암의 설립은 인간 기존의 골육종에서 세포 배양 줄기

Cancer Research
 

Summary

뼈 육종 암 줄기 세포의 존재 (CSC 추가)는 최근에 발병에 연결되어있다. 이 글에서, 우리는 비 접착 조건에서 성장하는 암줄 기세포의 능력을 사용하여 기존의 골육종 (OS)의 인간 생체 검사에서 얻은 기본 세포 배양에서 암줄 기세포의 분리를 제시한다.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

골육종 (OS)에 대한 치료에 현재 향상 암 환자의 생명을 연장했지만 전이가 발생했을 때, 5 년 생존율은 여전히 ​​좋지. 암 줄기 세포 (CSC) 이론은 종양을 유지하고 약제 요법에 저항 할 수있는 능력을 포함한 줄기 같은 특성을 갖는 종양 내 종양 세포의 서브 세트가 있음을 보유하고있다. 따라서, OS의 생물학 및 병인에 대한 이해는 특정 서브 세트를 박멸 및 환자군 질병률 및 사망률을 감소시키는 치료 표적의 개발을 진행시키기 위해 필요하다. , 암줄 기세포를 분리 암줄 기세포의 세포 배양을 수립, 그들의 생물학을 공부하는 것은 OS 생물학 및 병인에 대한 우리의 이해를 향상시키는 중요한 단계입니다. OS의 생검에서 인간 유래 된 CSC-OS의 설립 nonadhere 하에서 3 차원 줄기 세포 배양 물을 만들 수있는 능력을 포함하여, 여러 가지 방법을 사용 가능하게 된NT 조건. 이러한 조건에서, CSC 추가 딸 줄기 세포에 의해 형성된 콜로니 구형 플로팅을 만들 수있다; 이 식민지는 "세포 분야"라고되어있다. 여기서는 OS 생검에서 얻어진 종래의 OS의 일차 세포 배양 물로부터 CSC 배양을 설정하는 방법을 설명한다. 우리는 명확하게 암줄 기세포를 분리하고 특성화하는 데 필요한 여러 구절을 설명합니다.

Introduction

육종은 배아 중배엽 (1)에서 주로 발생하는 드문 악성 결합 조직 종양의 이종 그룹입니다. 다른 유형은 골 육종 및 연부 조직 육종을 포함한다. 뼈 육종은 비교적 드문 차 종양의 그룹, 골육종 (OS)를 포함한 여러 아형,로 구성되어 있습니다. OS, 뼈의 일반적인 기본 종양 중 하나는, 광범위한 임상 적, 조직 학적 및 분자 이질성 (2, 3)을 나타내는 중간 엽 악성 종양이다. 불행히도, OS 5, 어린이 및 청년 4에서 주로 발생하며 60 %를 차지 어린 시절 뼈 육종의 일반적인 조직 학적 아형은 6, 7. OS는 일반적으로 영향을 빠른 뼈의 성장을 특징으로 골격 영역 (예를 들면, 긴 뼈의 골 간단). 또한 수질 또는 중앙 OS라는 OS, 기존 OS의 조직 학적으로 서로 다른 아형 중 악성 종양의 높은 학년과 할당량 샤가80 % 8 재. 이 80 %는 60 % 종래 골아 OS 10 % chondroblastic OS, 및 10 % 섬유 아세포 OS 6, 8-10로 구성되어있다. 다른 OS 서브 타입은 역 형성, telangiectatic, 거대 세포가 풍부한 작은 세포 OS를 포함한다. 결합 수술 OS 관리 화학 요법의 진보에도 불구하고, 결과는 전이 11,12없이 환자 65-70%의 장기 생존율 불량 남아있다. 먼 재발 자주 전이로, 또는 덜 빈번 폐 전이 발생할 먼 뼈와 지방 재발 13. 전이는 종종 기존 치료에 저항. 이 저항은 10 년 무병 생존율 진단 14, 15, 전이성 질환을 가진 환자의 약 30 %가되는 이유이다.

정상 조직과 같이, 암 조직은 세포 유형의 이종의 집합으로 구성된다. 종양 내 세포 발달의 각 단계에 대응하는 것으로 보인다. 상관 없음 내ormal 조직 따라서 조직 항상성을위한 전구 세포 및 성숙한 세포를 제공 selfrenew 할 수있는 능력 세포의 서브 모집단을 상주. 마찬가지로, 암의 증식과 종양 전위 상이한 정도와 개발의 다른 단계에서 세포의 유사한 이종 집단으로 구성된다. 이러한 암 세포의 서브 세트는 암 줄기 세포 (CSC 추가)를, 종양 부피 (16)를 구성하는 다른 세포 계통을 따라서, 종양의 악성 가능성 selfrenew 및 유지 배타적 능력 세포 selfsustaining 생성 리저버를 구성 되나. 1990 년대에, 급성 골수성 백혈병에 대한 연구는 CSC의 소집단 (17), (18)의 존재에 대한 최초의 강력한 증거를 제공했다. 암줄 기세포는 이후함으로써 암 연구에서 가장 연구 주제 중 하나가되고, 고형 종양 (19)의 큰 숫자에서 고립되었다. 암줄 기세포는 실제로 정상 만드는 유전자의 돌연변이에 의해 정상 줄기 세포에서 발생할 수20-23 암 줄기 세포. 미세 환경과 여러 변형 돌연변이 및 상호 작용은 암줄 기세포를 예표 selfrenewal 용량과 불멸을 획득 ​​건강 전구 세포와 성숙 세포에 기여할 수있다. 이러한 변화에 대한 여러 가지 가설이있다. 건강 선조 건강한 성숙 세포 및 암세포 selfrenewal 관련 유전자 24-28을 활성화하여 줄기 같은 표현형을 획득하는 세포를 줄기 탈분화있다. 몇 가지 최근의 연구에도 불구하고, 암줄 기세포의 기원은 아직 발견해야합니다.

암줄 기세포의 특별한 특징은 능력이 다른 약물과 결합 된 수술과 화학 요법으로 구성 다중 치료 접근 방식을, 저항하는 것입니다. 최근의 연구는 암줄 기세포는 화학 요법 제를 세포 독성에 내성을 획득 할 수 있다는 것을 보여 주었다. 이 저항에 대한 가능한 설명은 ATP 바인딩 카세트 (ABC) 다중 약물 수송의 과발현을 포함한다 (즉,MDR1 및 BCRP1) 알데히드 데 하이드로게나 제 1 (ALDH1) 및 / 또는 세포주기 동력학 30-33 변화로서 항암제 대사 효소의 과발현. 지금까지 설명 된 모든 이러한 개념의 직접적인 결과는 CSC의 하위 집단이 완전히 제거 된 경우에만 단 한 번의 CSC가 살아 경우 국소 재발이나 원격 전이가 발생할 수 있습니다 동안 암 치료가 효과적 일 것입니다.

이 환자 나중에 재발 많은 치료 초기에 효과적인 것으로 보인다 이유에 대한 가능한 설명을 제공하지만, 때문에 인간의 육종 (34), 특히 OS (35), 또는 다른 뼈와 연부 조직 암에서의 암줄 기세포의 발견은 큰 임상 적 중요성을 가지고있다. 따라서, 기존의 OS에 대한 미래의 전투에 대한 희망이 하위의 분자 특성에 OS-암줄 기세포 감사에 관한 혁신적인 약물의 개발에 따라 새로운 특정 표적으로 한 치료를 찾을 수 있습니다인구와 CSC 생물학의 연구에.

1992 년 줄기 세포의 일부는 성숙한 포유 동물의 뇌에 존재 여부를 조사 하였다 레이놀즈와 동료, 줄기 형 셀 (36), (37)로 의심되는 세포를 분리하는 방법을 개발 하였다.이 방법의 특정 기능에 기초 비 접착 조건 하에서 성장 될 때이 세포 구형 콜로니를 형성한다. 비슷한 기술이 골 육종 (38)의 줄기와 같은 세포의 모집단을 연구하기 위해 2005 년에 깁스와 동료에 의해 사용되었다. 분리 종래 OS의 종류의 일차 세포 배양 물로부터 OS-CSC 추가 특성화하기 위해 OS 세포주에이 기술을 적용하기로 결정했다.

여기서는 종래의 OS의 생검 인간 유래의 유한 차 세포주로부터 OS-CSC 추가를 분리하는데 사용될 수있다 "sarcosphere 분석"이라 구 형성 분석이 적응 방법을 서술. 우리는 또한 모든 기술 유를 설명이 분석에 의해 단리 세포주의 줄기 등 CSC 표현형 확인 나오지 : 그리고 암줄 기세포의 마커 인 CD133 유전자의) 다 능성 배아 줄기 세포 (는 ESC를 특성화하는 유전자의 발현의 1) 평가하는 단계; 2) 집락 형성 단위 (CFU) 분석; 3) 적당한 분화 조건에서 조골 세포 및 지방 세포로 분화하도록 이들 세포의 기능 평가; 면역 형광 염색 및 유세포 분석에 의한 중간 엽 줄기 세포 표면 마커 (MSC들) (즉, CD44, CD105 및 STRO-1) ~ 4) 연구; 이들 세포의 활성 ALDH 5) 평가.

Protocol

여기에 설명 된 인체 조직을 사용하는 모든 실험은 로컬 윤리위원회 (하기 Rif. N. 12분의 141)에 의해 승인되었다. 조직 샘플의 수집 및 샘플의 사용 및 저장에 대한 동의는 AOUC의 기증자로부터 얻은 것입니다.

문화 1. 준비

  1. 10 % 우태 혈청 (FBS), 100 IU / ml의 페니실린 및 100 μg의 / ㎖ 스트렙토 쿤 변성 햄 F12 배지에 첨가하여 성장 배지 (GM)을 준비한다. 필터 및 0.22 ㎛의 필터를 이용하여 멸균 GM. 최대 1개월 4 ° C에서 보관 GM.
  2. 쿤 변성 햄 F12 배지에 20 % FBS, 100 IU / ml의 페니실린, 100 μg의 / ㎖ 스트렙토 마이신, 3 ㎎ / ㎖의 콜라게나 제 II 형 콜라겐을 첨가하여 배지 (CM)을 준비한다. 필터 및 0.22 ㎛의 필터를 이용하여 CM 살균. 에게 1 달 -20 ° C에서 보관 CM.
  3. 40 % FBS를 추가하여 (FM)를 동결 세포에 대한 매체 준비, 100 IU / ㎖ 페니실린, 100 μg의 / ㎖ 스트렙토 마이신 및 (6)쿤의 수정 햄의 F12 매체에 0.5 %의 디메틸 설폭 사이드 (DMSO). 필터 0.22 μm의 필터를 사용하여 FM을 소독합니다. 최대 1개월 4 ℃에서 보관 FM.
  4. 쿤의 수정 햄의 F12 매체에 20 % FBS, 100 IU / ml의 페니실린과 100 μg의 / ㎖ 스트렙토 마이신을 추가하여 CFU 분석 (㎖,)에 대한 매체를 준비합니다. 필터는 0.22 μm의 필터를 사용 ㎖, 살균 및. 스토어 ㎖, 1개월까지 4 ° C에서.
  5. ml의 둘 베코 인산염 완충 식염수 (DPBS) 2 + 칼슘과 마그네슘없이 1000에서 포도당 무수 - 400 mg의 트립신, 200 mg을 EDTA 1,000 mg을 D (+)를 용해하여 트립신을 준비합니다.
    참고 : 최대 3 개월 동안 -20 ° C에서 0.22 μm의 필터와 동결을 사용하여 25cm에 50 ml의 분취 액에 2 플라스크 신선한 트립신 EDTA를 나눈다. 스토어 활동의 손실없이 4 ° C에서 필터 살균 분취 량을 해동.
  6. 100 IU / ml의 페니실린, 100 μg의 / ㎖ streptom 10 % FBS를 첨가하여 줄기 세포 성장 배지 (SCGM)를 준비쿤의 수정 햄의 F12 매체에 ycin, 10 NG / ㎖의 bFGF (25 μg의 / ㎖ 주). 4 ° C에서 이주까지 0.22 μm의 필터와 매장 SCGM를 사용하여 SCGM를 필터링합니다.
  7. 3 일 동안 39 ° C에서 초순수 H 2 O에 MC에 용해시켜 2 % 메틸 셀룰로오스 (MC)를 준비한다. MC가 완전히 용해 될 때, 오토 클레이브를 4 ℃에서 저장한다.
    참고 : MC는 멸균 후에는 고체가된다. 4 ℃에서 액체 상태, 가게에 MC를 가져올 수 있습니다.
  8. sarcosphere 성장 매체 (SGM)를 준비합니다. , 100 μg의 / ㎖ 인간의 bFGF (25 μg의 / ㎖ 주) 100 IU / ml의 페니실린을 추가하여이 매체 신선한 (안 2 주 이상 사용 전) 준비, 20 nM의 프로게스테론 (10 μM 주), 100 μM의 퓨 트레 신, 30 nM의 아 셀렌 산 나트륨 (30 μM 주), 25 μg의 2 배에 / ㎖ 트랜스페린 (25 ㎎ / ㎖ 주), 20 μg의 / ㎖ 인슐린 (20 ㎎ / ㎖ 주), 10 NG / mL의 인간 EGF (10 μg의 / ML의 주) 쿤의 햄의 F12 매체를 수정했습니다. 필터 및 0.22 ㎛의 FIL를 사용 SGM 살균터. 4 ° C에서 최대 2 주 동안 저장합니다.
  9. (10 % FBS (미국 남부 출신), 100 IU / ml의 페니실린, / ㎖ 스트렙토 마이신, 10 나노 덱사메타손 (100 μM 주) 100 μg의 0.2 mM의 나트륨 L - 아스 코르 빈산 -2- 인산을 첨가하여 1 골 형성 매체 (OM)를 준비 M 주식), 쿤의 수정 햄의 F12 매체에 10 MM의 β-글리세 (5 ㎎ / ㎖ 주) 1 μg의 / ㎖ 칼 세인 (200 μg의 / ㎖ 주). 필터는 0.22 μm의 필터를 사용 OM을 소독. 4 ℃에서 보관하십시오.
    주 : 액체 질소하에 저장 덱사메타손 원액 그들의 활성을 유지한다. 매체의 분화 잠재력을 유지하기 위해 덱사메타손의 활성을 유지하기 위해 2 주마다 신선한 OM을 준비한다.
  10. 1.66 mg의 NH4Cl를 용해시켜 0.2 mg의 K 2 HPO 4 200 ㎖ 중의 0.007 밀리그램 EDTA 증류수 (DH 2 O)을 적혈구 세포 용해 완충액 (ELB)를 준비한다. 필터 및 0.22 ㎛의 필터를 이용하여 멸균 ELB. 4 °에서 보관기음.
  11. 추가하여 지방 세포 매체 (AM)를 준비 10 % FBS (남미 원산지), 100 IU가 / ㎖ 페니실린, 100 μg의 / ㎖ 스트렙토 마이신, 1 μM 덱사메타손 (1 밀리미터 주), 1 μM 소 인슐린 (10 mM의 주식), 0.5 mM의 이소 부틸 (IBMX) (500 밀리미터 주)와 쿤의 수정 햄의 F12 매체에 100 μM의 인도 메타 신 (200 mm)이다. 필터 및 0.22 μm의 필터를 사용하여 AM 소독. 4 ℃에서 보관하십시오.
    주 : 액체 질소하에 저장 덱사메타손 원액 그들의 활성을 유지한다. 매체의 분화 잠재력을 유지하기 위해 덱사메타손의 활성을 유지하기 위해 2 주마다 신선한 AM을 준비한다.
  12. 준비 2 % DPBS에 소 혈청 알부민 (BSA) (BSA / DPBS). 500㎖의 DPBS에 10g의 BSA를 용해시키고, 50 ㎖ 원뿔형 튜브에 50 mL의 원액을 aliquotting하여 스톡 용액을 제조 하였다. -20 ° C에서 보관하십시오.
  13. DPBS (PFA / DPBS) 중 4 % 파라 포름 알데히드 (PFA)의 용액을 준비한다. 채널에서emical 후드는 DPBS에 파라 포름 알데히드를 희석하고 50 ㎖ 원뿔형 튜브에 50 mL의 원액을 aliquotting하여 스톡 용액을 제조 하였다. 4 ℃에서 보관하십시오.

2. (OSA) 1 차 OS 세포 배양 및 OS 유한 세포주를 수립

참고 : 기본 OS 세포 배양은 "자 Unit ORTOPEDIA Oncologica 전자의 Ricostruttiva", AOUC Careggi, 피렌체에서 수집 된 기존의 OS 생검의 신선한 샘플로부터 제조 하였다. 침 흡인 또는 종양 (도 1A, B)의 작은 부분의 수술 적 절제에 의해 수득 된 모든 생검 즉시 100 IU / ml의 페니실린 및 100 μg의 / ㎖ 스트렙토 마이신 (PH 7.4)로 보충 된 배양 배지에 넣고 그들은 처리 된 실험실로 이송. 모든 기술 된 조작은 층류 후드를 이용하여 무균 조건 하에서 수행 하였다.

  1. OS 세포의 분리
    1. A의 조직 검사를 배치GM의 작은 볼륨 100mm 페트리 접시. 무균 란셋 페리 핀셋으로 가능한 한 작은 피스로 절단하여 OS 조직 샘플을 말하다 (0.5-1 ㎜) (도 2A, B).
    2. 효소 소화 (그림 2B) 10 ML의 CM으로 조직의 조각을 덮고 37 ° C, 5 % CO 2 배양기에서 3 시간 동안 배양. 조심스럽게 피펫을 사용하여 조각의 정지를 제거하고 조각을 펠렛 즉각적인 원심 분리 (5 분 400 XG)의 15 ML 원뿔 튜브로 전송할 수 있습니다.
      주 : 생검 적혈구 풍부하면 원심 분리 후, 적혈구 이루어지는 적색 입금 프래그먼트 통해 알 수있다. 따라서, 기계적 분산으로 진행하기 전에, 적혈구 용해 버퍼와 샘플을 취급합니다. 흡인에 의해 뜨는을 취소하고 5 ML의 ELB를 추가합니다.
    3. 1 분 동안 펠렛 조각을 일시 중단하고 2 400 XG에 현탁액을 원심 분리분. 흡인에 의해 뜨는을 제거합니다. 20 회 - 10 ml의 혈청 학적 피펫 (눈 크기, 1.5 mm 내부 Ø) (10)를 사용하여 조각을 분산 기계적으로 5 ml의 GM을 추가합니다.
    4. 5 분 동안 400 XG에 현탁액을 원심 분리기. 흡인하여 상등액을 제거 10 ㎖ GM과 세포 펠렛을 중단 한 후 100mm 페트리 접시로 얻어진 세포 현탁액을 전송. 37 ° C, 5 % CO 2 배양기에서 배양 접시를 품어 신선한 완전한 GM 매 3 D로 GM을 교체합니다.
      참고 : 매우 자주, 침 흡인에 의해 얻어진 OS 조직 샘플은 콜라게나 제와 효소 분해에 의해 소화되지 않은 뼈 조각, 매우 작고 포함되어 있습니다. 상등액을 제거한 후 따라서 피펫 펠릿 단편을 당화함으로써 뼈 조직으로부터 세포를 분리하기 위해 시도한다.
  2. 하위 문화
    참고 :
    세포가 대략 합류에 도달 할 때 OSA을 설정하려면, 파묻혀에서 제거R 문화 용기, 희석 및 추가 성장을 가능하게하는 신선한 접시에 배치합니다. 이러한 배양 과정은 트립신 불리는 효소 절차를 사용하여 달성된다.
    1. 흡인 매체를 제거합니다. - (20 ° C 최대 18) 부드럽게 한 번 흔들어, 흡인에 의해 즉시 트립신을 제거 실온에서 3 ㎖ 트립신 - 세포 단일 층을 해리하려면 2를 추가합니다. 두 번 반복합니다. 그들은 분리하기 시작할 때까지 4 분 - 3 37 ° C에서 세포를 품어.
      참고 : 좋은 트립신은 요리가 빛을 개최 할 때 약간 불투명 한 단층을 형성하는 작은 구멍으로 경험 사용자가 볼 수 있습니다. 이 분리는 역 현미경을 사용하여 모니터링 할 수있다 이 방법은 초보자에게 추천합니다.
    2. 10 ml의 GM을 추가하여 트립신 반응을 중지하고 모든 세포를 분리하기 위해 피펫을 사용하여 잘 접시를 씻으십시오. 전송 한 새로운 100mm 페트리 접시에 정지 ㎖의 9 ml의 GM (세포의 1/10 분할)를 추가합니다.
      노트:
  3. OS 차 문화와 OSA의 냉동 보존
    참고 : 4-5 크리오 바이알 (cryovial)에 하나의 합류 100mm 페트리 접시를 고정. 냉동 보존 공정은 동결 중에 세포막 보호 DMSO가 비 냉동 온도에서 세포 독성이 있기 때문에 신속하게 수행되어야한다.
    1. 트립신에 의한 단층에서 세포 배양을 해리, 5 분 동안 400 XG에서 원심 분리하여 펠렛 세포 (2.2 절 참조) 흡인에 의해 뜨는을 제거하고 신속 FM의 세포 펠렛을 일시 중지합니다.
    2. 나누어지는 극저온 유리 병 당이 현탁액 1 ㎖. 즉시 2- 프로판올 및 저장 최단 당일의 재킷 냉장고 상자에 충전 된 튜브를 배치tely -80 ° CO / N에서. 전송은 액체 질소에 장기 저장을 위해 다음날 크리오 바이알 (cryovial).
  4. 제상 OS 세포주 및 일차 배양
    1. 액체 질소에서 보관 제상 OS 세포주, 37 ° C에서 실험 수조에 배치하여 급속 해동 크리오 바이알 (cryovial). 15 ML 원뿔 튜브에 크리오 바이알 (cryovial)의 내용을 전송하고 GM의 약 10 ml에 (DMSO를 제거하기 위해 2.3 절 참조)에 추가합니다. 흡인에 의해 뜨는을 제거하고 10 ml의 GM의 세포 펠렛을 일시 중지합니다. 100mm의 페트리 접시에 세포 현탁액을 접시 및 37 ℃, 5 % CO 2 인큐베이터에서 배양한다.

3. Sarcosphere 분석은 분리하는 OS-암줄 기세포

참고 :이 실험은 OSA에서 수행됩니다. 이 실험 기간은 이들 구체 콜로니 (sarcospheres)을 형성하는 세포의 능력에 관련된 시간 내지 7, 14, 21, 및 28 (D)이다.

  1. 맛 음료sarcosphere 분석의 lishment
    1. 혈구 챔버와 사전에 모든 시약을 준비합니다.
    2. 흡인 배지를 제거하고 트립신 처리에 의해 단일 층의 세포를 해리 (섹션 2.2 참조). 피펫 어떤 덩어리를 분산하고, 20 μL 피펫 팁을 사용하여 10 μL를 수집 철저히 세포 현탁액을 혼합한다.
    3. 상기 혈구 챔버 에지 바로 10 μL 세포 현탁액을 전송 현탁액을 배출하고,이 모세관 현상에 의해 커버 슬립에 따라 그려 질 수 있도록.
    4. 위상차에서 혈구 실을 준수하십시오. 10 배 목표를 선택하고 챔버에서 그리드 선에 초점을 맞 춥니 다. 계산에 대한 지원으로 (또한 세 개의 평행선 구속)가 하위를 사용하여이 1mm 2 지역에 누워 세포와 단일 그리드 선을 계산합니다.
    5. 농도를 측정하고 다음 식에 적용 (1 mL의 = N * 104 / z를 N : 카운트 모든 셀의 전체 개수사각형 1mm 2; Z : 계산 사각형 1mm 2)의 수. 6- 웰 초저 부착 플레이트에 웰마다 40,000 세포로 분할 240,000 세포의 총량 판형에 필요한 세포 현탁액의 양을 계산한다.
      참고 : 하나의 여분의 우물에 세포를 도금 세포의 정확한 수를 판해야합니다. 따라서, 도금 될 세포의 총량은 28 세포이다.
    6. 25 cm2로 플라스크에 2 % MC (SGM-MC)의 50 %를 첨가하여 35 ml의 SGM을 준비한다. 엑스트라 웰 플레이트에는 별도 5 mL를 고려 SGM의 총량을 준비한다.
    7. 플라스크에서 제조 한 SGM-MC의 세포 현탁액의 계산 된 볼륨을 추가하고 덩어리를 분산하기 위해 피펫을 사용하여 부드럽게 섞는다. 6 잘 초저 부착 판에서 세포를 플레이트 및 도금 후 세포가 표시되는 방식을 관찰하기 위해 거꾸로 현미경을 사용합니다.
    8. 37 ° C, 5 % CO 2 인큐베이터에서 세포를 인큐베이션. 모든 3 d를, FR 추가각 웰의 bFGF와 EGF의 ESH 분취 량은 상기 성장 인자의 농도를 새로. 물론 각 10 ng를 / ㎖의 최종 농도에서 모두를 유지하기 위해 2 μL의 bFGF 5 μL EGF를 추가합니다.
  2. sarcospheres의 분리
    참고 :이 형성된 sarcospheres을 분리 할 필요가있다시기를 결정하기 위해 7, 14, 21, 28 D에 sarcosphere 분석의 좋은 진행 상황을 모니터링합니다.
    1. 층류 후드 (도 3A, B)의 모든 시약 및 장치를 준비한다. 25mm 직경의 넷 필터 및 멤브레인 필터 홀더에 40 ㎛의 메시를 배치하여 여과 유닛을 조립; 오토 클레이브 (그림 4A-E)에 의해 소독.
    2. 각 웰 들어, 1000 μL 팁으로 멸균 피펫을 사용하여 멸균 멤브레인 필터 홀더와 주사기에 sarcospheres을 함유하는 배지를 옮긴다. 완전히 sarcospheres을 함유하는 배지를 제거한 후, 추가로 잘 씻어5 ml의 GM을 보내고은 주사기에 모든 분야를 전송해야합니다. 모든 sarcospheres 복구되었는지 여부를 확인하기 위해 현미경을 사용합니다. 그렇지 않은 경우,이 단계를 반복하여 진행합니다.
    3. 구체의 손상을 방지함으로써 분야의 손실을 피하기 위해, 필터를 통해 교차 갖는 sarcospheres을 피하기 위해 압력 않고 중력에 의해 막 필터 홀더 현탁액 필터. 부드럽게 멸균 유리 파스퇴르 피펫을 사용하여 기포를 제거합니다.
      주 : 때때로 여과 멤브레인 필터 홀더에 기포의 존재에 의해 차단된다.
    4. 주사기에 10 ml의 GM을 추가하고 단일 세포를 제거해야하는 압력없이 필터링 할 수 있도록함으로써 여과 장치를 씻으십시오. 주사기에서 필터 유닛을 분해하고 페트리 접시에 넣어.
    5. 페리 핀셋을 사용하여 멤브레인 필터 홀더에서 그물 필터를 제거하고 60mm에서 핀셋으로 가볍게 흔들어 씻어페트리 접시는 멤브레인의 복잡하게 얽힌에서 sarcospheres를 분리합니다. 이어서, 웰 막을 배치하고 막에 얽힌 더 구체 없는지 현미경 관찰에 의해 확인한다. 분야는 여전히 막에 얽힌 경우 단계 3.2.4에 기술 된 바와 같이, 다른 세척 진행합니다.
    6. 현미경을 사용하여 출시 sarcospheres을 준수하십시오. 37 ° C, 5 % CO 2 배양기에서 방출 된 sarcospheres을 품어. 6 잘 초저 부착 판의 각 웰에 대한 모든 단계를 반복합니다.

4. OS-CSC 라인

참고 : OS-암줄 기세포는 재 소개하고 그들이 매우 낮은 부착 조건에서 더 이상 mm 60 작은 배양 접시에 도금 후 단층에서 이러한 세포를 reculturing 없다하여 부착 확장을 나타내는 sarcospheres에서 얻을 수 있습니다.

  1. OS-CSC 문화
    1. 그들은 60에서 약 90 %의 합류에 도달하면 추가 성장, 배양 세포를 활성화하려면mm 페트리 접시. 단계를 반복 2.2.1 OS-CSC 문화를 설정합니다.
    2. 모든 세포를 분리하기 위해 피펫을 사용하여, 4 ml의 SCGM을 추가하여 트립신 중지하고 잘 접시를 씻으십시오. 새로운 100mm 페트리 접시에 세포 현탁액을 전송하고 6 ml의 SCGM를 추가합니다. OS-암줄 기세포는 2.2 절을 반복하여 90 %의 합류, 서브 컬쳐에 도달하면.
      주 : 격리 된 CSC-OS의 줄기 세포와 유사한 표현형을 특성화하기 위해 시험 관내 분석을 위해, 세포를 플레이트의 종류에 도금 될 수있다.
    3. 냉동 보존에 의해 설립 OS-CSC 라인 (섹션 2.3의 모든 단계를 반복) 유지. 2.4의 모든 단계를 반복하여 냉동 보관 OS-암줄 기세포를 해동.

5. 시험 관내 nalysis는 OS-암줄 기세포의 특성을 :

  1. 면역에 대한 세포의 준비
    주 :이 24도 괞 찮아의 각 웰에 합류의 오른쪽 등급에 도달하면 세포 파라 포름 알데히드에서 해결테. 합류점의 등급은 실험의 유형에 관한 것이다.
    1. 플레이트 OS-암줄 기세포 면역에 의해 표면 중간 엽 줄기 세포 (MSC) 마커를 연구하는 24 웰 플레이트입니다. 60 % 합류 - 그들이 50에 도달하면 각 웰의 세포를 수정. 흡인에 의해 SCGM를 제거하고 DPBS 24 웰 플레이트에 두 번 씻는다.
    2. 화학 후드에서 각 웰에 500 μL 4 % PFA / DPBS를 추가합니다. 실온에서 10 분 동안 인큐베이션. 재정법 / DPBS를 제거하고 초순수 DH 2 O.와 배를 씻어 24 웰 플레이트는 흄 후드에서 건조하도록 허용합니다.
  2. MSC 마커에 대한 면역
    주 : OS-CSC 추가의 면역 형광 염색는 4 % PFA / DPBS 고정은 CD44, STRO-1, CD105에 대한 항체를 사용하여 OS-CSC 추가의 MSC와 같은 표현형을 조사하는데 사용될 수있다. 다음 방법은 저자가 일상적으로 사용됩니다.
    1. 화학 후드에서 μL 0.2 (500)를 추가하여 4 % PFA / DPBS에서 수정 된 세포를 Permeabilize 하시려면% 트리톤 X-100 / 웰로 각각 DPBS. 30 분 동안 37 ℃에서 세포를 인큐베이션. 조심스럽게 세포가 DPBS로 3 배 씻는다. 300 μL의 RNase가 2 % BSA로 1 / 1,000으로 희석 추가 / 셀 DPBS 30 분 동안 37 ℃에서 배양한다.
    2. 조심스럽게 세포가 2 % BSA / DPBS로 3 배 씻는다. MSC 마커에 대한 세포 얼룩. 각 항체 양성 대조군으로 선정 우물에 차 항체를 추가합니다.
      1. 추가 300 μL 안티 CD105 안티 STRO-1는 2 % BSA / DPBS로 1/10 희석하여 300 μL 항 CD44은 2 % BSA로 1/10 희석하여 300 μL, 2 % BSA / DPBS / DPBS로 1/10 희석 만 200 μL 2 % BSA / 각 항체 음성 대조군으로 선정 우물에 DPBS.
      2. 4 ° CO / N에서 습한 환경에서 세포를 품어. 우물이 2 % BSA / DPBS로 두 번 다음 DPBS로 3 배 및 씻으십시오.
    3. 특정 이차 항체를 추가하여 일차 항체를 알 수있다.
      1. 300 μL 항 - 토끼 IgG를가 (당나귀 항 토끼 IgG를 [H + 1]가) 1/100 희석 추가2 % BSA와 함께 / 잘 CD44와 CD105 양성 및 음성 대조군으로 선정 각각에 DPBS. 2 % BSA로 1/100 희석 300 μL FITC 안티 - 마우스 IG (FITC-토끼 항 - 마우스 IgG [H + L]을) 추가 / 각 웰 STRO-1 양성 및 음성 대조군으로 선택로 DPBS. 60 분 동안 실온에서 어둠 속에서 세포를 품어. 우물이 DPBS로 6 배 씻으십시오.
    4. 2 % BSA로 희석 1/100 Phalloidin의 300 μL를 추가하여 세포 골격 액틴을위한 얼룩 MSC 마커 양성 세포 / 웰 MSC 마커 면역에 대한 스테인드 각에 DPBS.
    5. 실온에서 40 분 동안 세포를 품어. 우물이 DPBS로 3 배 세척 한 후 초순수 DH 2 O.로 두 번 씻어 위에서 설명한 면역 형광 염색 후 핵으로 대조를 진행합니다. 흄 후드에서 M DPBS (주 1.5 × 10-3 M)에 요오드화 프로피 듐 솔루션 10-5을 준비합니다.
      1. 각이 잘 상술 한 바와 같이 색깔에 200 μL 프로피 디움 요오드 용액을 추가합니다. 셀을 품어RT에서 3 분 - 2의. 초순수 DH 2 O.로 두 번 우물을 씻으십시오
        주 - 세포주 HCT8 5.2, 음성 대조군으로 사용되는 주 연속 차별화 결장암 세포주 섹션 5.1의 모든 단계를 반복한다.
  3. 골 형성 분화 분석
    주 :
    골 형성 분화는 20 일 동안 지속됩니다.
    1. SCCGM 1 × 104 세포 / cm 2의 세포 밀도에서 24 웰 플레이트에 플레이트 OS는-암줄 기세포. 물론 각각 90 % 컨 플루 - 그들은 80에 도달 할 때까지 세포가 SCGM에서 성장 할 수 있습니다.
    2. OM에 SCGM을 변경하여 골 형성 분화를 시작합니다. 4 D - 세포가 OM 성장과 매체 매 3를 새로 고칠 수 있습니다. 알칼리성 포스파타제 (ALP)의 존재를 평가하기 위해 10 D의 골 형성 분화 분석을 중지합니다.
    3. 4 % PFA / DPBS에 세포를 수정 (5.1 절 참조). ALP과 HA에 대한 세포 화학적 염색에 의한 조골 세포 표현형을 평가알리자린 레드 S 염색을 사용.
    4. ALP 세포 화학적 염색
      주 : 즉시 염색을 시작하기 전에 화학 후드에서 염료 혼합물을 준비합니다.
      1. 40 mg을 녹이고 빠른 블루 BB 50 ml의 트리스 - 염산에 빠른 레드 바이올렛 LB 소금, pH가 9 (용액 A). 1 ml의 DMSO (솔루션 B) 5 mg을 나프톨 AS-MX 인산 나트륨 염을 용해. 완전히 해결 방법에 용액 B를 추가하고 DPBS로 두 번 솔루션 C. 워시 세포를 획득, 잘 섞는다.
      2. 각 웰에 1 ml의 솔루션 C와 CO 2를 37 ° C에서 품어 5 % - 500 μL를 추가합니다. 현미경으로 세포를 관찰하여 매 10 분 염색 과정을 모니터한다.
      3. ALP 양성 세포가 집중적으로 일반적으로 30 분 이내에 발생 (고속 레드 바이올렛 LB 소금 빠른 블루 BB 염 또는 빨간색과 파란색)를 착색 될 때 염색을 중지합니다. 세포가 초순수 DH로 3 배 씻어 2 O는 경우 해결 방법 C의 모든 잔류 물을 제거하는 얼룩의 난의 침전물본이야, 무수 에탄올 빠르게 한 번 세포를 씻으십시오.
      4. 단계 5.2.5 및 5.2.5.1에 ​​설명 된대로 ALP 염색 후 핵으로 대조를 진행합니다.
    5. 알리자린 레드 S 세포 화학적 염색
      주 : 실험을 시작하기 전에 염료 혼합물을 준비한다.
      1. (초순수 H 2 O 100ml에 2g 알리자린 레드 S) 2 % 알리자린 레드 S를 준비합니다. pH가 6.0에 도달하기 위해 2 % 알리자린 레드 S 2.5 % NH 3를 추가합니다. 4 ℃에서 보관 2 % 알리자린 레드 S 솔루션입니다. DPBS로 한 번 세포를 씻으십시오.
      2. 단 몇 초 동안 세포에 알리자린 레드 S를 추가합니다.
      3. 초순수 DH와 염색의 정도를 제어하는 2 O를 우물을 씻으십시오; 는 HA 보증금은 강렬한 색이 아닌 경우, 단계 5.3.5.2를 반복합니다. HA 예금은 보통 몇 분 이내에 발생하는, 색의 강렬한 빨간색이되면 염색을 중지합니다. 초순수 DH 2 O와 우물을 씻으십시오
    6. 지방 세포 분화
      주 : 분석 기간은 OS-CSC 라인에 따라 달라집니다. 30 D - 분석은 14 지속될 수 있습니다.
      1. SCGM 1 × 104 세포 / cm 2의 세포 밀도에서 24 웰 플레이트에 플레이트 OS는-암줄 기세포. 물론 각각 90 % 컨 플루 - 그들은 80에 도달 할 때까지 세포가 SCGM에서 성장 할 수 있습니다. AM하는 SCGM을 변경하여 지방 세포 분화를 시작합니다. 세포가 AM에서 성장하고 일주일에 두 번 오전를 새로 고칠 수 있습니다.
      2. 지질 소포를 볼 수 있습니다 때 지방 세포 분화 분석을 중지합니다. 오일 레드 O 염색에 의한과 핵에 대한으로 대조 헤 마톡에 의해 지방 세포 표현형을 평가합니다.
      3. 핵에 대한 헤 마톡의으로 대조
        주 : 실험을 시작하기 전에 염료 혼합물을 준비한다.
        1. Emallume Carazzi (39)라는 5 % 헤 마톡 솔루션을 준비합니다. 4 ° C에서 솔루션을 저장합니다. 단지 2 분 동안 Emallume Carazzi를 추가합니다. ULT와 우물을 씻으십시오rapure DH 2 O.
    7. CFU 분석
      참고 :이 실험은 3 회 반복 수행해야합니다.
      1. 플레이트 OS-암줄 기세포 100mm 배양 접시에있는 ㎖, 450 세포 / cm 2의 셀 밀도. 4 주간 37 ° C, 5 % CO 2 배양기에서 세포를 품어. 일주일에 두 번 ㎖, 새로 고침.
      2. 톨루이딘 블루와 CFUs를 얼룩. 거꾸로 현미경을 사용하여 컬러 식민지를 계산합니다. 다음 식에 따라 CFU 효율을 계산한다 (콜로니 수 / 세포의 수가 시드) * 100.
    8. ALDH 활성 분석
      참고 ALDH 활성은 두 OS-CSC 라인 상 및 음성 대조군으로 사용 하였다 유한 섬유 모세포 라인상의 ALDH 활동 비색 분석 키트를 사용하여 평가되었다. 이 키트는 450 nm에서 읽기 흡수하여 ALDH 효소 활성을 정량화. 모든 실험은 3 회 반복 수행 하였다.
      1. 트립신에 의한 단층에서 세포 배양을 해리 (2.2 절 참조). 5 분 동안 400 × g으로 원심 분리하여 세포를 펠렛. 제조 업체의 프로토콜을 따르십시오.
    9. 유세포 분석 유량 :
      참고 : 단일 세포 현탁액을 유동 세포 계측법 샘플의 최적의 염색이 필요합니다. 각각의 항체를 시험 할 수 있도록 단일 세포 현탁액을 준비해야한다. 트립신에 의한 단층에서 세포 배양을 해리 (2.2 절 참조).
      1. / 1 × 105 세포의 최종 세포 농도의 세포 현탁액을 수득 분리 버퍼의 적절한 체적 챔버를 카운트 BURKER를 이용하여 세포 수, 원심 셀 400 XG에서와 재현 탁을 수행하는 원뿔형 튜브에 세포 현탁액을 배치 ml의.
      2. 4 ℃에서 5 분 동안 세포 현탁액을 원심 분리기. 뜨는을 취소하고 분리 버퍼와 펠렛을 씻는다. 두 번이 단계를 반복합니다.
      3. MS에 대한 얼룩 세포C 마커 (즉, CD44, CD105 및 STRO-1) 40.
      4. 유동 세포 계수기에 긍정적으로 스테인드 세포 현탁액을 분석합니다. 1 D 내에 표시된 샘플을 분석 할 수 있습니다. 분석 할 때까지 4 ° C에서이 샘플을 품어.
    10. RT-PCR
      1. 추출 및 RNA의 분리
        1. OS-CSC 추가의 세포 냉동 포장 샘플 1 ml의 용해 시약을 추가 상하 수회 펠릿을 피펫 팅에 의해 튜브에 직접 세포를 용균.
        2. 4 ℃에서 1 분 동안 12,000 XG에서 샘플을 원심 분리기. 조심스럽게 뜨는을 제거합니다. 새로운 튜브에 뜨는을 전송 200 μL의 클로로포름을 추가하고 안전하게 튜브를 모자. 15 초 동안 적극적으로 튜브를 흔들 RT에서 5 분 동안 샘플을 품어.
        3. 4 ℃에서 15 분 동안 12,000 XG에서 샘플을 원심 분리기. 혼합물을 세 가지 단계로 분리한다. RNA를 무색의 상부 수용액상에서 배타적이다.
        4. 인 파rticularly주의 만 수상을 제거하고 RNA 분리를 진행하는 새로운 튜브로이 단계를 전송합니다. 수성 상을 포함하는 튜브에 500 μL의 이소프로판올을 추가합니다. 손으로 부드럽게 튜브를 흔들어. 실온에서 10 분 동안 샘플을 인큐베이션. 4 ℃에서 10 분 동안 12,000 XG에서 샘플을 원심 분리기.
          주의 : 샘플을 원심 분리 한 결과, 측면에 상기 튜브의 바닥에 겔 펠릿을 형성하는 RNA를 볼 수있다.
        5. 하단에있는 RNA의 펠렛을 남겨주의하면서 튜브에서 뜨는을 제거합니다. 튜브에 1 ㎖의 75 % 에탄올을 추가합니다. 소용돌이 후 몇 초 동안 손으로 튜브와 4 ℃에서 5 분 동안 7,500 XG에서 튜브를 원심 분리기.
        6. 에탄올을 취소하고 공기는 RNA 펠렛을 건조. 위아래로 수회 용액을 피펫 팅하여 - (50 μL 10) 펠렛이 건조 할 때의 RNase가없는 물에 RNA 펠렛을 재현 탁.
        7. 신체의 체중 측정에 의한 RNA의 수율과 순도를 결정260 nm에서 분광 광도계를 사용하여 280 nm에서 흡광도를 uring. 표준 1 % 아가 로스 겔의 총 RNA의 무결성을 평가합니다. -80 ° C에서 RNA를 저장합니다.
      2. 역 폴리머 라제 연쇄 반응
        1. 역전사 키트를 이용하여 500 ng의 RNA의 샘플들로부터 첫 번째 가닥 cDNA를 합성. 얼음을 녹여 RNA 샘플 및 RT에서 키트에 필요한 용액을 해동. 제조 업체의 프로토콜 다음 cDNA를 합성하기 위해 진행합니다.
      3. 반 정량적 역전사 - 중합 효소 연쇄 반응 (RT-PCR)
        1. 24 μL의 최종 반응 부피에서 주형으로서 각 샘플 1 μL의 cDNA를 사용하여 모든 PCR들을 수행한다. Nanog를 10 월 3/4 SOX2 및 CD133 유전자의 증폭을 위해, 표 1에 기재된 프라이머 서열을 사용한다.
        2. 에티 디움 브로마이드로 1.8 % 아가로 오스 겔 전기 영동 및 염색하여 RT-PCR 생성물을 분리한다. 자외선 ILLUM 아래의 사진ination.

Representative Results

침 흡인 또는 종양의 작은 부분의 수술 적 절제에 의해 얻어진 OS 샘플 정확하게 처리 된 경우 (도 2A, B) 프로토콜 부분에서 설명한 바와 같이 (도 1A는, B) 하나의 OSA의 분리를 허용한다. 50 % - 불행히도, 생검으로부터 분리 된 세포의 수 (30)로부터의 출력 범위가 낮다. 출력은 입력과 생검 (도 5A, B)의 치수에 의존한다. 이 세포는 정확하게 처리해야합니다. 일차 배양은 100mm 배양 접시에서 컨 플루 언시에 도달하기 때문에, 약 1 개월이 필요하다. 이 시간 이후, OSA는 OSA5 및 OSA6 (도 6A는, B) 두 개의 OS 샘플에서 표시를 얻을 수있다. 그리고, LIN을 특성 분석을 수행하고, 세포를 세포 cryopreserve하도록 적절한 수를 획득하기 위해 상기 프라이 머리 셀의 행을 배양 할 필요에스. 모두 OSA 일차 전지 라인이 포화 상태에 도달했을 때 하위 문화의 3 번째 통로에서, 그들은 sarcosphere 분석을위한 6 자 초저 부착 판에 도금되어있다. 이것은 우리를 허용하기 때문에 플레이트의이 유형은, 현탁 상태로 세포를 유지하는 부착 - 매개 분화의 줄기 세포를 방지하기 위해, 분할에서 고정 의존성 세포를 방지하기 위해, 마지막으로, 기판에의 부착을 감소시키기 위해 사용된다. 그러므로 그들의 사용 된 CSC를 선택할 필요가 암 세포에 대한 스트레스 조건을 생성하라고 허용한다. 분석의 개시 후 24 시간에, 세포는 서로 (도 7)로부터 절연 나타나는. 분석의 진행을 모니터링 7 일 이내 후 작은 구형 콜로니를 형성하기 시작했고, 볼 (그림 8)되어있다. 28 (D)에 각 웰에 형성 한 여러 대형 구형 콜로니 (도 9A, B)을 관찰 할 수있다. sarcospheres가 근래 후전자가 28 일 동안 배양하고,이 큰 구형 콜로니를 분리 할 수있다. (10)이 6 자 초저 부착 판에서 sarcospheres를 분리 및 부착 조건을 reculturing 단계를 보여줍니다. (11)도 분리 한 후 부동 구형 식민지를 보여줍니다. 정상 부착 판에 도금 큰 구형 식민지 (그림 12A, B) 분리 후 부착 확장을 보여줍니다. 단일 sarcospheres에서 확장 세포 아마 줄기 세포와 유사한 표현형 암세포이다. 따라서, 분리 후에, OS-CSC 추가 아마 얻었다. 이 세포는 OSA5 - 암줄 기세포와 OSA6 - 암줄 기세포 (그림 13A, B) 이름이 지정됩니다.

지금부터, 전술 한 바와 같이, 얻어진 두 OS-CSC 라인을위한 줄기 세포와 유사한 표현형의 특성화를 진행하는 것이 필요하다. 줄기 세포와 유사한 표현형 WER의 특성에 대한 분석각 OS-CSC 선에 대한 sarcospheres 단리 된 후 E는 배양의 4 통로 수행. 그들은 표면 MSC 마커에 대한 중간 양성을 보였다 두 세포주, OSA5 - 암줄 기세포와 OSA6 - 암줄 기세포는, 표면 MSC 마커에 대한 강한 양성 (CD105과 CD44) (그림 14A, B 및도 15a를, B)했다 Stro- 1 (그림 16A, B). 관찰 사항은 상업용 및 차별화 된 대장 암 세포주 HCT8 (도 14C,도 15C,도 16C)로 취득 음성 결과에 의해 확인되었다. HCT8 세포주에서 이러한 표면 마커에 특이 비특이적 염색 총 부족이 관찰되었다.

두 OS-암줄 기세포의 MSC 표현형을 평가하기 위해, 우리는 또한 수행 유세포 분석. 모두 OS-CSC 라인은 CD44와 CD105의 높은 수준을 나타냈다. 그러나 두 세포주의 세포 만 1.14 %가 STRO-1 발현. 따라서이 다시면역 형광 염색에 의해 입증 된 바와 같이로 문의 하십은 STRO-1의 중간 존재를 확인했다. 반면, OSA5 - 암줄 기세포의 99.62 %는 CD44 표현 이러한 세포의 87.38 %는 CD105을 표현; OSA6 - 암줄 기세포의 99.88 %는에 CD44 표현 이러한 세포의 95.79 %는 CD105를 표명했다. 또한 두 세포주 CD45-이다.

우리는 3 ESC 마커 (Nanog를 10 월 3/4, Sox2이)와 CD133 유전자의 RT-PCR에 의해 다른 암줄 기세포 마커의 발현을 평가 하였다. 우리는이 유전자 모두가 모두 OS-CSC 라인 (그림 17)으로 표현 된 것으로 나타났습니다. (그림 20A - D) 및 지방 세포에 지방 세포와 골 형성 분화 분석은 조골 세포 (D - - D 그림 19A 그림 18A)로 분화하는 모두 격리 OSA-CSC 라인의 용량을 보여 주었다.

또한, CFU ssay (그림 21) OSA5 - 암줄 기세포에 대한 13 %와 OSA6-CSC에 대한 14 %로, 클론 원성 효율의 좋은 속도를 보여 주었다. 몇몇 최근의 연구는 ALDH 활성의 높은 수준의 암의 다양한 유형의 특징 인 것으로 나타났다. 이 매개 변수는 암 줄기 세포 마커로 사용 될 수 있고, 불량한 예후와 연관된다. ALDH 활성 분석은 ALDH 활성이 분석에서 음성 대조군으로 사용 된 섬유 모세포 라인 하부 정량 한계에서 관찰되었다 반면 모두 OS-CSC 라인, ALDH 활동 (도 22)의 높은 레벨들을 갖도록 하였다.

그림 1
그림 OS 생검 샘플의 1 예. (A). 생검 샘플은 침 흡인에 의해 획득했습니다. (B). 종양의 일부를 수술 적 절제에 의해 얻어진 생검 샘플.884 / 53884fig1large.jpg "대상 ="_ 빈 ">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
운영체제 샘플도 2 기계 세분화. 페리 핀셋 란셋을 사용하여 시료 (A) 조각화. (화살표로 표시) CM에 현탁 (B) 조각. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
Sarcospheres을 분리하는 데 필요한 그림 3. 장비 및 소모품. (A). 세포 분리에 필요한 모든 장치. 멸균 멤브레인 필터 홀더 1. 멸균 주사기; 2. 두 개의 서로 다른 미디어 : GM a를차 SCGM; 3. 멸균 유리 파스퇴르 피펫. 멤브레인 필터 홀더와 지원에 조립 된 주사기의 (B) 세부 사항입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
도 4 여과 장치. 여과 부 (A)를 조립하는 데 필요한 여러 구성 요소 (네트 필터는 화살표로 표시된다). 네트 필터 (B)의 40 ㎛의 메쉬 (메쉬 하나가 화살표로 표시된다)의 위상차 관찰. 원래 배율 : 10X. 여과 유닛 조립 (C - D). 여과 장치 멸균 (E). 더 큰이 적이 보려면 여기를 클릭하십시오이 그림의 rsion.

그림 5
그림 기존 OS의 5 차 세포 배양. 고급 OS의 기본 세포 배양의 위상 대비 관찰. 여러 작은 둥근 부동 적혈구가 존재하고, (B)의 상태 (A)에서, 여러 밝은 뼈 조각은 가시적이다. 원래 배율 : 10X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 6
위상차도 6 종래 유한 골육종 세포주 (OSA). (A) OSA5(B) OSA6. 관측.원래 배율 : 10X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 7
도 OSA5 및 OSA6 Sarcosphere의 분석이. 분석 개시로부터 24 시간 후, 세포를 부유 한 서로로부터 격리 (세포는 화살표로 표시된다). 위상차의 관측. 원래 배율 :. (20X) 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 8
분석에 7 D. 7 일 이내에서 그림 8. OSA5의 Sarcosphere 분석 및 OSA6, 여러 개의 작은 spherica하나의 세포에 의해 둘러싸여 리터의 콜로니가 관찰 될 수있다. sarcospheres (화살표로 나타낸 sarcospheres 이들 중 일부)을 배지에 부유하거나 약간 웰의 바닥에 침착 나타나는. 위상차의 관측. 원래 배율 : 20X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 9
도 9 Sarcosphere OSA5의 분석 및 OSA6 28 D. 28 D 후, 몇몇 큰 황색 sarcospheres 각 웰 OSA 세포주 OSA5 (A) 및 OSA6 (B)에 대한 각각의 플레이트에서 관찰된다. 바의 크기 : 100 μm의. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. </ P>

그림 10
Sarcospheres의 분리 그림 10. 통행 6 웰 매우 낮은 부착 판에서 분리 sarcospheres하는 단계 및 부착 상태에서 자신의 reculturing 표시됩니다 (A) 분리에 필요한 모든 장비.. : 넷 필터 홀더, 3 피펫, 4 천 μL 멸균 팁, 제 2 멸균 페리 핀셋, 6. 2 개의 다른 문화 미디어와 각 웰, (2) 주사기에 형성 sarcospheres 1. 하나의 6 자 초저 판 7. 멸균 파스퇴르 피펫 (8) 배양 접시. sarcospheres의 (B) 컬렉션. 각 웰에 포함 된 매체는 멸균 1,000 μL 팁과 피펫을 사용하여 수집됩니다. (C) 주사기의 정지를 수집합니다. 수집 된 현탁액을 사용하여 천연 여과 공정을 시작하기 위해 주사기로 전송멤브레인 필터 홀더. (D) 자연 여과. 주사기의 멤브레인 필터 홀더를 분해 (E). 전체 현탁액을 여과 한 후, 네트 필터 홀더는 따로 취하여 페트리 접시에 넣고; (F) 막 필터 홀더를 분해. Sarcospheres 그물 필터 홀더의 순 필터의 기공에 포함되어 있습니다, 그래서 그들은 페리 핀셋을 사용하여 해제해야합니다. (G, H) 멤브레인 필터에서 sarcospheres의 제거. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 11
그림 11. Sarcosphere의 격리. 격리 된 sarcospheres는 60mm 페트리 접시에서 매체에 떠. 위상차의 관측.원래 배율 : 40X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 12
OSA5 (A) 및 OSA6 (B) 다음의 재 도입 및 분리 후 48 시간에서 접착 상태에서 단층으로 부착 reculturing 확장의 시작 세포주로부터 격리. Sarcospheres 후 12 Sarcosphere. 위상차의 관측. 원래 배율 : 20X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 13 그림 분리 후 7 일 이내에서 13 Sarcospheres. OSA5 (A) 및 OSA6 (B) 세포주 Sarcospheres 재 도입은 다음과 분리 한 후 7 일 이내에서 접착 상태에서 단층으로 부착 reculturing 확장을 나타내었다. 위상차의 관측. 원래 배율 : 20X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 14
도 14. 면역 형광 염색 CD105. OSA-CSC 라인에서 CD105에 대한 면역 형광 염색법 OSA5-CSC 추가 (A) 및 OSA6-된 CSC (B) 및 음의 대조군으로 사용 된 연속 세포주 HCT8 (C)이다. 기존의 색상 LSCM: CD105 녹색과 세포 골격 빨간색. 원래 배율 : 10X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 15
도 15. 면역 형광 염색 CD44. OSA-CSC 라인에서 CD44에 대한 면역 형광 염색법 OSA5-CSC 추가 (A) 및 OSA6-된 CSC (B) 및 음의 대조군으로 사용 된 연속 세포주 HCT8 (C)이다. 세포 골격에 대한 CD44 녹색과 빨간색 : 기존의 색상 LSCM. 원래 배율 : 10X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.


STRO-1 OSA-CSC 라인에 대한 Stro1. 면역 형광 염색도 16. 면역 형광 염색법 OSA5-CSC 추가 (A) 및 OSA6-된 CSC (B)과 음극으로 사용 된 연속 세포주 HCT8 (C)에서 제어. 기존의 색상 LSCM : 녹색 STRO-1과 세포 골격 빨간색. 원래 배율 : 10X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 17
원자력 ESC 마커 및 CD133 유전자. RT-PCR은 Nanog를 10 월 3/4, Sox2이와 CD133 OSA5-암줄 기세포 (A) 및 OSA6 - 암줄 기세포에 (의 발현을 보여주는 그림 17. 표현 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 18
도 18 조골 세포 분화 분석 -. ALP 0 D (A, B)에서 패스트 블루 BB를 이용 ALP위한 세포 화학적 염색에 의해 결정되는 유도 10 (D) (C, D) 후의 골 형성 분화. 블루, ALP + 세포에서, 붉은 색, 핵은 요오드화 프로피 듐으로 대조. 시야 및 형광 복합 관찰. 원래 배율 : 20X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 19 도 19 조골 세포 분화 분석 -. 0 D에서 HA 조골 세포 분화 (A는 B) 및 알리자린 레드 S.으로 하이드 록시 아파타이트 (HA)에 대한 세포 화학적 염색에 의해 결정되는 유도 20 (D) (C, D) 후에 세포에서 대조되고 HA의 / 파란색, 회색, 그리고 거친 예금은 빨간색으로 염색된다. 위상차의 관측. 원래 배율 : 40X. 바 크기 :. 100 μm의 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 20
그림 20. 지방 세포의 분화 분석. cytoch에 의해 결정되는 유도의 0 D (A, B)에서, 14 D (C, D) 후 지방 세포 분화빨간색에서 오일 레드 O.와 emical 염색의 지질 소포 (큰 소포가 검은 색 / 빨간색 화살표로 표시됩니다, 작은 소포가 흰색 / 검은 색 화살표로 표시됩니다) 파란색 / 보라색에서, 핵 헤 마톡에 의해 대조. 시야에서 관찰. 원래 배율 : 40X. 바 크기 :. 100 μM 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 21
그림 21. CFU 분석. 톨루이딘 블루 염색 OSA-CSC 라인의 CFU 분석. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 22 />도 22 ALDH 활동 분석. ALDH 비색 분석법 검출 한정된 분화 된 세포 라인이 활성의 부재를 검출 분석 반면 두 OS-CSC 라인 OSA5-CSC 추가 및 OSA6-CSC 추가의 ALDH 활성의 높은 수준 섬유 아세포의, FIB. 오차 막대 : SD. ** : FIB 대 P <0.001; * :. FIB 대 P <0.01 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

2 "> CCCAGCTGTGTGTACTCAAT의 GGTTCAGGATGTTGGAGAGTT
유전자 올리고 뉴클레오티드 시퀀스 (5¹-3¹) 앰플 리콘 크기 (BP) Tₐ (° C)
NANOG 앞으로 프라이머 역방향 프라이머 87 (60)
10월 3/2 앞으로 프라이머 역방향 프라이머 GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 (60)
SOX2 앞으로 프라이머 역방향 프라이머 TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC (125) (55)
CD133 앞으로 프라이머 역방향 프라이머 CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC (127) (56)
BP, 앰플 리콘 크기의 염기 쌍, Tₐ, 어닐링온도

앰플 리콘 크기와 어닐링 온도와 Nanog를 10 월 3/4, Sox2이와 CD133을위한 프라이머 시퀀스 표 1. 상세 목록

Discussion

암줄 기세포는 종양의 대부분이 특정 세포 부분 집합의 식별을 허용하는 여러 속성이 있습니다. 이러한 표현식, ATP 결합 카세트 다제 유출 수송차 28, 32, 33, 또는 ALDH 32 해독 효소의 발현의 상향 조절을위한의 과발현을위한 화학 요법 제를 세포 독성 취득 된 저항 이러한 특성에 기초 된 CSC를 분리 예컨대 CD133, CD44, CD34, CD90, 및 기타 30, 34, 35, 41, 여러 가지의 방법으로서, 특정 표면 마커의 42-44를 개발되었다. 이러한 기술 중 하나는 비 - 부착 조건 하에서 성장 된 CSC의 용량에 기초한 구 형성 분석이다.

구체를 형성하는 조직 줄기 세포 및 CSC 추가의 능력은 제 레이놀즈 등. (37)에 의해 신경줄 기세포의 식별에 관한 연구에서 설명 하였다. 그 후, 깁스 등. (38) 우리를이러한 연구 에디션은 골 육종에서, 특히, 고형 종양에서 암줄 기세포를 분리 시작합니다. 우리는 깁스 등의 알에 도시 된 구 형성 분석 방법을 사용 할 수 있습니다. 기존의 OS 생검에서 얻은 OSA 세포주에서 암줄 기세포를 분리하기로 결정했습니다. 우리는 원래의 방법이 분석의 결과를 개선하기위한 다른 암세포에 대한 재현성을 용이하게하도록 적응. 구 형성 검정의 설립을 참조하여, 우리는 40,000 세포를 도금하는 것은 / 웰의 분석의 시작 부분에서 분리 세포를 유지하는 것이 좋다 것을 확인 하였다. 이 트릭은 구 식민지가 세포 응집하지 않은 부착 조건에서 성장하고 구형 콜로니를 형성하는 하나의 CSC의 특정 독점 용량에서 발생 가능성을 방지하는 것이 매우 중요합니다. 이 기능은이 분석의 특히 중요한 포인트입니다.

또한 구 형성의 양호한 비율을 구하는 것을 증명원래의 방법에 기재된 바와 같이 매일 성장 인자의 분취 량을 매 3 일 아닌 새로 고침하기에 충분하다. 본 연구에서는, 우리는 또한 설립 광범위하게 비 접착 조건에서 배양 할 때 형성되는 구형 콜로니를 분리하기위한 좋은 방법을 설명했다. 이 웰을 손상시키지 않고 각각 형성 가능한 분야의 많은을 분리하려고하는 것이 매우 중요하기 때문에이 단계는이 분석에서 중요하다. 단지 구체 아니라 분석 기간 동안 현탁액에 남아 있었던 단일 세포를 분리하는 것이 중요하다. 이 중요한 점을 극복하기 위해, 우리는 위의 그림과 같이, CSC 격리를위한 좋은 결과를 준, 특정 분리 방법을 개발했습니다. 분명히이 형성하는 모든 분야가 복구 될 수없는 가능성이 있지만, 손실 비율이 매우 낮다. 실제로, 우리는 그들이 결정 (커질 후 구를 분리하여 40 ㎛의 기공 필터를 사용할 수있을에드 약 100-200 세포).

이 격리 영역 형성을 정지하지만, 단 전지의 메틸 잔기의 일부가 가장 작은 구체를 여과 할 수있다. 프로토콜에 기재 한 바와 같이 제거는 철저한 여과에 의해 수행된다.

또한, 가장 작은 구형 콜로니 그에 따른 손실이 40 ㎛의 메쉬를 통해 큰 구형 콜로니의 선택은 하나의 구형 콜로니를 형성 할 수있는 높은 용량과 더 stemness로 된 CSC를 선택할 수 있습니다. 이러한 모든 수정은 분석 향상과 이해 ​​구 형성 검정의 원래있어서 가장 중요한 단계를 재현 된 CSC 공부 연구자 있도록 하였다.

분리 암줄 기세포에 대한 시험 관내 방법에 관한 연구 중 본 연구에서 암줄 기세포를 분리이 적응 구 형성 분석은 좋은 방법이 될 수있는 방법을 보여 목표OSA 세포주. 일본어 방법 및 상세한 분리 기술에 대한 적응은 효능 향상을 설명했다. 단시간에, CSC 추가의 상당수가 얻어 질 수 있고 여러 가지 실험에 사용 하였다. 따라서, 급속 OS-CSC 추가 특징 이중 스템 형 표현형을 연구하기 위해, 특히, 줄기 등의 표현형을 확인하는 것이 가능하다. 따라서,이 수정 된 분석은 암줄 기세포를 분리 및 생물학 연구를위한 좋은 방법이 될 수 있습니다. 미래에,이 방법은 추가로 적응도 희귀 고형 종양의 생검에 의해 얻어지는 다른 유한 암 세포주에서 암줄 기세포를 분리하는데 사용될 수있다.

이러한 OS 희귀 고형 종양에서 CSC 추가 분리 가능성뿐만 아니라, 특정 암에 대한 연구의 개선을 허용하지만, 또한 분리를위한 더 좋은 방법을 개발하는 암의 다양한 유형의 연구 및 생물학의 앞으로의 연구를 확장 이 중요한 세포의 부분 집합. 따라서, 우리와 같은본 연구에서 수행 한, 아마에 대한 책임이 특정 세포의 부분 집합에 관한 매우 구체적인 항암 치료, 분자 표적을 발견하고 개발의 최종 목표로, CSC 생물학의 연구를 통해 CSC 분리의 방법을 개선하는 것이 중요하다 주 종양의 유지 재발의 개발 및 여러 기관에서 전이의 기원. CSC 생물학의 연구는 항암 치료 후 생존율이 매우 가난한 유지하는 등의 OS와 같은 암의 치료에 예리한 될 수 치료법을 찾는 것이 중요합니다.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics