Establishment of Cancer Stem Cell Cultures de Human osteossarcoma convencional

Cancer Research
 

Summary

A presença de células-tronco cancerosas (CSCs) em sarcomas ósseos foi recentemente ligada à sua patogênese. Neste artigo, apresentamos o isolamento de CSCs de culturas de células primárias obtidas a partir de biópsias humanas de osteossarcoma convencional (OS) que utilizam a capacidade dos CSCs a crescer sob condições não aderentes.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

As melhorias atuais na terapia contra o osteossarcoma (OS) ter prolongado a vida de pacientes com câncer, mas a taxa de sobrevivência de cinco anos continua a ser pobre quando a metástase ocorreu. A teoria de haste do cancro celular (CSC) sustenta que há um subconjunto de células tumorais dentro do tumor que têm características tronco-semelhantes, incluindo a capacidade de manter o tumor e para resistir a múltiplos fármacos de quimioterapia. Portanto, uma melhor compreensão da biologia OS e patogénese é necessária, a fim de avançar no desenvolvimento de terapias específicas para erradicar este subconjunto particular e para reduzir a morbidade e mortalidade entre os pacientes. Isolando CSCs, estabelecendo culturas de células de CSCs, e estudar sua biologia são passos importantes para melhorar a nossa compreensão da biologia OS e patogênese. O estabelecimento de origem humana OS-CSCs a partir de biópsias de OS tem sido possível usando vários métodos, incluindo a capacidade de criar culturas de células estaminais em 3 dimensões sob nonadherecondições NT. Sob estas condições, os CSCs são capazes de criar colónias flutuantes esféricas formadas por células estaminais filhas; essas colônias são denominadas "esferas celulares". Aqui, descrevemos um método para estabelecer culturas CSC de culturas de células primárias de OS convencional obtidos a partir de biópsias OS. Nós descrever claramente as várias passagens necessários para isolar e caracterizar CSCs.

Introduction

Sarcomas são um grupo heterogêneo de tumores raros do tecido conjuntivo malignas de origem predominantemente a partir da mesoderme embrionária 1. Os diferentes tipos incluem sarcomas ósseos e sarcomas de tecidos moles. sarcomas ósseos, um grupo de tumores primários relativamente pouco frequentes, consistir em vários subtipos, incluindo osteossarcoma (OS). OS, um dos tumores primários mais comuns do tecido ósseo, é um tumor maligno mesenquimal que exibe extensa clínicos, histológicos e heterogeneidades moleculares 2, 3. Infelizmente, OS ocorre predominantemente em crianças e em adultos jovens 4, 5 e representa 60% do os subtipos histológicos comuns de sarcoma do osso na infância 6, 7. oS geralmente afecta as áreas do esqueleto, as quais são caracterizadas pelo crescimento ósseo rápido (por exemplo, a metáfise de ossos longos). Entre os histologicamente diferentes subtipos de OS, sistema operacional convencional, também chamado medular ou OS central, tem um alto grau de malignidade e uma quota share de 80% 8. Este 80% é composto de 60% OS convencional osteoblástica, 10% OS condroblástico, e 10% de SO fibroblástica 6, 8-10. Outros subtipos do sistema operacional incluem anaplásico, telangiectatic, rico em células gigantes e OS de pequenas células. Apesar dos avanços na cirurgia e quimioterapia na gestão OS combinados, o resultado permanece pobre, com uma taxa de sobrevivência a longo prazo de 65-70% em pacientes sem metástase 11, 12. Recorrências distantes ocorrem frequentemente como metástases pulmonares ou, menos frequentemente, como metástases aos ossos distantes e recidivas locais 13. As metástases são frequentemente resistentes aos tratamentos convencionais. Esta resistência é a razão pela qual a sobrevida livre de doença de 10 anos é de aproximadamente 30% em pacientes com doença metastática no momento do diagnóstico 14, 15.

Como com o tecido normal, tecido de cancro é composto de uma colecção heterogénea de tipos celulares. As células dentro do tumor parece corresponder a diferentes fases de desenvolvimento. Dentro de qualquer Normal tecido reside uma subpopulação de células com a capacidade de selfrenew, proporcionando assim progenitores e células maduras para a homeostase do tecido. Do mesmo modo, o cancro é composta por uma população heterogénea semelhante de células em diferentes fases de desenvolvimento, com diferentes graus de proliferação e potencial tumorigénico. Um subconjunto destas células de cancro, denominado cancro de células estaminais (CSCs), constitui um reservatório de selfsustaining células com a capacidade para selfrenew exclusiva e manter o potencial de malignidade de tumores, assim gerar as diferentes linhagens de células que constituem a maior parte do tumor 16. Na década de 1990, estudos sobre a leucemia mielóide aguda forneceu a primeira evidência convincente para a existência de CSC subpopulações 17, 18. CSCs já foram isolados a partir de um grande número de tumores sólidos 19, tornando-se um dos temas mais pesquisados na pesquisa do câncer. CSCs pode, de facto surgem a partir de células estaminais normais por mutações em genes que tornam a normaiscélulas cancerosas 20-23 haste. Múltiplas mutações transformando e interações com o microambiente também poderia contribuir para progenitores saudáveis ​​e células maduras que adquirem a capacidade selfrenewal e imortalidade que tipificam CSCs. Existem várias hipóteses sobre esta transformação. Progenitores saudáveis, células maduras saudáveis e células cancerosas, pode dedifferentiate às células-tronco, obtendo um fenótipo estaminais-como ativando genes associados à selfrenewal 24-28. Apesar de vários estudos recentes, as origens da CSCs têm ainda a ser descoberto.

Uma característica particular de CSCs é que a sua capacidade para resistir a aproximação multi-terapia, que consiste em cirurgia e quimioterapia combinadas com diferentes drogas. Estudos recentes têm mostrado que os CSCs também podem adquirir resistência a agentes citotóxicos quimioterapia. Possíveis explicações para essa resistência incluem a superexpressão de ATP vinculativo cassete (ABC) transportador de múltiplas drogas (isto é,MDR1 e BCRP1), a sobre-expressão de enzimas metabolizadoras de quimioterapia tais como aldeído desidrogenase 1 (ALDH1), e / ou alterações na cinética do ciclo celular 30-33. A consequência directa de todos os conceitos que têm sido descritos até aqui é que uma terapia de cancro seria eficiente apenas se a subpopulação CSC foram completamente eliminadas, enquanto que a recorrência local ou metástase distante poderia ocorrer se mesmo um único CSC sobreviveram.

A descoberta de CSCs em sarcomas humanos 34, particularmente OS 35, ou em quaisquer outros tipos de câncer ósseo e dos tecidos moles, tem grande importância clínica, pois oferece uma possível explicação de por que muitos tratamentos parecem ser eficazes no início, mas os pacientes depois recaída. Portanto, a esperança para o futuro batalha contra OS convencional é encontrar terapias direcionadas novos e específicos com base no desenvolvimento de medicamentos inovadores dirigidos a OS-CSCs graças à caracterização molecular deste subpopulação e para o estudo da biologia CSC.

Em 1992, Reynolds e colegas, que investigam se um subconjunto de células estaminais estava presente no cérebro de mamíferos adultos, desenvolveu um método para isolar células que se suspeita serem células 36, 37 da haste semelhante. Este método baseia-se na capacidade particular de estas células para formar colónias esféricas quando cultivadas sob condições não aderentes. Técnicas semelhantes foram empregadas por Gibbs e seus colegas em 2005 para estudar uma subpopulação de células-tronco, como em sarcomas ósseos 38. Para isolar e caracterizar OS-CSCs a partir de culturas de células primárias de diferentes tipos de OS convencional, decidimos adaptar esta técnica para linhas de células do sistema operacional.

Aqui, nós descrevemos este método adaptado do ensaio de formação de esferas, chamado "ensaio sarcosphere", que pode ser utilizado para isolar SO-CSCs a partir de linhas de células primárias derivadas finitos a partir de biópsias humanas de SO convencional. Descrevemos também todas as técnicas used para validar o fenótipo CSC-haste como as de linhas de células isoladas por este ensaio: 1) a avaliação da expressão de genes que caracterizam células estaminais embrionárias pluripotentes (CES) e do gene de CD133, que é um marcador de CSCs; 2) (CFU) ensaio de unidades formadoras de colónias; 3) Avaliação da capacidade destas células para se diferenciarem em osteoblastos e adipócitos sob condições de diferenciação adequados; 4) estudo dos marcadores de superfície de células-tronco mesenquimais (MSCs) (ie, CD44, CD105 e Stro-1) por imunofluorescência e por análise de citometria de fluxo; 5) Avaliação da actividade de ALDH destas células.

Protocol

Todos os experimentos usando tecidos humanos aqui descritos foi aprovado pelo comitê de ética local (Rif. N. 141/12). O consentimento informado para a recolha de amostras de tecido e para o uso e armazenamento das amostras foi obtido a partir dos doadores em AOUC.

1. Preparação para a Cultura

  1. Prepare meio de cultura de crescimento (GM) pela adição de 10% de Soro Fetal Bovino (FBS), 100 UI / ml de penicilina e 100 ug / ml de estreptomicina para meio F12 de Ham modificado de Coon. Filtra-se e esterilizar GM utilizando um filtro de 0,22 um. Loja GM até 1 mês a 4 ° C.
  2. Preparar o meio de colagenase (CM) pela adição de 20% de FBS, 100 UI / ml de penicilina, 100 ug / ml de estreptomicina e 3 mg / mL de colagenase tipo II para meio F12 de Ham modificado de Coon. Filtra-se e esterilizar cm, utilizando um filtro de 0,22 um. Loja CM até 1 mês à temperatura de -20 ° C.
  3. Preparar o meio de congelação de células (FM) por adição de 40% de FBS, 100 UI / ml de penicilina, 100 ug / ml de estreptomicina e 60,5% de dimetilsulfóxido (DMSO) ao meio F12 de Ham modificado de Coon. Filtra-se e esterilizar FM, utilizando um filtro de 0,22 um. Loja FM até 1 mês a 4 ° C.
  4. Preparar o meio para o ensaio de CFU (CFUM) pela adição de 20% de FBS, 100 UI / ml de penicilina e 100 ug / ml de estreptomicina para meio F12 de Ham modificado de Coon. Filtra-se e esterilizar CFUM usando um filtro de 0,22 um. Loja CFUM até 1 mês a 4 ° C.
  5. Prepare tripsina por dissolução de 400 mg de tripsina, 200 mg de EDTA e 1,000 mg de D (+) - glucose anidra em 1000 ml de Dulbecco tamponada com fosfato salino (DPBS) sem Ca 2+ e Mg 2+.
    NOTA: Dividir fresco tripsina-EDTA em 50 ml de aliquotas em frascos de 25 centímetros 2 utilizando um filtro de 0,22 um e congelamento a -20 ° C durante até 3 meses. Loja descongeladas aliquotas, esterilizadas por filtração a 4 ° C sem perda de actividade.
  6. Preparar o meio de crescimento de células estaminais (SCGM) pela adição de 10% de FBS, 100 UI / ml de penicilina, 100 ug / ml streptomycin, e 10 ng / ml de bFGF (25 ng / ml de stock) para meio F12 de Ham modificado de Coon. Filtrar SCGM usando um filtro de 0,22? M e armazenamento SCGM até 2 semanas a 4 ° C.
  7. Preparar 2% de metilcelulose (MC) por dissolução em MC ultrapura H 2 O a 4 ° C durante 3 d. Quando MC está completamente dissolvido, que autoclave e armazenar a 4 ° C.
    NOTA: Depois de MC é esterilizado, torna-se sólida. Para trazer o MC para um estado líquido, armazenar a 4 ° C.
  8. Prepare meio de crescimento sarcosphere (SGM). Preparar este meio fresco (não mais de 2 semanas antes de usar) pela adição de 100 UI / ml de penicilina, 100 ug / ml de bFGF (25 ng / ml de stock) humana, 20 nM de progesterona (10 uM estoque), 100 uM putrescina, 30 nM selenito de sódio (30 uM estoque), 25 ug / ml de transferrina (25 mg / ml), 20 ug / ml de insulina (20 mg / ml), e 10 ng / EGF humano mL (10 ug / ml de stock) para 2X Coon do modificado meio F12 de Ham. Filtra-se e esterilizar SGM usando um fil 0,22ter. Armazenar por até 2 semanas a 4 ° C.
  9. Preparar o meio osteogénico (OM) pela adição de 10% de FBS (origem sul-americana), 100 UI / ml de penicilina, 100 ug / ml de estreptomicina, 10 nM de dexametasona (100 uM estoque), de sódio L-ascorbil-2-fosfato a 0,2 mM (1 da M), 10 mM de glicerof osf ato-β (5 mg / ml) e 1 ug / ml de calceina (200 ug / ml de stock) para meio F12 de Ham modificado de Coon. Filtra-se e esterilizar OM usando um filtro de 0,22 um. Armazenar a 4 ° C.
    NOTA: Loja soluções de dexametasona sob nitrogênio líquido para manter a sua actividade. Prepare OM fresco a cada 2 semanas para manter a actividade da dexametasona, a fim de manter o potencial de diferenciação do meio.
  10. Preparar tampão de lise de eritrócitos (ELB) por dissolução de 1,66 mg de NH 4 Cl, 0,2 mg de K 2 HPO 4 e 0,007 mg de EDTA em 200 ml de água destilada (dH2O). Filtra-se e esterilizar ELB usando um filtro de 0,22 um. Armazenar a 4 °C.
  11. Prepare forma adipogênica (AM) pela adição de 10% de FBS (origem América do Sul), 100 UI / ml de penicilina, 100 ug / ml de estreptomicina, 1 uM de dexametasona (estoque 1 mM), 1? M de insulina bovina (10 mM), 0,5 mM isobutilmetilxantina (IBMX) (estoque 500 mM), e 100 ^ M indometacina (200 mM) ao meio F12 de Ham modificado de Coon. Filtra-se e esterilizar AM utilizando um filtro de 0,22 um. Armazenar a 4 ° C.
    NOTA: Loja soluções de dexametasona sob nitrogênio líquido para manter a sua actividade. Preparar fresco AM a cada 2 semanas para manter a actividade da dexametasona, a fim de manter o potencial de diferenciação do meio.
  12. Preparar 2% Albumina de Soro Bovino (BSA) em DPBS (BSA / DPBS). Dissolve-se 10 g de BSA em 500 mL de DPBS e preparar a solução stock aliquotting 50 ml de solução de estoque em tubos de 50 mL cónicos. Armazenar a -20 ° C.
  13. Prepara-se uma solução de paraformaldeído a 4% (PFA) em DPBS (PFA / DPBS). Em um chhood emical, diluir paraformaldeído em DPBS e preparar a solução stock aliquotting 50 ml de solução em 50 ml tubos cônicos. Armazenar a 4 ° C.

2. Estabelecer culturas de células primárias OS e OS linhas celulares finitos (OSA)

NOTA: culturas de células do sistema operacional primário foram preparadas a partir de amostras frescas de biópsias OS convencionais recolhidos no "Unità Ortopedia Oncologica e Ricostruttiva", AOUC Careggi, Florença. Todas as biópsias, que foram obtidos por aspiração com agulha ou ressecção cirúrgica de uma pequena porção do tumor (Figura 1A, B), foram imediatamente colocadas em meio de cultura suplementado com 100 UI / ml de penicilina e 100 ug / ml de estreptomicina (pH 7,4) e transportados para o laboratório em que foram processados. Todas as manipulações descritas foram realizadas sob condições assépticas, usando uma câmara de fluxo laminar.

  1. Isolamento de células OS
    1. Coloque a biópsia numa100 milímetros placa de Petri com um pequeno volume de GM. Com uma lanceta esterilizada e pinças Perry, mediu as amostras de tecido OS cortando-as em pedaços tão pequenos quanto possível (0,5-1 mm) (Figura 2A, B).
    2. Cobrir os fragmentos de tecido com 10 ml de CM para a digestão enzimática (Figura 2B) e incubar durante 3 h num banho a 37 ° C, 5% de CO2. Suavemente remover a suspensão de fragmentos usando uma pipeta e transferi-lo para um tubo cónico de 15 ml para centrifugação imediata (400 xg durante 5 min) para sedimentar os fragmentos.
      NOTA: Após a centrifugação, se as biópsias são ricos em eritrócitos, um depósito vermelho composta de eritrócitos pode ser visto ao longo dos fragmentos. Portanto, antes de prosseguir para a dispersão mecânica, tratar a amostra com tampão de lise de eritrócitos. Descartar o sobrenadante por aspiração e adicionar 5 ml ELB.
    3. Suspender fragmentos pelotas durante 1 min e centrifuga-se a suspensão a 400 xg durante 2min. Remover o sobrenadante por aspiração. Adicionar 5 ml GM e mecanicamente dispersar os fragmentos usando uma pipeta de 10 ml sorológico (tamanho da abertura, 1,5 mm de diâmetro interno) 10 - 20 vezes.
    4. Centrifugar a suspensão a 400 xg durante 5 min. Remover o sobrenadante por aspiração, suspender o sedimento de células com 10 mL de GM, e depois transferir a suspensão de células resultante em uma placa de Petri de 100 milímetros. Incubar a placa de Petri num banho a 37 ° C, incubador de CO2 a 5% e substituir a GM com GM fresco completo a cada 3 d.
      NOTA: Muitas vezes, amostras de tecido obtidas SO por aspiração com agulha são muito pequenas e contêm fragmentos de osso, que não são digeridos por digestão enzimática com colagenase. Portanto, depois o sobrenadante foi removido, a tentativa para separar as células de tecido ósseo por triturar fragmentos pelota com uma pipeta.
  2. Subcultura
    NOTA:
    Para estabelecer um OSA, quando as células atingem confluência aproximada, removê-los do theirecipiente de cultura r, diluir, e coloque em um prato fresco para permitir um maior crescimento. Este procedimento subcultura é atingido utilizando o processo enzimático denominado tripsinização.
    1. Remover o meio por aspiração. Para dissociar a monocamada de células, adicionar 2-3 mL de tripsina à TA (max 18 - 20 ° C), agite suavemente uma vez, e de remover a tripsina imediatamente por aspiração. Repita duas vezes. Incubar as células a 37 ° C durante 3-4 minutos até se começar a separar.
      NOTA: Bom tripsinização pode ser visto pelo utilizador experiente como pequenos orifícios que se formam em monocamada ligeiramente opaca quando o prato é realizada à luz. Esta dissociação pode também ser monitorada utilizando um microscópio invertido; Essa abordagem é recomendada para iniciantes.
    2. Parar a reacção por adição de tripsina 10 mL de GM e lavar bem o prato usando uma pipeta para retirar todas as células. Transferir 1 ml da suspensão para um novo 100 milímetros placa de Petri e adicionar 9 ml de GM (1/10 divisão das células).
      NOTA:
  3. Criopreservação de culturas primárias OS e OSA
    NOTA: Congelar uma confluentes 100 milímetros placa de Petri para 4-5 cryovials. O processo de criopreservação deve ser realizada rapidamente, porque DMSO, que protege as membranas celulares durante o congelamento, é tóxico para as células a temperaturas não-congelamento.
    1. Separar as culturas de células da monocamada por tripsinização (ver Secção 2.2), células de pelotas por centrifugação a 400 xg durante 5 min, remove-se o sobrenadante por aspiração, e, em seguida, rapidamente suspender o sedimento celular em FM.
    2. Aliquota de 1 ml desta suspensão por frasco criogénico. Imediatamente coloque os frascos cheios em uma caixa freezer com uma jaqueta de 2-propanol e armazenar Immediadiatamente a -80 ° CO / N. Transferência criotubos em azoto líquido no dia seguinte para armazenamento a longo prazo.
  4. Linhas celulares de degelo OS e culturas primárias
    1. linhas celulares de degelo OS a partir de armazenamento de nitrogênio líquido, cryovials descongelamento rapidamente, colocando-os em um banho de água de laboratório a 37 ° C. Transferir o conteúdo dos criotubos em um tubo de 15 ml e adicionar cerca de 10 ml de GM (ver secção 2.3 para remover DMSO). Remover o sobrenadante por aspiração e suspender o sedimento celular em 10 mL de GM. Placa da suspensão de células numa placa de 100 milímetros de Petri e incubar num banho a 37 ° C, 5% de CO2.

3. Sarcosphere Ensaio para isolar OS-CSCs

NOTA: Esta experiência é realizada em OSA. A duração desta experiência está relacionada com a capacidade das células para formar estas colónias esfera (sarcospheres), e o intervalo de tempo é de 7, 14, 21, e 28 d.

  1. Estabbelecimento de ensaio sarcosphere
    1. Preparar a câmara hemocitómetro e todos os reagentes de antecedência.
    2. Remover o meio por aspiração e dissociar as células da monocamada por tripsinização (ver Secção 2.2). Misture a suspensão de células completamente, pipetagem para dispersar qualquer aglomerados, e recolher 10 mL utilizando uma ponta de pipeta de 20 mL.
    3. Transferir a suspensão de célula de 10 ul imediatamente à borda câmara de hemocitómetro, expelir a suspensão, e permitir que ele seja desenhada sob a lamela por acção capilar.
    4. Observe a câmara de hemocitómetro sob contraste de fase. Selecione um objetivo 10X e focar as linhas de grade na câmara. Contar as células que encontram-se nesta área um milímetro 2 utilizando as subdivisões (também ligada por três linhas paralelas) e linhas de grade individuais como uma ajuda para a contagem.
    5. Medir a concentração e aplica a seguinte equação: n = 1 ml * 10 4 / z (n: O número total de células contadas, em todo oquadrados 1 mm 2; z: o número de quadrados contados 1 mm 2). Calcular o volume da suspensão de células necessário para a chapa uma quantidade total de 240.000 células dividido em 40.000 células para cada poço na placa de 6 poços de ultra-baixo de fixação.
      NOTA: Certifique-se de placa o número correto de células por plaqueamento de células para um poço extra. Por conseguinte, a quantidade total de células a ser revestida é de 280.000 células.
    6. Preparar 35 ml de MBP pela adição de 50% de 2% MC (MC-MBP) em um balão de 2 25 centímetros. Prepara-se o volume total de 5 ml SGM considerando extra no fim de uma chapa bem extra.
    7. Adicionar o volume calculado da suspensão de células para a MBP-MC preparado no frasco e misturar suavemente, utilizando uma pipeta para dispersar quaisquer aglomerados. Placa as células em uma placa de 6 poços de ultra-baixo de fixação e usar um microscópio invertido para observar como as células aparecem depois de serem plaqueadas.
    8. Incubar as células em uma temperatura de 37 ° C, 5% de CO2. Cada 3 d, adicione frESH alíquotas de bFGF e EGF a cada poço para actualizar a concentração dos factores de crescimento. Adicionar 2 mL de bFGF e 5 mL de EGF para manter tanto na concentração final de 10 ng / ml em cada poço.
  2. Isolamento de sarcospheres
    NOTA: Monitorar o bom andamento do ensaio sarcosphere aos 7, 14, 21 e 28 d para decidir quando é necessário para isolar os sarcospheres que se formaram.
    1. Preparar todos os reagentes e equipamentos na câmara de fluxo laminar (Figura 3A, B). Montar o aparelho de filtração por colocação de um filtro de rede de 25 mm de diâmetro e uma malha de 40 um para um suporte de filtro de membrana; esterilizar em autoclave (Figura 4A-E).
    2. Para cada poço, transferir o meio contendo as sarcospheres para uma seringa com um suporte de filtro de membrana estéril usando uma pipeta esterilizada com uma ponta de 1000 mL. Depois de remover completamente o meio contendo as sarcospheres, lava-se a bem por suplementoing 5 ml GM para ter a certeza de transferir todas as esferas a uma seringa. Use o microscópio para confirmar se todos os sarcospheres foram recuperados. Se não, continue repetindo este passo.
    3. Filtra-se a suspensão com um filtro de membrana de suporte apenas por gravidade, sem pressão, a fim de evitar danificar as esferas e para evitar ter sarcospheres atravessam através do filtro, evitando assim a perda de esferas. Remover bolhas de ar delicadamente com uma pipeta Pasteur de vidro estéril.
      NOTA: Por vezes, a filtração é bloqueado pela presença de uma bolha de ar no suporte do filtro de membrana.
    4. Lave a unidade de filtração por adição de 10 ml GM para a seringa e deixá-lo filtrar sem pressão para ter a certeza de eliminar as células individuais. Desmontar a unidade de filtro da seringa e colocá-lo em uma placa de Petri.
    5. Retire o filtro de rede do porta-filtro de membrana, usando uma pinça Perry e lavá-lo, agitando-o suavemente com a pinça de 60 milímetrosPlaca de Petri para libertar os sarcospheres do emaranhado da membrana. Em seguida, colocar a membrana em um poço e confirmar por observação microscópica que não existem mais esferas emaranhados na membrana. Se esferas ainda estão emaranhados na membrana, prossiga com outra lavagem conforme descrito no passo 3.2.4.
    6. Observe as sarcospheres liberado usando um microscópio. Incubar as sarcospheres libertados num banho a 37 ° C, 5% de CO2. Repetir todas as medidas para cada poço de uma placa de 6 poços de ultra-baixo de fixação.

Linhas 4. OS-CSC

NOTA: SO-CSCs são obtidos a partir dos sarcospheres que exibem expansão aderente e reintroduzindo reculturing essas células numa monocamada após serem semeadas em pequenos pratos de Petri 60 milímetros não mais sob condições ultra-baixas de fixação.

  1. Culturas OS-CSC
    1. Para permitir ainda mais o crescimento, as células de subcultura quando atingirem aproximadamente 90% de confluência em 60prato mm Petri. Repita o passo 2.2.1 para estabelecer culturas OS-CSC.
    2. Parar tripsinização adicionando 4 ml SCGM e lavar bem o prato, usando uma pipeta para retirar todas as células. Transferir a suspensão de células para uma nova placa de Petri de 100 milímetros e adicionar 6 mL SCGM. Quando OS-CSCs chegar a 90% de confluência, subcultura, repetindo secção 2.2.
      NOTA: Para a análise in vitro para caracterizar o fenótipo de células estaminais do tipo de isolado SO-CSCs, as células podem ser colocadas em diferentes tipos de placas.
    3. Preservar as estabelecidas linhas OS-CSC por criopreservação (repetir todos os passos da secção 2.3). Descongele o criopreservados OS-CSCs, repetindo todos os passos da secção 2.4.

5. In vitro A nálise Caracterizar OS-CSCs:

  1. Preparação das células para imunofluorescência
    NOTA: As células são fixadas em paraformaldeído, quando alcançam o grau de confluência direita em cada poço de uma pla de 24 cavidadeste. O grau de confluência está relacionada com o tipo de experiências.
    1. Placa SO-CSCs em uma placa de 24 poços para estudar as Células Estaminais (CME) marcadores de superfície mesenquimais por imunofluorescência. Fixar as células em cada poço quando atingem 50-60% de confluência. Remover o SCGM por aspiração e lavar duas vezes em uma placa de 24 poços de DPBS.
    2. Dentro de uma câmara química, adicionar 500 mL de 4% PFA / DPBS a cada poço. Incubar à temperatura ambiente durante 10 min. Remover o PFA / DPBS e lavar 3x com ultrapura dH2O Permitir que a placa de 24 poços para secar na hotte.
  2. Imunofluorescência para marcadores MSC
    NOTA: imunofluorescência da OS-CSCs fixado em 4% PFA / DPBS pode ser usado para investigar o fenótipo MSC-like de SO-CSCs utilizando anticorpos dirigidos contra CD44, Stro-1 e CD105. O método que se segue é utilizado rotineiramente pelos autores.
    1. Num capuz química, permeabilizar as células que foram fixadas em 4% PFA / DPBS por adição de 500 uL de 0,2% De Triton X-100 / DPBS a cada poço. Incubar as células a 37 ° C durante 30 min. Delicadamente, lave as células 3x com DPBS. Adicionar 300 uL de RNase diluída 1/1000 com 2% de BSA / DPBS para as células e incuba-se a 37 ° C durante 30 min.
    2. Lavar suavemente as células 3x com 2% de BSA / DPBS. Corar as células para marcadores MSC. Adicionar o anticorpo primário apenas para os poços escolhidos como controlos positivos para cada um dos anticorpos.
      1. Adicionar 300 uL de anti-CD105 diluída 1/10 com 2% de BSA / DPBS, 300 uL de anti-CD44 diluído 1/10 com 2% de BSA / DPBS, 300 uL de anti-Stro-1 diluída 1/10 com 2% de BSA / DPBS e apenas 200 ul de 2% BSA / DPBS para os poços escolhidos como controlos negativos para cada anticorpo.
      2. Incubar as células em um ambiente húmido a 4 ° CO / N. Lavar os poços 3x com DPBS e depois duas vezes com 2% de BSA / DPBS.
    3. Revelam anticorpos primários através da adição de anticorpos secundários específicos.
      1. Adicionar 300 uL de IgG anti-coelho (de burro anti-IgG de coelho [H + L]) diluído a 1/100com BSA a 2% / DPBS a cada poço escolhido como controle positivo e negativo para CD44 e CD105. Adicionar 300 uL de FITC Ig anti-ratinho (FITC-coelho de ratinho anti-IgG [H + L]) diluído a 1/100 com 2% de BSA / DPBS a cada poço escolhido como controlo positivo e negativo para Stro-1. Incubar as células no escuro a temperatura ambiente durante 60 min. Lavar os poços 6x com DPBS.
    4. Stain MSC células marcador positivas para actina do citoesqueleto, adicionando 300 mL phalloidin diluído a 1/100 com BSA a 2% / DPBS a cada poço coradas para MSC marcador de imunofluorescência.
    5. Incubam-se as células durante 40 min à TA. Lavar os poços 3x com DPBS e depois lavá-los duas vezes com ultrapura dH 2 O. Avance para a contracoloração dos núcleos após a imunofluorescência descrito acima. Preparar a solução de iodeto de propídio 10 -5 M em DPBS (estoque de 1,5 x 10 -3 M) numa hotte.
      1. Adicionar 200 uL solução de iodeto de propídio a cada poço de cor tal como descrito acima. Incubar a células para 2-3 min a RT. Lavar as cavidades duas vezes com dH2O ultrapura
        NOTA: repetir todos os passos de secções 5.1 - 5.2 na HCT8 linha celular, uma linha contínua diferenciada primária de células do cancro do cólon, que é usado como um controlo negativo.
  3. Ensaio de diferenciação osteogênica
    NOTA:
    Osteogénica diferenciação tem a duração de 20 d.
    1. Placa SO-CSCs em placas de 24 poços a uma densidade celular de 1 x 10 4 células / cm2 em SCCGM. Permitir que as células a crescer em SCGM até atingirem 80-90% de confluência em cada poço.
    2. Comece diferenciação osteogênica, alterando o SCGM a OM. Permitir que as células a crescer em meio de OM e refrescar a cada 3-4 d. Pare o ensaio de diferenciação osteogénica em 10 d para avaliar a presença de fosfatase alcalina (ALP).
    3. células em 4% PFA / DPBS Fix (ver secção 5.1). Avaliar o fenótipo osteoblástico por coloração citoquímica para ALP e para HAutilizando Vermelho de Alizarina S coloração.
    4. Coloração citoquímica ALP
      Nota: Preparar a mistura de corantes numa hote química imediatamente antes de iniciar a coloração.
      1. Dissolve-se 40 mg de azul rápido BB ou sal rápida Vermelho Violeta LB em 50 ml de Tris-HCl, pH 9 (solução A). Dissolve-se 5 mg de naftol-AS-MX fosfato de sal de sódio em 1 ml de DMSO (solução B). Adicionar solução B inteiramente a solução A e misture bem, a obtenção de células Solução C. Lavar duas vezes com DPBS.
      2. - Adicionar 500 ul de 1 ml de solução C a cada poço e incubar a 37 ° C e 5% de CO 2. Monitorizar o curso de coloração a cada 10 minutos por meio da observação das células ao microscópio.
      3. Pare a coloração quando as células ALP-positivos tornam-se intensamente coloridos (azul com o sal Rápido Azul BB ou vermelho com sal LB Rápido Vermelho Violeta), que geralmente ocorre dentro de 30 min. Lavam-se as células 3x com dH 2 O ultrapura para remover todos os resíduos da solução de C. Se um precipitado do i manchas presente, lavar as células rapidamente uma vez com etanol absoluto.
      4. Avance para o contracoloração dos núcleos após a coloração ALP tal como descrito nos passos 5.2.5 e 5.2.5.1.
    5. Vermelho de alizarina S coloração citoquímica
      Nota: Preparar a mistura de corante antes de iniciar o experimento.
      1. Prepara-se o 2% Vermelho de Alizarina S (2 g Vermelho de Alizarina S em 100 mL de H2O ultra pura). Adicionar 2,5% de NH 3 a 2% Vermelho de Alizarina S para atingir pH 6,0. Armazenar a Solução de Vermelho de Alizarina S 2% a 4 ° C. Lavar as células uma vez com DPBS.
      2. Adicionar Vermelho de Alizarina S às células durante apenas alguns segundos.
      3. Lavar os poços com dH 2 O ultrapura para controlar o grau de coloração; se os depósitos de HA não são intensamente colorido, repita o passo 5.3.5.2. Pare a coloração quando os depósitos HA-se intensamente de cor vermelha, o que normalmente ocorre dentro de alguns minutos. Lavar os poços com ultrapura dH2O
    6. diferenciação adipogênica
      NOTA: Ensaio duração depende das linhas SO-CSC. O ensaio pode durar 14-30 d.
      1. Placa SO-CSCs em placas de 24 poços a uma densidade celular de 1 x 10 4 células / cm2 em SCGM. Permitir que as células a crescer em SCGM até atingirem 80-90% de confluência em cada poço. Iniciado diferenciação adipogênica mudando a SCGM para AM. Permitir que as células a crescer em AM e AM actualizar a duas vezes por semana.
      2. Pare o ensaio de diferenciação adipogênica quando vesículas lipídicas são visíveis. Avaliar o fenótipo adipogênica por Oil Red O coloração e pela hematoxilina contracoloração para núcleos.
      3. Hematoxilina de contraste para núcleos
        Nota: Preparar a mistura de corante antes de iniciar o experimento.
        1. Prepare a solução de hematoxilina de 5%, chamada Emallume Carazzi 39. Guardar a solução a 4 ° C. Adicionar Emallume Carazzi por apenas 2 min. Lave os poços com ultrapure dH2O
    7. ensaio CFU
      NOTA: Esta experiência deve ser realizada em triplicado.
      1. Placa SO-CSCs em placas de Petri de 100 mm a uma densidade celular de 450 células / cm2 em CFUM. Incubam-se as células num banho a 37 ° C, 5% de CO2 durante 4 semanas. Atualizar CFUM duas vezes por semana.
      2. Manchar o UFC com azul de toluidina. Contar as colónias de cor usando um microscópio invertido. Calcular a eficiência CFU de acordo com a seguinte fórmula: (número de colónias formadas / número de células semeadas) * 100.
    8. Análise da atividade ALDH
      NOTA: ALDH actividade foi avaliada usando uma ALDH Actividade Colorimetric Assay Kit nas duas linhas SO-CSC e sobre uma linha de fibroblastos finita, o qual foi utilizado como um controlo negativo. Este kit quantifica a actividade enzimática da ALDH por leitura da absorvância a 450 nm. Todos os testes foram realizados em triplicado.
      1. Dissociar culturas de células da camada simples por tripsinização (ver Secção 2.2). Peletizar as células por centrifugação a 400 xg durante 5 min. Seguir o protocolo do fabricante.
    9. Análise citométrica de fluxo:
      NOTA: são necessárias suspensões de células individuais para a coloração ideal de amostras para citometria de fluxo. Uma única suspensão de células deve ser preparada para cada anticorpo a ser testado. Dissociar culturas de células da camada simples por tripsinização (ver Secção 2.2).
      1. Colocar a suspensão celular num tubo de cónico, executar uma contagem de células utilizando o Burker câmara de contagem, as células de centrifugação a 400 xg e ressuspender em um volume apropriado de tampão de separação para se obter uma suspensão de células a uma concentração celular final de 1 x 10 5 células / ml.
      2. Centrifugar a suspensão de células durante 5 min a 4 ° C. Descartar o sobrenadante e lavar o sedimento com tampão de separação. Repita esta etapa duas vezes.
      3. células mancha para MSMarcadores C (isto é, CD44, CD105 e Stro-1) 40.
      4. Analise suspensões de células coradas positivamente num citómetro de fluxo. Analisar as amostras marcadas dentro de 1 d. Incubar as amostras a 4 ° C até à análise.
    10. RT-PCR
      1. A extracção e o isolamento de ARN
        1. Adicionar 1 ml de reagente de lise às amostras embalados congelados celulares de SO-CSCs e lisar as células directamente no tubo o sedimento por pipetagem para cima e para baixo várias vezes.
        2. Centrifugar as amostras a 12.000 xg durante 1 min a 4 ° C. Remova cuidadosamente o sobrenadante. Transferir o sobrenadante para um novo tubo, adicionar 200 mL de clorofórmio, e a tampa do tubo de forma segura. Agitar o tubo vigorosamente durante 15 segundos e incuba-se a amostra durante 5 min à TA.
        3. Centrifugar as amostras a 12.000 xg durante 15 min a 4 ° C. A mistura separa-se em três fases diferentes. O ARN é exclusivamente na fase aquosa superior incolor.
        4. sendo particularly cuidado, remover apenas a fase aquosa e transferir esta fase para um novo tubo para prosseguir com o isolamento de ARN. Adicionar 500 mL de isopropanol ao tubo contendo a fase aquosa. Agite suavemente o tubo com a mão. Incubar a amostra à temperatura ambiente durante 10 min. Centrifugar a amostra a 12.000 xg durante 10 min a 4 ° C.
          NOTA: Após a amostra é centrifugada, é possível ver o ARN, que forma um sedimento tipo gel, no lado e no fundo do tubo.
        5. Retirar o sobrenadante do tubo, tendo o cuidado de deixar o sedimento do RNA na parte inferior. Adicionar 1 ml de etanol a 75% ao tubo. Vortex o tubo à mão durante alguns segundos e depois centrifugar o tubo a 7500 xg durante 5 min a 4 ° C.
        6. Descartar o etanol e secar o sedimento de ARN. Quando o sedimento é seco, ressuspender o sedimento de ARN em-ARNase isento de água (10 - 50 mL), pipetando a solução para cima e para baixo várias vezes.
        7. Determinar o rendimento e a pureza do RNA por measurante a absorvância a 260 nm e 280 nm utilizando um espectrofotómetro. Avaliar a integridade do ARN total sobre gel de agarose a 1% padrão. Armazenar o ARN a -80 ° C.
      2. Reação em cadeia da polimerase inversa
        1. Sintetizar ADNc de primeira cadeia a partir de 500 ng de ARN de amostras utilizando um kit de transcrição reversa. Descongelar as amostras de RNA em gelo e descongelar as soluções necessárias incluídos no kit à TA. Avance para sintetizar cDNAs seguindo o protocolo do fabricante.
      3. Semi-quantitativa da reacção da cadeia de polimerase-transcriptase reversa (RT-PCR)
        1. Executar todas as PCRs utilizando 1 mL de cDNA para cada amostra como um molde num volume de reacção final de 24 ul. Use as sequências dos iniciadores listados na Tabela 1 para a amplificação de Nanog, Out 3/4, SOX2 genes e CD133.
        2. Separa-se os produtos de RT-PCR por electroforese em gel de agarose a 1,8% e mancha com brometo de etídio. Fotografia sob illum UVinação.

Representative Results

OS amostras obtidas por aspiração com agulha ou ressecção cirúrgica de uma pequena porção do tumor (Figura 1A, B) permitir o isolamento de apenas um OSA, se tratados com precisão, tal como descrito na secção de protocolo (Figura 2A, B). Infelizmente, o número de células isoladas a partir de biópsias é baixo, com um intervalo de 30 saída de - 50%. A saída depende do tipo e da dimensão das biópsias (Figura 5A, B). Estas células devem ser tratadas de forma precisa. Por conseguinte, de aproximadamente um mês é necessário para as culturas primárias para atingir confluência numa placa de Petri de 100 milímetros. Após este tempo, OSA são obtidos a partir de duas amostras marcadas OS OSA5 e OSA6 (Figura 6A, B). Em seguida, é necessário subcultura da linha de células primária para obter um número adequado de células para realizar a análise e caracterização a criopreservação de células do lines. Na passagem 3 rd de subcultura, quando ambas as linhas celulares primárias OSA atingem a confluência, elas são plaqueadas em placas de 6 poços ultra-baixas de fixação para o ensaio sarcosphere. Este tipo de placa é usado porque ele permite-nos manter as células num estado suspenso, para impedir que as células-tronco de diferenciação mediada por fixação, para impedir que as células dependentes de ancoragem de se dividir e, por fim, para reduzir a ligação ao substrato. Assim, a sua utilização nos permite criar uma condição stressante para as células cancerígenas, que é necessário para a selecção das CSCs. Em 24 horas após o início do ensaio, as células aparecem isolados um do outro (Figura 7). Após 7 d de monitorização da progressão do ensaio, as pequenas colónias esféricas começaram a formar e são visíveis (Figura 8). Aos 28 anos d, várias colónias esféricas grandes que se formaram em cada poço pode ser observado (Figura 9A, B). Após as sarcospheres Have foram cultivadas durante 28 d, estes grandes colónias esféricas pode ser isolada. A Figura 10 mostra os passos para isolar sarcospheres partir de 6-se placas ultra-baixas de fixação e reculturing-los sob condições aderentes. A Figura 11 mostra as colónias esféricas flutuantes após o isolamento. As grandes colónias esféricas plaqueadas em placas de fixação normais apresentam expansão aderentes após isolamento (Figura 12A, B). As células que se expandem a partir do único sarcospheres são, provavelmente, as células cancerosas com um fenótipo celular como caule. Assim, após o isolamento, OS-CSCs foram provavelmente obtidos. Estas células são nomeados OSA5-CSCs e OSA6-CSCs (Figura 13A, B).

Neste ponto, é necessário proceder à caracterização do fenótipo de células-tronco como para as duas linhas de SO-CSC obtidos, como descrito acima. As análises para a caracterização do fenótipo wer Stem Cell-likee realizada no dia 4 de passagem da subcultura após os sarcospheres para cada linha de OS-CSC foram isolados. As duas linhas celulares, OSA5-CSCs e OSA6-CSCs, mostraram forte positividade para os marcadores de superfície MSC (CD105 e CD44) (Figura 14A, B e A Figura 15A, B), ao passo que mostrou positividade moderada para o marcador de superfície MSC Stro- 1 (Figura 16A, B). As nossas observações foram confirmadas pelos resultados negativos obtidos com a linha comercial e diferenciada de células de cancro do cólon HCT8 (Figura 14C, Figura 15C, Figura 16C). Observou-se uma total ausência de coloração específica e não específica por estes marcadores de superfície na linha celular HCT8.

Para avaliar o fenótipo MSC dos dois SO-CSCs, nós também análises de citometria de fluxo realizada. Ambas as linhas OS-CSC expressa altos níveis de CD44 e CD105. No entanto, de as células em ambas as linhas celulares, apenas a 1,14%, expresso Stro-1. Portanto, este resultado confirmou a presença de moderada Stro-1, como demonstrado por coloração por imunofluorescência. Em contraste, 99,62% do OSA5-CSCs expressa CD44 e 87,38% destas células expressaram CD105; 99,88% do OSA6-CSCs expressa CD44 e 95,79% destas células expressa CD105. Além disso, ambas as linhas celulares são CD45-.

Nós avaliamos a expressão de 3 marcadores ESC (NANOG, Oct 3/4, Sox2) e do gene CD133, outro marcador CSCs, por RT-PCR. Percebemos que todos esses genes foram expressos em ambas as linhas OS-CSC (Figura 17). Os ensaios de diferenciação e adipogênicas osteogênicos mostrou a capacidade de ambas isolado linhas OSA-CSC se diferenciar em osteoblastos (Figura 18A - D e Figura 19A - D) e em adipócitos (Figura 20A - D).

Além disso, a uma CFU ssay (Figura 21) mostrou uma boa taxa de eficiência clonogênica, com 13% de OSA5-CSCs e 14% para OSA6-CSC. Vários estudos recentes têm demonstrado que níveis elevados de actividade de ALDH são característicos de vários tipos de cancro. Este parâmetro pode ser usado como um marcador de células estaminais do cancro e está correlacionada com um mau prognóstico. O ensaio de actividade de ALDH mostraram que ambas as linhas SO-CSC têm níveis elevados de actividade de ALDH (Figura 22), enquanto que a actividade de ALDH foi observada no limite inferior quantificável na linha de fibroblasto que foi utilizado como um controlo negativo neste ensaio.

figura 1
Figura 1. Exemplos de amostras de biópsia SO. (A). amostra de biópsia obtido por aspiração com agulha. (B). amostra de biópsia obtido por ressecção cirúrgica de uma parte do tumor.884 / 53884fig1large.jpg "target =" _ blank "> Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. mecânica desagregação de uma amostra OS. (A) Fragmentação de uma amostra usando uma pinça Perry e uma lanceta. (B) Fragmentos suspensos no CM (indicado pela seta). Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. O equipamento e consumíveis necessários para isolar Sarcospheres. (A). Todos os equipamentos necessários para o isolamento de células. 1. Uma seringa esterilizada com um suporte de filtro de membrana estéril; 2. Dois meios diferentes: GM umnd SCGM; 3. Um vidro Pasteur pipeta estéril. (B) Detalhe da seringa montada sobre um suporte, com o suporte do filtro de membrana. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. Unidade de Filtração. Vários componentes necessários para a montagem da unidade de filtragem (A) (o filtro de líquido é indicado pela seta). Observação de contraste de fase das malhas de 40 um (uma malha é indicado pela seta) do filtro de líquido (B). Ampliação original: 10X. A unidade de filtração montados (C - D). Unidade de filtragem esterilizada (E). Por favor clique aqui para ver uma maior version desta figura.

Figura 5
Figura 5. culturas de células primárias de OS convencional. Observação de contraste de fase de culturas de células primárias de OS de alto grau. Em (A), vários fragmentos de osso brilhantes são visíveis, enquanto que em (B), vários pequenos eritrócitos e arredondadas flutuantes estão presentes. Ampliação original: 10X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 6
Figura 6. convencional Osteosarcoma linhas celulares finitas (OSA). (A) OSA5 e (B) OSA6. Observação em contraste de fase.Ampliação original: 10X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 7
Figura 7. Ensaio de Sarcosphere OSA5 e OSA6. Depois de 24 h desde o início do ensaio, as células foram flutuante e isolados um do outro (células estão indicados por setas). Observação em contraste de fase. Ampliação original:. 20X Por favor clique aqui para ver uma versão maior desta figura.

Figura 8
Figura 8. Sarcosphere Ensaio de OSA5 e OSA6 às 7 D. 7 d para o ensaio, vários pequenos spherical colónias rodeadas por células individuais podem ser observados. Os sarcospheres (alguns destes sarcospheres estão indicados por setas) apareça flutuando no meio ou ligeiramente estabeleceu-se na parte inferior do poço. Observação em contraste de fase. Ampliação original: 20X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 9
Figura 9. Ensaio de Sarcosphere OSA5 e OSA6 a 28 D. Depois de 28 d, vários sarcospheres âmbar grandes são observados em cada poço das placas para cada linha de células de OSA, OSA5 (A) e OSA6 (B). Tamanho Bar: 100 m. Por favor clique aqui para ver uma versão maior desta figura. </ P>

Figura 10
Figura 10. As passagens para o isolamento de Sarcospheres As etapas para sarcospheres isolamento a partir de 6-bem placas ultra-baixas de fixação e sua reculturing em condições aderentes são mostrados (a) todo o equipamento necessário para o isolamento..: 1. Uma 6 poços ultra-low placa com sarcospheres formados em cada poço, 2. seringa com suporte de filtro na rede, 3. pipeta, 4. 1.000 mL dicas estéreis, 5. 2 pinças Perry estéreis, 6. 2 diferentes meios de cultura , 7. 8. pipeta esterilizada de Pasteur placas de Petri. (B) Recolha de sarcospheres. O meio contido em cada poço é recolhido com uma pipeta com uma ponta de 1.000 mL estéril. (C) Recolha a suspensão na seringa. A suspensão recolhido é transferido para a seringa para iniciar o processo de filtragem natural usando osuporte de filtro de membrana. (D) filtragem natural. (E) A desmontagem suporte do filtro de membrana a partir da seringa. Depois de toda a suspensão é filtrada, porta-filtro a rede é desmontado e colocado em uma placa de Petri; (F) Desmontar o suporte do filtro de membrana. Sarcospheres estão contidas nos poros do filtro líquido de suporte de filtro da rede, de modo que deve ser liberado usando a pinça Perry. (G, H) Remoção de sarcospheres do filtro de membrana. Por favor clique aqui para ver uma versão maior desta figura.

Figura 11
Figura 11. Isolamento Sarcosphere. Isolado sarcospheres flutuar no meio da placa de Petri de 60 mm. Observação de contraste de fase.Ampliação original: 40X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 12
Figura 12. Sarcosphere após o isolamento. Sarcospheres OSA5 de (A) e OSA6 (B) linhas de células no início de expansão aderente seguintes reintrodução e reculturing numa monocamada, sob condições aderentes às 48 h após o isolamento. Observação de contraste de fase. Ampliação original: 20X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 13 Figura 13. Sarcospheres em 7 D após o isolamento. Sarcospheres OSA5 de (A) e linhas de células OSA6 (B) mostraram expansão aderente seguinte reintrodução e reculturing numa monocamada, sob condições aderentes aos 7 d após o isolamento. Observação de contraste de fase. Ampliação original: 20X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 14
Figura 14. Coloração por imunofluorescência de CD105. Coloração por imunofluorescência de CD105 nas linhas OSA-CSC-OSA5 CSCs (A) e OSA6-CSCs (B) e na linha de células contínua HCT8 (C), que foi utilizado como um controlo negativo. LSCM na cor convencional: Verde para CD105 e vermelho para o citoesqueleto. Ampliação original: 10X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 15
Figura 15. Coloração por imunofluorescência para CD44. Imunofluorescência para CD44 nas linhas OSA-CSC-OSA5 CSCs (A) e OSA6-CSCs (B) e na linha de células contínua HCT8 (C), que foi utilizado como um controlo negativo. LSCM em cores convencionais: verde para CD44 e vermelhas para o citoesqueleto. Ampliação original: 10X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.


Figura 16. Coloração por imunofluorescência de coloração de imunofluorescência Stro1. Para Stro-1 nas linhas OSA-CSC-OSA5 CSCs (A) e OSA6-CSCs (B) e na linha de células contínua HCT8 (C), que foi utilizado como um negativo ao controle. LSCM em cores convencionais: verde para Stro-1 e vermelho para o citoesqueleto. Ampliação original: 10X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 17
Figura 17. Expressão de Nucleares ESC Marcadores e do CD133 Gene. RT-PCR mostrando a expressão de Nanog, Oct 3/4, Sox2 e CD133 no OSA5-CSCs (A) e, em OSA6-CSCs ( Por favor clique aqui para ver uma versão maior desta figura.

Figura 18
Figura 18. Ensaio de Diferenciação osteogénica -. ALP diferenciação osteogénica a 0 d (A, B) e após 10 d (C, D) de indução tal como determinado por coloração citoquímica para ALP usando azul rápido BB. Em azul, ALP + células; em vermelho, o núcleo contra-coradas com iodeto de propídio. observação Composite em claro e na fluorescência. Ampliação original: 20X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 19 Figura 19. Ensaio de Diferenciação osteogénica -. HA diferenciação osteogénica a 0 d (A, B) e após 20 d (C, D) de indução tal como determinado por coloração citoquímica para hidroxiapatite (HA) com Vermelho de Alizarina S. As células são contrastados em depósitos azul / cinza, eo granuladas de HA estão manchadas de vermelho. Observação em contraste de fase. Ampliação original: 40X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 20
Figura 20. Ensaio de Diferenciação Adipog�ica. Diferenciação Adipog�ica a 0 d (A, B) e após 14 d (C, D) de indução tal como determinado por cytochemical coloração com óleo vermelho O. Em vermelho, as vesículas lipídicas (as vesículas maiores são indicadas pelas setas pretas / vermelho; as vesículas mais pequenas são indicadas pelas setas brancas / preto); em azul / violeta, os núcleos contrastadas pela hematoxilina. Observação de campo claro. Ampliação original: 40X. Tamanho Bar:. 100 mm Por favor clique aqui para ver uma versão maior desta figura.

Figura 21
Figura 21. CFU de Ensaio. Ensaio CFU de linhas OSA-CSC corados com azul de toluidina. Por favor clique aqui para ver uma versão maior desta figura.

Figura 22 /> Figura 22. ALDH Activity Assay. O ensaio colorimétrico ALDH detectados altos níveis de atividade ALDH nas duas linhas OS-CSC, OSA5-CSCs e OSA6-CSCs, enquanto o ensaio detectados na ausência desta atividade na linha de célula diferenciada finita de fibroblastos, FIB. As barras de erro: SD. **: P <0,001 vs FIB; *:. P <0,01 vs FIB Por favor clique aqui para ver uma versão maior desta figura.

2 "> GGTTCAGGATGTTGGAGAGTT CCCAGCTGTGTGTACTCAAT
Gene oligonucleotídeos Sequence (5¹-3¹) Tamanho amplicon (pb) Tₐ (° C)
Nanog Adiante Iniciador inverso de primer 87 60
outubro 3/2 Adiante Iniciador inverso de primer GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 Adiante Iniciador inverso de primer TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 Adiante Iniciador inverso de primer CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
bp, pares de bases de tamanho amplicon; Tₐ, recozimentotemperatura

Tabela 1. lista detalhada de Primer Sequências para Nanog, Oct 3/4, Sox2 e CD133 com o tamanho Amplicon ea temperatura de recozimento

Discussion

CSCs têm várias propriedades que permitem a identificação deste subconjunto celular particular na massa do tumor. Na base destas características, tais como resistência adquirida à citotóxica agentes de quimioterapia para a sobre-expressão de ATP-ligação cassete multidrogas transportadores de efluxo 28, 32, 33, ou para a regulação positiva da expressão de enzimas de desintoxicação tais como ALDH 32, para a expressão de um marcador de superfície específico, como CD133, CD44, CD34, CD90, e outros 30, 34, 35, 41, vários métodos diferentes para isolar CSCs foram desenvolvidos 42-44. Uma dessas técnicas é o ensaio de formação de esfera, que se baseia na capacidade das CSCs a crescer sob condições de não-aderentes.

A capacidade das células-tronco de tecidos e CSCs para formar esferas foi descrita pela primeira vez em estudos sobre a identificação de células-tronco neurais por Reynolds et al. 37. Subsequentemente, Gibbs et ai. 38 nósEd estes estudos para começar a isolar CSCs de tumores sólidos, em particular, a partir de sarcomas ósseos. Decidimos usar o método de ensaio de formação de esfera ilustrado por Gibbs et al. Isolar CSCs de linhas celulares OSA obtidos a partir de biópsias OS convencionais. Nós adaptado o método original para melhorar os resultados deste ensaio e para facilitar a sua reprodutibilidade por outras linhas de células de cancro. Com referência à realização do ensaio de formação de esfera, verificou-se que o plaqueamento 40.000 células / poço é uma boa prática para a manutenção de células em isolamento no início do ensaio. Este truque é muito importante para evitar a possibilidade de que as colónias esféricas são originários de agregação celular e não a partir da capacidade particular e exclusivo de um único CSC a crescer sob condições de não-aderentes e formar uma colónia esférica. Esta capacidade é um ponto particularmente crítico deste ensaio.

Nós também certificou que para obter uma boa taxa de formação de esfera, É suficiente para refrescar alíquotas de factores de crescimento a cada 3 d e não todos os dias, como descrito no método original. No presente estudo, nós também estabelecido e amplamente descrito um bom método para o isolamento das colónias esféricas que se formaram, quando cultivadas sob condições não-aderentes. Este passo é crítico neste ensaio, porque é muito importante para tentar isolar o maior número de esferas quanto possível, que são formadas em cada poço sem danificá-los. É também importante para isolar apenas as esferas e não as células individuais, que podem permanecer em suspensão durante a duração do ensaio. Para superar estes pontos críticos, temos desenvolvido um método de isolamento em particular, que, conforme mostrado acima, deu bons resultados para o isolamento CSC. Obviamente, existe a possibilidade de que nem todas as esferas que se formaram pode ser recuperada, mas a percentagem de perda é muito baixa. Na verdade, temos também a possibilidade de usar um filtro com 40 mm poros para isolar esferas depois que eles se tornam grandes (formaed cerca de 100-200 células).

Este isolamento pára a formação de esfera, mas permite que as células individuais, parte do resíduo de metilcelulose, e as mais pequenas esferas para ser filtrada. Esta eliminação é realizada por meio de filtração profunda, tal como descrito no protocolo.

Além disso, a selecção das maiores colónias esféricas através dos 40 uM de malha com a consequente perda das colónias mais pequenas esféricas permite seleccionar os CSCs com a maior capacidade para formar colónias esféricas e com maior stemness. Todas estas modificações foram realizadas para melhorar o ensaio e para ajudar os investigadores que estudam CSCs de compreender e reproduzir a etapa mais crítica do método original de ensaio de formação de esfera.

Entre os estudos sobre métodos in vitro para CSCs de isolamento, este estudo teve como objetivo mostrar como esse ensaio de formação de esfera adaptada poderia ser um bom método para isolar CSCs delinhas de células SAOS. As adaptações para o método original e a técnica de isolamento detalhada descrito melhorar a sua eficácia. Num curto espaço de tempo, um bom número de CSCs podem ser obtidas e usadas para várias experiências. Portanto, é possível confirmar rapidamente os fenótipos tronco-like e, em particular, para estudar o fenótipo estaminais-como dupla que caracteriza OS-CSCs. Assim, este ensaio pode ser modificado uma boa técnica para isolar e estudar os CSCs sua biologia. No futuro, este método, com adaptações adicionais, podem também ser utilizados para isolar os CSCs de outras linhas celulares de cancro finito obtidos por biópsias de tumores sólidos raras.

A possibilidade de isolar CSCs de tumores sólidos raras, tais como SO, não apenas permite a melhoria de estudos sobre o cancro em particular, mas também se estende para estudos de diferentes tipos de cancro para desenvolver melhores métodos para o seu isolamento e para futuros estudos sobre a biologia de este subconjunto celular importante. Portanto, como nóster feito neste estudo, é importante para melhorar os métodos de isolamento CSC através do estudo da CSC biologia, com o objectivo final de encontrar alvos moleculares e desenvolver uma terapia anticancro muito específica dirigida contra este subconjunto celular particular, que é provavelmente responsável por a manutenção do tumor primário, o desenvolvimento da sua recorrência, e a origem de metástases em vários órgãos. O estudo da CSC biologia também é importante para encontrar terapias que poderiam ser incisiva na cura de cânceres, como o OS, para os quais a taxa de sobrevivência após o tratamento neoadjuvante continua a ser muito pobre.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics