הממברנה באמצעות פינצטה פרי ולשטוף אותו על ידי ניעור אותו בעדינות עם פינצטה בתוך 60 מ"מצלחת פטרי כדי לשחרר את sarcospheres מהפקעת של הממברנה. ואז, במקום הקרום בבאר ולאשר באמצעות תצפית מיקרוסקופית שאין ספירות יותר סבוכות בקרום. אם תחומים עדיין סבוכים בקרום, להמשיך לשטוף אחר כמתואר בשלב 3.2.4.
    6. שימו לב sarcospheres שוחרר באמצעות מיקרוסקופ. דגירה sarcospheres שוחרר באינקובטור 37 מעלות צלזיוס, 5% CO 2. חזרה על כל השלבים של כל גם צלחת מצורפת 6-גם נמוכה במיוחד.

4. קווי OS-CSC

הערה: מערכת ההפעלה CSCS מתקבלת sarcospheres כי תערוכת הרחבת חסיד ידי reintroducing ו reculturing תאים אלה בשכבה אחרי שהם מצופים קטנים 60 מ"מ פטרי מנות כבר לא בתנאים מצורפים אולטרה-נמוכים.

  1. תרבויות OS-CSC
    1. כדי לאפשר צמיחה נוספת, תאים תת כשהם מגיעים כ מפגש 90% בתוך 60צלחת פטרי מ"מ. חזור על שלב 2.2.1 להקים תרבויות OS-CSC.
    2. עצור trypsinization ידי הוספת 4 מ"ל SCGM ולשטוף את צלחת היטב, בעזרת פיפטה כדי לנתק את כל התאים. מעבירים את ההשעיה תא אל צלחת פטרי 100 מ"מ חדשה ולהוסיף 6 מ"ל SCGM. כאשר-CSCS OS להגיע ל -90% המפגש, תת-ידי חזרה בסעיף 2.2.
      הערה: לקבלת ניתוח במבחנה לאפיין את תאי גזע דמוי הפנוטיפ של מבודדי OS-CSCS, תאים יכולים להיות מצופים בסוגים שונים של צלחות.
    3. לשמר את קווי OS-CSC שהקים cryopreservation (חזור על כל השלבים של סעיף 2.3). הפשירו OS-CSCS cryopreserved ידי חזרה את כל השלבים של סעיף 2.4.

5. במבחנה nalysis לאפיון OS-CSCS:

  1. הכנת תאים עבור immunofluorescence
    הערה: תאים מתוקנים paraformaldehyde כשהם מגיעים כיתת זכות מפגש בכל טוב של PLA 24 גםטה. הציון של מפגש קשור לסוג של ניסויים.
    1. OS-CSCS פלייט צלחת 24 גם ללמוד את בתאי גזע mesenchymal משטח (MSC) סמנים על ידי immunofluorescence. תקן תאים בכל טוב כאשר הם מגיעים 50 - 60% מפגש. הסר את SCGM ידי שאיפה ולשטוף פעמיים בצלחת 24 גם DPBS.
    2. מתחת למכסה המנוע כימי, להוסיף 500 μL 4% PFA / DPBS היטב כל אחד. לדגור על RT במשך 10 דקות. הסר את PFA / DPBS לשטוף 3x עם DH ultrapure 2 O. אפשר צלחת 24 גם להתייבש במנדף.
  2. Immunofluorescence עבור סמנים MSC
    הערה: מכתים Immunofluorescence של OS-CSCS קבוע 4% PFA / DPBS יכול לשמש כדי לחקור את הפנוטיפ MSC דמוי של OS-CSCS באמצעות נוגדנים המכוונים נגד CD44, Stro-1 ו CD105. השיטה הבאה משמשת באופן שגרתי על ידי המחברים.
    1. במנדף כימי, permeabilize תאים תוקנו 4% PFA / DPBS על ידי הוספת 500 μL 0.2% Triton X-100 / DPBS היטב כל אחד. דגירת התאים ב 37 מעלות צלזיוס למשך 30 דקות. לשטוף בעדינות את התאים 3x עם DPBS. הוספת 300 μL RNase בדילול 1 / 1,000 עם 2% BSA / DPBS אל התאים לדגור על 37 מעלות צלזיוס למשך 30 דקות.
    2. לשטוף בעדינות את התאים 3x עם 2% BSA / DPBS. כתם התאים עבור סמני MSC. מוסיף את הנוגדן הראשוני רק על הבארות נבחרו שולטים חיובי עבור כל נוגדן.
      1. הוספת 300 μL אנטי-CD105 בדילול 1/10 עם 2% BSA / DPBS, 300 μL נגד CD44 בדילול 1/10 עם 2% BSA / DPBS, 300 μL אנטי-Stro-1 בדילול 1/10 עם 2% BSA / DPBS ורק 200 μL 2% BSA / DPBS אל הבארות נבחרו שולטים שלילי עבור כל נוגדן.
      2. דגירה התאים בסביבה לחה ב 4 ° CO / N. שטפו את בארות 3x עם DPBS ואז פעמיים עם 2% BSA / DPBS.
    3. לחשוף נוגדנים ראשוניים על ידי הוספת נוגדנים משני ספציפיים.
      1. הוספת 300 μL IgG נגד ארנב (חמור ארנבת אנטי IgG [H + L]) מדולל 1/100עם 2% BSA / DPBS לתוך כל נבחר גם שליטה חיובית ושלילית עבור CD44 ו CD105. הוספת 300 μL FITC אנטי עכבר IG (FITC ארנב אנטי העכבר IgG [H + L]) מדולל 1/100 עם 2% BSA / DPBS לתוך כל נבחר גם שליטה חיובית ושלילית עבור Stro-1. דגירת תאים בחושך ב RT במשך 60 דקות. שטפו את בארות 6x עם DPBS.
    4. הכתם MSC סמן חיובי תאים עבור אקטין cytoskeletal על ידי הוספת 300 μL phalloidin בדילול 1/100 עם 2% BSA / DPBS לתוך כל מוכתם גם עבור immunofluorescence סמן MSC.
    5. דגירת התאים למשך 40 דקות ב RT. שטפו את בארות 3x עם DPBS ולאחר מכן לשטוף אותם פעמיים עם DH ultrapure 2 O. המשך אל counterstaining של הגרעינים לאחר מכתים immunofluorescence שתואר לעיל. הכן פתרון יודיד propidium 10 -5 M ב DPBS (המניה 1.5 x 10 -3 M) במנדף.
      1. הוספת 200 פתרון propidium יודיד μL לכל צבעוניים היטב כפי שתואר לעיל. דגירת התאים עבור 2 - 3 דקות ב RT. לשטוף את הבארות פעמיים עם DH ultrapure 2 O.
        הערה: חזור על כל השלבים של בסעיפים 5.1 - 5.2 ביום הקו הסלולרי HCT8, שורת תאי סרטן המעי גס בדיל רציפה עיקרית המשמשת כביקורת שלילית.
  3. Assay בידול osteogenic
    הערה:
    בידול osteogenic נמשך 20 ד.
    1. פלייט OS-CSCS ב 24 גם צלחות בצפיפות תא של 1 x 10 4 תאים / ס"מ 2 ב SCCGM. אפשר התאים לגדול SCGM עד שהם מגיעים 80 - 90% confluency בכל טוב.
    2. התחל בידול osteogenic ידי שינוי SCGM כדי OM. אפשר התאים לגדול OM ולרענן בינוני כל 3 - ד 4. עצור את assay בידול osteogenic ב 10 ד כדי להעריך את הנוכחות של phosphatase אלקליין (ALP).
    3. תקן תאים ב 4% PFA / DPBS (ראה סעיף 5.1). להעריך את הפנוטיפ osteoblastic ידי מכתים cytochemical עבור ALP ועבור HAבאמצעות מכתים האדום S Alizarin.
    4. מכתים ALP cytochemical
      הערה: מכינים את תערובת צבע במנדף כימי מיד לפני תחילת מכתים.
      1. ממיסים 40 מ"ג מהיר כחול BB או מלח ויולט LB האדום מהירה ב 50 מ"ל טריס-HCl, pH 9 (פתרון א). ממיסים מלח נתרן פוספט 5 מ"ג naphthol-AS-MX ב 1 מ"ל DMSO (B פתרון). הוספת פתרון B לגמרי פתרון A ו- ומערבבים היטב, קבלת תאים פתרון ג שטפו פעמיים עם DPBS.
      2. הוספת 500 μL - 1 מ"ל פתרון C זה טוב לדגור על 37 מעלות צלזיוס, 5% CO 2. לבחון את המהלך מכתים כל 10 דקות על ידי התבוננות בתאים תחת מיקרוסקופ.
      3. עצור את המכתים כאשר תאים החיוביים ALP הופכים צבועים בצבעים עזים (כחול עם מלח BB הכחול המהיר או אדום עם מלח LB ויולט האדום מהיר), אשר מתרחש בדרך כלל תוך 30 דקות. לשטוף את התאים 3x עם DH ultrapure 2 O להסיר את כל השאריות של פתרון ג אם משקע של i כתםזה נוכחי, לשטוף את התאים במהירות ברגע עם אתנול אבסולוטי.
      4. המשך אל counterstaining של גרעינים לאחר מכתים ALP כמתואר צעדים 5.2.5 ו 5.2.5.1.
    5. Alizarin האדום S מכתים cytochemical
      הערה: מכינים את תערובת לצבוע לפני תחילת הניסוי.
      1. הכן את S האדום 2% Alizarin (2 גרם Alizarin האדום S ב 100 מ"ל של ultrapure H 2 O). להוסיף 2.5% NH 3 ל -2% Alizarin האדום S לעמוד על 6.0 pH. חנות 2% Alizarin פתרון האדום S על 4 מעלות צלזיוס. שוטפים את התאים פעם עם DPBS.
      2. להוסיף Alizarin האדום S לתאי רק לכמה שניות.
      3. לשטוף את הבארות עם DH ultrapure 2 O לשלוט על מידת מכתים; אם פיקדונות HA אינם צבועים בצבעים עזים, חזור על שלב 5.3.5.2. עצור את המכתים כאשר פיקדונות HA להיות מאוד בצבע אדום, אשר מתרחש בדרך כלל תוך מספר דקות. לשטוף את הבארות עם DH ultrapure 2 O.
    6. בידול Adipogenic
      הערה: משך Assay תלוי בקווי OS-CSC. Assay יכול להימשך 14 - 30 ד.
      1. פלייט OS-CSCS ב 24 גם צלחות בצפיפות תא של 1 x 10 4 תאים / ס"מ 2 ב SCGM. אפשר התאים לגדול SCGM עד שהם מגיעים 80 - 90% confluency בכל טוב. ליזום בידול adipogenic ידי שינוי SCGM לעם. אפשר התאים לגדול AM ולרענן את AM פעמיים בשבוע.
      2. עצור את assay בידול adipogenic כאשר שלפוחית ​​שומנים גלויה. להעריך את הפנוטיפ adipogenic ידי מכתים שמן האדום O ועל ידי haematoxylin counterstaining עבור גרעינים.
      3. Haematoxylin counterstaining עבור גרעינים
        הערה: מכינים את תערובת לצבוע לפני תחילת הניסוי.
        1. הכן את הפתרון 5% haematoxylin, שנקרא Emallume Carazzi 39. אחסן את הפתרון על 4 מעלות צלזיוס. להוסיף Emallume Carazzi רק 2 דקות. לשטוף בארות עם ultrapure DH 2 O.
    7. assay CFU
      הערה: ניסוי זה חייב להתבצע triplicates.
      1. פלייט OS-CSCS ב 100 מ"מ צלחות פטרי בצפיפות תא של 450 תאים / ס"מ 2 ב CFUM. דגירת תאי CO 2 באינקובטור 37 מעלות צלזיוס, 5% למשך 4 שבועות. רענן CFUM פעמיים בשבוע.
      2. הכתם CFUs עם toluidine כחול. ספירת מושבות בצבע באמצעות מיקרוסקופ הפוכה. חישוב יעיל CFU פי הנוסחא הבאה: (מספר מושבות נוצרו / מספר התאים זורע) * 100.
    8. ניתוח פעילות ALDH
      הערה: ALDH הפעילות נבדקו באמצעות ערכת Assay ALDH פעילות מדד-צבע על שני הקווים OS-CSC ועל קו פיברובלסטים סופי, אשר שימש כביקורת שלילית. ערכה זו מכמת את הפעילות האנזימטית ALDH ידי ספיגת קריאה ב -450 nm. כל הבדיקות בוצעו ב triplicates.
      1. לנתק בתרביות תאים מן בשכבה ידי trypsinization (ראה סעיף 2.2). גלולת תאים על ידי צנטריפוגה ב 400 XG במשך 5 דקות. עקוב פרוטוקול של היצרן.
    9. ניתוח תזרים cytometric:
      הערה: מתלי תא יחידים נדרשים עבור מכתים אופטימלי של דגימות עבור cytometry זרימה. השעית תא בודדת חייבת להיות מוכנה לכל נוגדן להיבדק. לנתק בתרביות תאים מן בשכבה ידי trypsinization (ראה סעיף 2.2).
      1. מניח את השעית תא צינור חרוטים, לבצע ספירת תאים באמצעות "שודד גופות ספירה קאמרית, תאי צנטריפוגות ב 400 XG ו resuspend נפח מתאים של חיץ הפרדה לקבל השעית תא בריכוז תא סופי של 1 x 10 5 תאים / מ"ל.
      2. צנטריפוגה השעית התא במשך 5 דקות ב 4 ° C. בטל supernatant לשטוף את הכדור עם חיץ ההפרדה. חזור על פעולה זו פעמיים.
      3. תאים כתמים עבור MSC סמנים (כלומר, CD44, CD105 ו Stro-1) 40.
      4. לנתח השעיות תא מוכתמות חיובי בתוך cytometer זרימה. ניתוח הדגימות המסומנות בתוך 1 ד. דגירה דגימות אלה ב 4 ° C עד הניתוח.
    10. RT-PCR
      1. הפקה ובידוד של RNA
        1. הוסף מגיב תמוגה 1 מ"ל על דגימות הסלולר קפוא ארוז של OS-CSCS ו lyse התאים ישירות בצינור ידי pipetting גלולה מעלה ומטה מספר פעמים.
        2. צנטריפוגה דגימות XG ב 12,000 במשך 1 דקות ב 4 °. בעדינות להסיר את supernatant. מעבירים את supernatant לצינור חדש, להוסיף 200 μL כלורופורם, מכסה את הצינור בצורה מאובטחת. לנער את הצינור בחוזקה במשך 15 שניות ו דגירה המדגם עבור 5 דקות ב RT.
        3. צנטריפוגה דגימות XG ב 12,000 במשך 15 דקות ב 4 °. התערובת מפרידה לשלושה שלבים שונים. רנ"א הוא בלעדי בשלב מהימי העליון חסר הצבע.
        4. להיות particularly זהיר, להסיר את השלב מהימי רק ולהעביר את השלב הזה לתוך צינור חדש כדי להמשיך עם בידוד RNA. הוספת 500 μL isopropanol אל הצינור המכיל את השלב מימית. לנער את הצינור בעדינות ביד. דגירת המדגם ב RT במשך 10 דקות. צנטריפוגה מדגם XG ב 12,000 במשך 10 דקות ב 4 °.
          הערה: אחרי המדגם הוא centrifuged, אפשר לראות את RNA, המהווה גלולה דמוי ג'ל בצד על החלק התחתון של הצינור.
        5. הסר את supernatant מהצינור, נזהר לצאת גלולה של RNA על הקרקעית. הוסף 1 מ"ל 75% אתנול אל הצינור. וורטקס הצינור ביד במשך כמה שניות ואז צנטריפוגות צינור XG ב 7500 למשך 5 דקות ב 4 ° C..
        6. מחק את אתנול אוויר יבש גלולת RNA. כאשר הגלולה יבשה, resuspend גלול RNA במי RNase ללא (10 - 50 μL) על ידי pipetting הפתרון מעלה ומטה מספר פעמים.
        7. קבע את התשואה והטוהר של RNA על ידי MEAsuring את הספיגה ב 260 ננומטר ו -280 ננומטר באמצעות ספקטרופוטומטר. להעריך את היושרה של רנ"א הכל על ג'ל agarose 1% סטנדרטי. אחסן את RNA ב -80 ° C.
      2. תגובת שרשרת פולימראז הפוך
        1. לסנתז cDNAs הגדיל הראשון מ -500 דגימות ng RNA באמצעות ערכת שעתוק לאחור. דגימות רנ"א להפשיר על הקרח להפשיר את הפתרונות הדרושים כלול בערכה ב RT. המשך לסנתז cDNAs הבא הפרוטוקול של היצרן.
      3. וכמותיות תגובת שרשרת transcriptase-פולימראז הפוך (RT-PCR)
        1. בצע את כל PCRs באמצעות 1 μL cDNA עבור כל דגימה כתבנית בנפח התגובה האחרון של 24 μL. השתמש רצפים פריימר המפורטים בטבלה 1 עבור הגברה של Nanog, 3/4 אוקטובר גנים Sox2 ו CD133.
        2. הפרד את מוצרי RT-PCR על ידי ג'ל אלקטרופורזה 1.8% agarose ואת הכתם עם ברומיד ethidium. צילום תחת UV תאורה פנימיתination.

Representative Results

דגימות OS מתקבלות על ידי שאיפת מחט או כריתה כירורגית של חלק קטן של הגידול (איור 1 א ', ב') לאפשר את הבידוד של אחד OSA רק כאשר הם טופלו בדיוק, כפי שתוארו בסעיף Protocol (איור 2 א ', ב'). למרבה הצער, מספר התאים המבודדים מן הביופסיות הוא נמוך, עם מגוון פלט 30 - 50%. התפוקה תלויה בסוג וממד הביופסיות (איור 5 א ', ב'). תאים אלה חייבים להיות מטופלים בדיוק. כתוצאה מכך, כחודש הוא הכרחי עבור התרבויות העיקריות להגיע confluency בצלחת פטרי 100 מ"מימ. לאחר פרק זמן זה, OSA מתקבלים שני מדגמים OS מסומן OSA5 ו OSA6 (איור 6 א, ב). לאחר מכן, יש צורך תת הקו הסלולרי העיקרי להשיג מספר מספיק של תאים כדי לבצע את הניתוח אפיון כדי cryopreserve התא ליןes. במעבר 3 rd של תת-תרבות, כאשר הן שורות התאים ראשוניים OSA להגיע confluency, הם מצופים 6-גם צלחות מצורפות אולטרה-נמוכות עבור assay sarcosphere. סוג של צלחת זה משמש כי היא מאפשרת לנו לשמור על תאים במצב מושעה, כדי למנוע את תאי גזע בידול מצורף בתיווך, כדי למנוע את התאים תלויים למעגן מחלוקת, ולבסוף, כדי להפחית מצורף המצע. לפיכך, השימוש בהם מאפשר לנו ליצור מצב מלחיץ עבור תאים סרטניים, אשר הכרחי בבחירת CSCS. בגיל 24 שעות לאחר תחילת assay, תאים להופיע מבודדות זו מזו (איור 7). לאחר 7 ד של ניטור ההתקדמות של assay, מושבות כדוריות זעירות החלו להיוצר גלוי (איור 8). בגיל 28 ד, מספר מושבות כדוריות גדולות כי נוצרו בכל טוב ניתן לצפות (איור 9 א ', ב'). לאחר sarcospheres havדואר שמעובד עבור 28 ד, מושבות כדורי הגדולות האלה יכולים להיות מבודדות. איור 10 מציג את השלבים לבידוד sarcospheres מ 6-גם צלחות מצורפות אולטרה-נמוכות reculturing אותם בתנאים חסידים. איור 11 מציג המושבות הכדוריות צפו לאחר בידוד. המושבות הכדוריות הגדולות מצופה בלוחות מצורפים נורמלים להראות רחבה חסידה לאחר הבידוד (איור 12 א ', ב'). תאי מרחיבים מן sarcospheres היחיד הם כנראה תאים סרטניים עם פנוטיפ דמוי תא גזע. לפיכך, לאחר בידוד, OS-CSCS כנראה התקבלו. תאים אלה נקראים OSA5-CSCS ו OSA6-CSCS (איור 13 א ', ב').

בשלב זה, יש צורך להמשיך עם האפיון של הפנוטיפ דמוי תא הגזע עבור שני קווי OS-CSC שהושגו, כפי שתואר לעיל. הניתוחים לאפיון של תאי גזע דמויי wer פנוטיפדואר ביצע על מעבר 4 th של תת לאחר sarcospheres עבור כל קו OS-CSC בודדו. שתי שורות התאים, OSA5-CSCS ו OSA6-CSCS, הראו חיוביות חזקות עבור סמני MSC המשטח (CD105 ו CD44) (איור 14 א ', ב' ו איור 15 א ', ב'), בשעה שהם הראו חיוביות מתונות עבור סמן MSC המשטח Stro- 1 (איור 16 א ', ב'). התצפיות שלנו אושרו על ידי תוצאות שליליות שהושגו עם שורת תאי סרטן המעי הגס המסחרית בדיל HCT8 (14 ג איור, איור 15C, 16C איור). היעדר מוחלט של מכתים ספציפי ולא ספציפי עבור סמני משטח אלה הקו הסלולרי HCT8 נצפה.

כדי להעריך את הפנוטיפ MSC של שני OS-CSCS, גם אנחנו תזרים cytometric ביצע ניתוחים. שני הקווים OS-CSC הביעו רמות גבוהות של CD44 ו CD105. עם זאת, התאים בשתי שורות תאים, רק 1.14% הביעו Stro-1. לכן, זה מחדשsult אישר את נוכחותו מתונה של Stro-1 כפי שעולה מכתים immunofluorescence. לעומת זאת, 99.62% של OSA5-CSCS הביע CD44 ו 87.38% של תאים אלה הביעו CD105; 99.88% של OSA6-CSCS הביע CD44 פנימה 95.79% של תאים אלה הביעו CD105. בנוסף, שורות התאים הן CD45-.

החוקרים העריכו את הביטוי של 3 סמנים ESC (Nanog, 3/4 אוקטובר Sox2) ושל הגן CD133, עוד סמן CSCS, על ידי RT-PCR. שמנו לב שכל הגנים הללו באו לידי ביטוי בשתי שורות OS-CSC (איור 17). מבחני בידול adipogenic ו osteogenic הראה את היכולת של שני קווי OSA-CSC מבודד להתמיין אוסטאובלסטים (18A איור - D ואיור 19 א - ד) ולתוך adipocytes (איור 20A - D).

יתר על כן, CFU ssay (איור 21) הראו שיעור טוב של יעילות clonogenic, עם 13% עבור OSA5-CSCS ו -14% עבור OSA6-CSC. כמה מחקרים שנערכו לאחרונה הראו כי רמות גבוהות של פעילות ALDH אופייניים של סוגים שונים של סרטן. פרמטר זה יכול לשמש כסמן תאי גזע סרטני מתואם עם פרוגנוזה גרועה. את assay פעילות ALDH הראו כי הן קווי OS-CSC יש רמות גבוהות של פעילות ALDH (איור 22), ואילו פעילות ALDH נצפתה בגבול לכימות נמוך בקו פיברובלסטים ששימשה כביקורת שלילית assay זה.

איור 1
באיור 1. דוגמאות של דגימות ביופסיה OS. (א). דגימת ביופסיה מתקבלת על ידי שאיפת מחט. (B). דגימת ביופסיה מתקבלת על ידי כריתה כירורגית של חלק של הגידול.884 / 53884fig1large.jpg "target =" _ blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. מכני חלוקה של מדגם OS. (א) פיצול של מדגם באמצעות פינצטה פרי, ניתוח. (ב) שברי המרחפים CM (מסומן בחץ). נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
ציוד איור 3. מתכלים הדרושים כדי לבודד Sarcospheres. (א). כל הציוד הדרוש בידוד תא. 1. מזרק סטרילי עם בעל מסנן קרום סטריליים; 2. שני סוגי מדיה שונים: א GMnd SCGM; 3. פיפטה פסטר זכוכית סטרילית. (ב) פרט של המזרק התאסף על תמיכה, עם בעל מסנן הממברנה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4. יחידת סינון. מספר מרכיבים הדרושים כדי להרכיב את יחידת הסינון (א) (מסנן נטו מצוין על ידי החץ). תצפית בניגוד שלב של 40 מיקרומטר משתלב (רשת אחד המצוין על ידי החץ) של המסנן נטו (B). הגדלה מקורית: 10X. יחידת הסינון התאסף (C - D). יחידת סינון מעוקרת (E). אנא לחץ כאן כדי להציג גדול version של נתון זה.

איור 5
איור 5. תא תרבויות הראשוני של מערכת הפעלה קונבנציונלית. תצפית בניגוד שלב של תרביות תאים ראשוניות של OS ציון הגבוהה. ב (א), כמה שברי עצמות בהירים גלויים, ואילו (ב), מספר אריתרוציטים מעוגלים קטנים צפו נוכחים. הגדלה מקורית: 10X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 6
איור 6. קונבנציונלי אוסטאוסרקומה סופיים שורות תאים (OSA). (א) OSA5 ו- (ב) OSA6. תצפית בניגוד שלב.הגדלה מקורית: 10X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 7
איור 7. Sarcosphere Assay של OSA5 ו OSA6. לאחר 24 שעות ממועד תחילת assay, התאים היו צפים ומבודדים זה מזה (תאים מסומנים על ידי חצים). תצפית בניגוד שלב. הגדלה מקורית:. 20X אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

הספרה 8
איור 8. Sarcosphere Assay של OSA5 ו OSA6 ב -7 ד 7 ד לתוך assay, מספר קטן sphericaמושבות l מוקפות תאים בודדים יכולות להיבחן. Sarcospheres (חלק sarcospheres אלה מסומנים על ידי חצים) מופיע צף בטווח הבינוני או מתיישב מעט למטה לתוך החלק התחתון של הבאר. תצפית בניגוד שלב. הגדלה מקורית: 20X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 9
איור 9. Sarcosphere Assay של OSA5 ו OSA6 ב 28 ד לאחר 28 ד, כמה sarcospheres ענבר גדול הם נצפו בכל טוב של הצלחות עבור כל קו התא OSA, OSA5 (א) ו OSA6 (B). גודל בר: 100 מיקרומטר. לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. </ P>

איור 10
מעברי איור 10. עבור הבידוד של Sarcospheres שלבי sarcospheres לבודד מן 6-גם צלחות מצורפות אולטרה-נמוכות reculturing שלהם בתנאים חסידים מוצגים (א) כל הציוד הדרוש עבור הבידוד..: 1. אחד 6-גם צלחת נמוכה במיוחד עם sarcospheres נוצר בכל טוב, מזרק 2. עם בעל מסנן נטו, 3. פיפטה, 4. 1,000 μL טיפים סטרילי, 5. 2 פינצטה פרי סטרילי, 6. 2 תקשורת תרבות אחרת , 7. פיפטה פסטר סטרילית צלחות פטרי 8.. (ב) גביית sarcospheres. המדיום הכלול בכל טוב נאסף בעזרת פיפטה עם טיפ μL 1,000 סטרילי. (ג) איסוף ההשעיה בתוך המזרק. ההשעיה שנאספה מועברת המזרק כדי להתחיל את תהליך הסינון הטבעי באמצעותבעל מסנן הממברנה. (ד) סינון טבעי. (ה) פירוק בעל מסנן קרום מן המזרק. אחרי הכל ההשעיה מסוננת, בעל מסנן נטו מפורק ולשים בצלחת פטרי; (F) פירוק בעל מסנן הממברנה. Sarcospheres מוכלים בתוך הנקבוביות של המסנן הנקי בעל מסנן נטו, ולכן הם חייבים להיות משוחררים באמצעות פינצטה פרי. (G, H) הסרת sarcospheres ממסנן הממברנה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 11
בידוד איור 11. Sarcosphere. Sarcospheres מבודד לצוף במדיום בצלחת פטרי 60 מ"מ. תצפית ב-בניגוד שלב.הגדלה מקורית: 40X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 12
איור 12. Sarcosphere לאחר בידוד. Sarcospheres מ OSA5 (א) ו OSA6 (B) שורות תאים בתחילת רחבה החסידה הבאים השבה ו reculturing בשכבה בתנאים חסידים ב 48 שעות לאחר בידוד. תצפית ב-בניגוד שלב. הגדלה מקורית: 20X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 13 איור 13. Sarcospheres ב -7 D לאחר בידוד. Sarcospheres מ OSA5 (א) ו OSA6 (B) שורות תאים במגמת התרחבות חסידה הבא השבה ו reculturing בשכבה בתנאים חסידים ב -7 ד לאחר בידוד. תצפית ב-בניגוד שלב. הגדלה מקורית: 20X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 14
איור 14. Immunofluorescence מכתים עבור CD105. מכתים Immunofluorescence עבור CD105 בקווי OSA-CSC OSA5-CSCS (א) ו OSA6-CSCS (ב ') בשורה תא רציפה HCT8 (C), אשר שימש כביקורת שלילית. LSCM בצבע קונבנציונאלי : ירוק עבור CD105 ואדום שלד התא. הגדלה מקורית: 10X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 15
איור 15. Immunofluorescence מכתים עבור CD44. מכתים Immunofluorescence עבור CD44 בקווי OSA-CSC OSA5-CSCS (א) ו OSA6-CSCS (ב ') בשורה תא רציפה HCT8 (C), אשר שימש כביקורת שלילית. LSCM בצבעים קונבנציונאלי: ירוק עבור CD44 ואדום שלד התא. הגדלה מקורית: 10X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

בתוך-page = "1"> איור 16
איור 16. מכתים Immunofluorescence של Stro1. מכתים Immunofluorescence עבור Stro-1 בקווי OSA-CSC OSA5-CSCS (א) ו OSA6-CSCS (ב ') בשורה תא רציפה HCT8 (C), אשר שימש שלילית לִשְׁלוֹט. LSCM בצבעים קונבנציונליים: ירוק עבור Stro-1 ואדום שלד התא. הגדלה מקורית: 10X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 17
הביטוי איור 17. של סמנים גרעיני ESC ושל CD133 ג'ין. RT-PCR מראה את הביטוי של Nanog, 3/4 אוקטובר Sox2 ו CD133 ב OSA5-CSCS (א) ו ב OSA6-CSCS ( נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 18
איור 18. osteogenic בידול Assay -. ALP בידול osteogenic ב 0 ד (A, B) ואחרי 10 ד (ג ', ד) האינדוקציה כפי שנקבע על ידי מכתים cytochemical עבור ALP באמצעות BB כחול מהיר. בכחול, ALP + תאים; באדום, בגרעין counterstained עם יודיד propidium. תצפית Composite ב brightfield ו קרינה. הגדלה מקורית: 20X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 19 איור 19. osteogenic בידול Assay -. HA בידול osteogenic ב 0 ד (A, B) ואחרי 20 ד (ג ', ד) האינדוקציה כפי שנקבע על ידי מכתים cytochemical עבור hydroxyapatite (HA) עם Alizarin האדום ס התאים הם בניגוד ב כחול / אפור, פקדונות המגורען של HA מגואלות באדום. תצפית בניגוד שלב. הגדלה מקורית: 40X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 20
איור 20. Adipogenic Assay בידול. בידול Adipogenic ב 0 ד (A, B) ואחרי 14 ד (ג ', ד) האינדוקציה כפי שנקבע על ידי cytochמכתים emical עם שמן אדום O. באדום, שלפוחית ​​lipidic (השלפוחית ​​הגדולה מסומנת על ידי החצים השחורים / אדומים; השלפוחית ​​הקטנה מסומנות על ידי החצים הלבנים / שחורים); ב / סגול כחול, הגרעינים counterstained ידי haematoxylin. תצפית ב brightfield. הגדלה מקורית: 40X. בר גודל:. 100 מיקרומטר אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 21
איור 21. CFU Assay. Assay CFU של קווי OSA-CSC מוכתם toluidine כחול. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 22 /> איור 22. ALDH Assay הפעילות. את assay colorimetric ALDH זוהה רמות גבוהות של פעילות ALDH בשתי שורות OS-CSC, OSA5-CSCS ו OSA6-CSCS, ואילו assay מזוהה בהעדר פעילות זו בשורת תא הבדיל הסופית של פיברובלסטים, FIB. ברי שגיאה: SD. **: P <0.001 לעומת FIB; *:. P <0.01 לעומת FIB אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
גֵן oligonucleotides רצף (5¹-3¹) גודל Amplicon (נ"ב) Tₐ (° C)
Nanog פריימר הפוך פריימר קדימה 87 60
אוקטובר 3/2 פריימר הפוך פריימר קדימה GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 פריימר הפוך פריימר קדימה TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 פריימר הפוך פריימר קדימה CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
נ"ב, זוגות בסיסים של גודל amplicon; Tₐ, חישולטֶמפֶּרָטוּרָה

רשימה מפורטת טבלת 1. פריימר רצפים עבור Nanog, 3/4 אוקטובר Sox2 ו CD133 עם גודל Amplicon ואת טמפרטורת החישול

Discussion

יש CSCS מספר מאפיינים המאפשרים זיהוי של קבוצת משנה הסלולר המסוים הזה את עיקר הגידול. על סמך מאפיינים אלה, כגון עמידות נרכשת ציטוטוקסיות תרופות כימותרפיות עבור ביטוי יתר של מובילי בזרימת multidrug קלטת מחייב ATP 28, 32, 33, או על הגברת הביטוי של הביטוי של אנזימים לסילוק רעלים כמו 32 ALDH, על מנת לתת ביטוי של סמן משטח מסוים, כגון CD133, CD44, CD34, CD90, ואחרים 30, 34, 35, 41, שיטות שונות כדי לבודד CSCS פותח 42-44. אחת מן הטכניקות הללו היא assay היווצרות הכדור, אשר מבוססת על היכולת של CSCS לגדול בתנאים שאינם חסידים.

היכולת של תאי גזע רקמות CSCS לגבש התחומים תוארה לראשונה במחקרים על זיהוי של בתאי גזע עצביים ידי ריינולדס et al. 37. בהמשך לכך, גיבס et al. 38 אותנועורך מחקרים אלה כדי להתחיל לבודד CSCS מגידולים מוצקים, בפרט, מן סרקומות עצם. החלטנו להשתמש בשיטת assay היווצרות כדור המאוירת על ידי גבסתי et al. לבודד CSCS שורות תאי OSA המתקבלות ביופסיות OS קונבנציונליות. מתאמנים בשיטה המקורית כדי לשפר את התוצאות של assay זה ולהקל השחזור שלה עבור שורות תאי סרטן אחרות. בהתייחס להקמת assay היווצרות כדור, אנו מאשרים כי ציפוי 40,000 תאים / גם הוא תרגול טוב לשמירה על תאים בבידוד בתחילת assay. הטריק הזה הוא מאוד חשוב כדי למנוע את האפשרות כי המושבות הכדוריות מקורן צבירה הסלולר ולא מן הקיבולת המסוימת ובלעדית של יחיד CSC לגדול בתנאים שאינם חסידים ויוצרת מושבה כדורית. יכולת זו היא נקודה קריטית במיוחד של assay זה.

אנחנו גם אשרנו כי כדי לקבל שיעור טוב של היווצרות כדור, זה מספיק כדי לרענן aliquots של גורמי גדילה כל 3 ד ולא כל יום כמתואר השיטה המקורית. במחקר זה, אנו גם הקמנו בהרחבה תארנו שיטה טובה לבידוד המושבות כדור שנוצרו כאשר בתרבית בתנאים שאינם חסידים. שלב זה הוא קריטי assay זה, כי זה חשוב מאוד לנסות לבודד כמה שיותר כדורים ככל האפשר כי נוצרות בכל טוב מבלי לפגוע בהם. כמו כן, חשוב לבודד רק ספירות ולא התאים הבודדים, אשר יכול לרחף למשך assay. כדי להתגבר על נקודות קריטיות אלה, פתחנו שיטת בידוד מסוימת, אשר, כפי שפורט לעיל, נתנה תוצאות טובות עבור בידוד CSC. כמובן, יש את האפשרות כי לא כל התחומים שהיוו ניתן לשחזר, אך אחוז ההפסד הוא נמוך מאוד. אכן, יש לנו גם את האפשרות להשתמש במסנן עם 40 מיקרומטר הנקבוביות לבודד תחומי לאחר שהן הופכות גדולות (טופסאד כ 100 - 200 תאים).

בידוד זה מפסיק היווצרות כדור אך מאפשר תאים בודדים, חלק שאריות methylcellulose, והן במישור הקטן להיות מסוננים. חיסול זו מבוצע על ידי סינון יסודי כמתואר בפרוטוקול.

יתר על כן, הבחירה של המושבות כדוריות הגדולות דרך 40 מיקרומטר הרשת עם לאובדן המושבות הכדוריות הקטנות מאפשרת לבחור את CSCS עם הקיבולת הגבוהה ביותר ליצור מושבות כדור עם stemness יותר. כל השינויים הללו בוצעו כדי לשפר את assay וכדי לסייע לחוקרים ללמוד CSCS להבין ולהתרבות השלב הקריטי ביותר של השיטה המקורית של assay היווצרות כדור.

בין המחקרים לגבי בשיטות במבחנה CSCS לבודד, המחקר הנוכחי הייתה להראות כיצד מותאם זה assay היווצרות כדור יכול להיות שיטה טובה לבידוד CSCS משורות תאים OSA. העיבודים לשיטה המקורית ואת טכניקת הבידוד המפורטת תארו לשפר את יעילותו. תוך זמן קצר, מספר לא מבוטל של CSCS ניתן להשיג ומשמש מספר ניסויים. לכן, אפשר לאשר את פנוטיפים הגבעולי במהירות, בפרט, כדי ללמוד את הפנוטיפ הגבעולי הכפול מאפיינת OS-CSCS. לפיכך, assay שונה זה יכול להיות טכניקה טובה לבידוד CSCS ולומד ביולוגיה שלהם. בעתיד, בשיטה זו, עם עיבודים נוספים, עשויה לשמש גם כדי לבודד CSCS מתוך שורות תאי סרטן סופי אחרות שהושגו באמצעות ביופסיות של גידולים מוצקים נדירים.

האפשרות לבודד CSCS מגידולים מוצקים נדירים, כגון OS, לא מתיר שיפור של מחקרים על סרטן הספציפי הזה, אבל גם מרחיב מחקרים של סוגים שונים של סרטן לפתח שיטות טובות יותר עבור הבידוד שלהם מחקרים עתידיים של הביולוגיה של משנה הסלולר החשובה הזו. לכן, כפי שאנועשו במחקר זה, חשוב לשפר את השיטות של בידוד CSC באמצעות לימוד ביולוגית CSC, עם המטרה הסופית של מציאת מטרות מולקולריות ופיתוח טיפול נגד סרטן ספציפי מאוד מכוון נגד משנה הסלולר המסוים הזה, שהוא כנראה אחראי התחזוקה של הגידול הראשוני, התפתחות הישנותו, ואת המקור של גרורות בכמה איברים. המחקר של הביולוגיה CSC חשוב גם למציאת טיפולים שיכולים להיות נוקב בריפוי סרטן, כגון OS, אשר שיעור ההישרדות לאחר טיפול neoadjuvant נשאר עני מאוד.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics