Etablering av Cancer Stem Cell Cultures fra Menneskelig Konvensjonell Osteosarkom

Cancer Research
 

Summary

Tilstedeværelsen av kreft stamceller (cscs) i bensarkomer har nylig blitt knyttet til deres patogenese. I denne artikkelen presenterer vi isoleringen av cscs fra primære cellekulturer ble oppnådd fra humane biopsier av konvensjonell osteosarkom (OS) ved hjelp av evnen til cscs til å vokse under adherente betingelser.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De nåværende forbedringer i terapi mot osteosarkom (OS) har forlenget livet til kreftpasienter, men overlevelsen av fem år er fortsatt dårlig når metastase har oppstått. Kreft Stem Cell (CSC) teori er at det er en undergruppe av tumorceller i svulsten som har stammeliknende egenskaper, herunder evnen til å opprettholde svulsten, og til å motstå multimedikament kjemoterapi. Derfor er en bedre forståelse av OS-biologi og patogenese nødvendig for å fremme utviklingen av målrettede terapier for å utrydde denne bestemte delsettet, og for å redusere sykelighet og dødelighet blant pasientene. Isolere cscs, etablere cellekulturer fra cscs, og studere deres biologi er viktige skritt for å forbedre vår forståelse av OS biologi og patogenesen. Etableringen av human-avledet OS-cscs fra biopsier av OS har blitt gjort mulig ved hjelp av flere metoder, blant annet evnen til å lage 3-dimensjonale stamcellekulturer henhold nonadherent forhold. Under disse betingelser, cscs er i stand til å skape sfæriske flytende kolonier dannet av datter stamceller; disse koloniene betegnes som "cellular kuler". Her beskriver vi en metode for å etablere CSC kulturer fra primære cellekulturer av konvensjonell OS hentet fra OS biopsier. Vi beskriver tydelig flere passasjer som kreves for å isolere og karakterisere cscs.

Introduction

Sarkomer er en heterogen gruppe av sjeldne ondartede binde svulster vev stammer hovedsakelig fra embryonale mesoderm en. De ulike typene inkluderer bensarkomer og sarkomer bløtvev. Bensarkomer, en gruppe av relativt uvanlig primære tumorer, bestå av flere undertyper, inkludert osteosarkom (OS). OS, en av de mest vanlige primære tumorer i ben, er en mesenchymale malignitet som oppviser omfattende kliniske, histologiske, og molekylære heterogeniteter 2, 3. Dessverre forekommer OS hovedsakelig hos barn og hos unge voksne, 4, 5 og utgjør 60% av de vanligste histologiske subtyper av bensarkom i barndommen 6, 7. OS vanligvis påvirker skjelett områder, som er preget av raske bein vekst (f.eks metafysært av lange bein). Blant de histologisk ulike subtyper av OS, konvensjonell OS, også kalt medullær eller sentral OS, har en høy grad av malignitet og en kvote share 80% 8. Denne 80% består av 60% konvensjonell osteoblastisk OS, 10% chondroblastic OS, og 10% fibroblastisk OS 6, 8-10. Andre OS subtyper inkluderer anaplastic, telangiectatic, gigantiske celle-rik og småcellet OS. Til tross for fremskritt i kombinert kirurgi og kjemoterapi i OS ledelse, forblir utfallet dårlig, med en langsiktig overlevelse på 65-70% hos pasienter uten metastaser 11, 12. Distant tilbakefall ofte oppstå som lungemetastaser eller, sjeldnere, som metastaser å fjerne bein og lokale residiv 13. Metastaser er ofte resistente mot konvensjonelle behandlinger. Denne motstanden er grunnen til at 10-års sykdomsfri overlevelse er ca 30% hos pasienter med metastatisk sykdom ved diagnose 14, 15.

Som med normalt vev, er kreft vev består av en heterogen samling av celletyper. Celler i tumoren synes å tilsvare forskjellige stadier av utviklingen. Innen noen normal vev ligger en subpopulasjon av celler med evnen til å selfrenew, og dermed gi forløpere og modne celler for vev homeostase. Tilsvarende er kreft sammensatt av en tilsvarende heterogen populasjon av celler på ulike stadier av utvikling, med forskjellig grad av spredning og karsinogent potensial. En undergruppe av disse kreftceller, betegnet Cancer stamceller (cscs), utgjør et reservoar av selfsustaining celler med den eksklusive evne til å selfrenew og opprettholde den maligne potensial av svulster, og dermed generere de forskjellige celle-linjene som utgjør tumoren bulk 16. På 1990-tallet, studier av akutt myelogen leukemi gitt den første overbevisende bevis for eksistensen av CSC subpopulasjoner 17, 18. Cscs har siden blitt isolert fra et stort antall faste tumorer 19, og ble dermed en av de mest forsket temaer i kreftforskning. Cscs kan faktisk oppstå fra normale stamceller ved mutasjoner i gener som gjør den normalestamceller kreft 20-23. Flere transformere mutasjoner og interaksjoner med mikromiljøet vil også kunne bidra til friske stamceller og modne celler anskaffe selfrenewal kapasitet og udødelighet som kjennetegne cscs. Det finnes flere hypoteser om denne transformasjonen. Sunn stamfedre, sunne modne celler og kreftceller, kan dedifferentiate til stamceller, få en stilk-lignende fenotype ved å aktivere selfrenewal assosierte gener 24-28. Til tross for flere nyere studier, opprinnelsen til cscs har ennå å bli oppdaget.

Et særlig kjennetegn ved cscs er at deres evne til å motstå den multi-terapi tilnærming, som består av kombinert kirurgi og kjemoterapi med forskjellige medikamenter. Nyere studier har vist at cscs kan også erverve resistens mot cytostatika agenter. Mulige forklaringer på denne motstand er overekspresjon av ATP-bindende kassett (ABC) multidrug transportør (dvs.MDR1 og BCRP1), overekspresjon av kjemoterapi metaboliserende enzymer så som aldehyd dehydrogenase 1 (ALDH1), og / eller endringer i cellesykluskinetikk 30-33. Den direkte følge av alle disse konsepter som er beskrevet så langt er at en kreftterapi vil være effektiv bare hvis CSC subpopulasjonen var fullstendig eliminert, mens lokalt tilbakefall eller fjernmetastaser kan inntreffe hvis en eneste CSC overlevde.

Oppdagelsen av cscs i menneskelig sarkomer 34, spesielt OS 35, eller i andre bein og bløtvev kreft, har stor klinisk betydning fordi det gir en mulig forklaring på hvorfor mange behandlinger ser ut til å være effektive i første omgang, men pasientene senere tilbakefall. Derfor er håp for fremtiden kampen mot konvensjonell OS er å finne nye og konkrete målrettede terapier basert på utvikling av innovative legemidler rettet mot OS-cscs takket være den molekylære karakterisering av denne underbefolkning og til studiet av CSC biologi.

I 1992 Reynolds og kolleger, som var å undersøke hvorvidt en undergruppe av stamceller var til stede i den voksne hjernen hos pattedyr, utviklet en metode for å isolere celler som mistenkes for å være stilk-lignende celler 36, 37. Denne metoden er basert på den spesielle evne disse cellene til å danne kuleformede kolonier når dyrket under adherente betingelser. Lignende teknikker ble ansatt av Gibbs og kollegene i 2005 for å studere en undergruppe av stilk-lignende celler i bein sarkomer 38. For å isolere og karakterisere OS-cscs fra primære cellekulturer fra ulike typer konvensjonelle OS, bestemte vi oss for å tilpasse denne teknikken for OS cellelinjer.

Her beskriver vi at dette er tilpasset metoden av kulen dannelsesbestemmelsen, kalt "sarcosphere assay", som kan brukes til å isolere OS-cscs fra endelige primære cellelinjer avledet fra humane biopsier av konvensjonell OS. Vi beskriver også alle teknikker used å validere stammeliknende CSC fenotype av cellelinjene isolert ved denne analysen: 1) evaluering av ekspresjonen av gener som er karakteristiske pluripotente embryonale stamceller (ESCS) og av CD133-genet, som er en markør for cscs; 2) kolonidannende enhet (CFU) analyse; 3) evaluering av evnen til disse cellene til å differensiere til osteoblaster og adipocytter under passende differensierings betingelser; 4) studie av overflatemarkører av mesenchymale stamceller (MSC) (dvs. CD44, CD105 og Stro-1) ved immunfluorescens farging og ved flowcytometrisk analyse; 5) evaluering av ALDH-aktivitet av disse cellene.

Protocol

All eksperimentering ved hjelp av menneskelig vev beskrevet her ble godkjent av den lokale etiske komiteen (Rif. N. 141/12). Informert samtykke til innsamling av vevsprøver og for bruk og oppbevaring av prøvene ble hentet fra givere på AOUC.

1. Forberedelse for kultur

  1. Fremstille vekstkulturmedium (GM) ved å tilsette 10% føtalt bovint serum (FBS), 100 IU / ml penicillin og 100 ug / ml streptomycin i Coon modifiserte Hams F12-medium. Filter og sterilisere GM bruker en 0,22 mikrometer filter. Oppbevares GM opp til en måned ved 4 ° C.
  2. Forbered kollagenase medium (CM) ved tilsetning av 20% FBS, 100 IU / ml penicillin, 100 ug / ml streptomycin og 3 mg / ml kollagenase type II Coon modifiserte Hams F12-medium. Filter og sterilisere CM hjelp av en 0,22 mikrometer filter. Oppbevares CM opp til en måned ved -20 ° C.
  3. Forbered medium for frysing celle (FM) ved tilsetning av 40% FBS, 100 IU / ml penicillin, 100 ug / ml streptomycin og 60,5% dimetylsulfoksyd (DMSO) for å Coon modifiserte Hams F12-medium. Filter og sterilisere FM ved hjelp av en 0,22 mikrometer filter. Oppbevares FM opp til en måned ved 4 ° C.
  4. Forbered medium for CFU-analyse (CFUM) ved tilsetning av 20% FBS, 100 IU / ml penicillin og 100 ug / ml streptomycin i Coon modifiserte Hams F12-medium. Filter og sterilisere CFUM ved hjelp av en 0,22 mikrometer filter. Oppbevares CFUM opp til en måned ved 4 ° C.
  5. Forbered trypsin ved oppløsning av 400 mg trypsin, 200 mg EDTA og 1000 mg D (+) - vannfri glukose i 1000 ml Dulbeccos fosfatbuffret saltoppløsning (DPBS) uten Ca2 + og Mg2 +.
    MERK: Del frisk trypsin-EDTA i 50 ml deler i 25 cm 2 kolber ved hjelp av en 0,22 mikrometer filter og fryse ved -20 ° C i inntil 3 måneder. Butikk tinte filtersterilisert alikvoter ved 4 ° C uten tap av aktivitet.
  6. Forbered stamcelle vekstmedium (SCGM) ved tilsetning av 10% FBS, 100 IU / ml penicillin, 100 ug / ml streptomycin, og 10 ng / ml bFGF (25 ug / ml stamløsning) for å Coon modifiserte Hams F12-medium. Filter SCGM ved hjelp av en 0,22 mikrometer filter og lagre SCGM opp til 2 uker ved 4 ° C.
  7. Fremstille 2% metylcellulose (MC) ved oppløsning av MC i ultrarent H2O ved 4 ° C i 3 dager. Når MC er fullstendig oppløst, autoklav og oppbevares ved 4 ° C.
    MERK: Etter at MC er sterilisert, blir det solid. Å bringe MC til en flytende tilstand, oppbevares ved 4 ° C.
  8. Forbered sarcosphere vekstmedium (SGM). Fremstille dette mediet frisk (ikke mer enn 2 uker før bruk) ved tilsetning av 100 IU / ml penicillin, 100 ug / ml humant bFGF (25 ug / ml stamløsning), 20 nM progesteron (10 uM lager), 100 uM putrescin, 30 nM natriumselenitt (30 uM lager), 25 ug / ml transferrin (25 mg / ml stam), 20 ug / ml insulin (20 mg / ml lager), og 10 ng / ml humant EGF (10 ug / ml stock) til 2X Coon modifiserte Hams F12 medium. Filter og sterilisere SGM ved hjelp av en 0,22 mikrometer filter. Oppbevar i opptil to uker ved 4 ° C.
  9. Forbered osteogene medium (OM) ved tilsetning av 10% FBS (South American opphav), 100 IU / ml penicillin, 100 ug / ml streptomycin, 10 nM deksametason (100 uM lager), 0,2 mM natrium-L-askorbyl-2-fosfat (1 M lager), 10 mM β-glycerofosfat (5 mg / ml stock) og 1 ug / ml Calcein (200 ug / ml stamløsning) for å Coon modifiserte Hams F12-medium. Filter og sterilisere OM hjelp av en 0,22 mikrometer filter. Oppbevar ved 4 ° C.
    MERK: Oppbevar deksametason lager løsninger som er under flytende nitrogen for å opprettholde sin aktivitet. Fremstille frisk OM hver 2 uker for å opprettholde aktiviteten av deksametason for å opprettholde den potensielle differensiering av mediet.
  10. Forbered erytrocytt lyseringsbuffer (ELB) ved oppløsning av 1,66 mg NH4CI, 0,2 mg K HPO 2 4 og 0,007 mg EDTA i 200 ml destillert vann (dH 2 O). Filter og sterilisere ELB ved hjelp av en 0,22 mikrometer filter. Oppbevares ved 4 °C.
  11. Forbered adipogenic medium (AM) ved tilsetning av 10% FBS (Sør-Amerika opphav), 100 IU / ml penicillin, 100 ug / ml streptomycin, 1 uM deksametason (1 mM stam), 1 uM bovint insulin (10 mM stamløsning), 0,5 mM isobutylmethylxanthine (IBMX) (500 mM stamløsning) og 100 uM indometacin (200 mM) til Coon modifiserte Hams F12-medium. Filter og sterilisere AM ved hjelp av en 0,22 mikrometer filter. Oppbevar ved 4 ° C.
    MERK: Oppbevar deksametason lager løsninger som er under flytende nitrogen for å opprettholde sin aktivitet. Fremstille frisk AM hver 2 uker for å opprettholde aktiviteten av deksametason for å opprettholde den potensielle differensiering av mediet.
  12. Fremstille 2% bovint serumalbumin (BSA) i DPBS (BSA / DPBS). Løs opp 10 g BSA i 500 ml DPBS og forberede stamløsning av aliquotting 50 ml stamløsning i 50 ml koniske rør. Oppbevar ved -20 ° C.
  13. Forbered en løsning av 4% paraformaldehyde (PFA) i DPBS (PFA / DPBS). I en lmemical hette, fortynne paraformaldehyde i DPBS og forberede stamløsning av aliquotting 50 ml stamløsning i 50 ml koniske rør. Oppbevar ved 4 ° C.

2. Etablering Primær OS cellekulturer og OS Finite cellelinjer (OSA)

MERK: Primær OS cellekulturer ble tilberedt av ferske prøver av konvensjonelle OS biopsier samles på "Unità Ortopedia Oncologica e Ricostruttiva", AOUC Careggi, Firenze. Alle biopsier, som ble oppnådd ved nål aspirasjon eller kirurgisk fjerning av en liten del av tumoren (figur 1 A, B), ble umiddelbart plassert i kulturmedium supplert med 100 IU / ml penicillin og 100 ug / ml streptomycin (pH 7,4) og transporteres til laboratoriet hvor de ble behandlet. Alle beskrevne manipulasjoner ble utført under aseptiske betingelser ved anvendelse av en laminær strømningshette.

  1. Isolering av OS celler
    1. Plasser biopsi i en100 mm petriskål med et lite volum av GM. Med en steril lansett og Perry pinsett, Finhakk OS vevsprøver ved å klippe dem i stykker så små som mulig (0,5 til 1 mm) (figur 2A, B).
    2. Dekk vevsfragmentene med 10 ml CM for den enzymatiske fordøyelse (figur 2B) og inkuberes i 3 timer i en 37 ° C, 5% CO2 inkubator. Fjern forsiktig suspensjon av fragmenter ved hjelp av en pipette og overføre den til et 15 ml konisk rør for umiddelbar sentrifugering (400 x g i 5 min) for å pelletere de fragmenter.
      MERK: Etter sentrifugering hvis biopsier er rike på erytrocytter, en rød depositum sammensatt av erytrocytter kan sees over fragmenter. Derfor, før du går videre til mekanisk spredning, behandle prøven med erytrocytt lysebuffer. Kast supernatanten ved aspirasjon og tilsett 5 ml ELB.
    3. Suspendere pellet fragmenter i 1 min og sentrifuger suspensjonen ved 400 xg for 2min. Fjern supernatanten ved aspirasjon. Tilsett 5 ml GM og mekanisk spre fragmenter ved hjelp av en 10 ml serologisk pipette (åpning størrelse, 1,5 mm indre Ø) 10 - 20 ganger.
    4. Sentrifuger suspensjonen ved 400 xg i 5 min. Fjern supernatanten ved aspirasjon, suspendere cellepelleten med 10 ml GM, og deretter overføre den resulterende cellesuspensjonen i en 100 mm petriskål. Inkuber petriskål i en 37 ° C, 5% CO 2 inkubator og erstatte GM med frisk komplett GM hver 3 d.
      MERK: Ganske ofte, OS vevsprøver innhentet av nål aspirasjon er veldig små og inneholde beinrester, som ikke er fordøyd ved enzymatisk fordøyelse med kollagenase. Derfor, etter at supernatanten er fjernet, forsøke å separere celler fra benvevet av mose pellet-fragmenter med en pipette.
  2. subkultur
    MERK:
    For å etablere et OSA, når cellene når omtrentlig samløpet, fjerne dem fra their kultur fartøy, fortynne, og plasser i en fersk plate for å muliggjøre videre vekst. Dette subkultur prosedyre oppnås ved hjelp av enzymatiske fremgangsmåten betegnes trypsinering.
    1. Fjern mediet ved aspirasjon. For å distansere cellen monolayer, tilsett 2-3 ml trypsin ved romtemperatur (maks 18 - 20 ° C), rist forsiktig en gang, og fjern trypsin umiddelbart ved aspirasjon. Gjenta to ganger. Inkuber cellene ved 37 ° C, 3 - 4 min før de begynner å løsne.
      MERK: Good trypsinering kan sees av den erfarne brukeren som små hull dannes i den litt ugjennomsiktig monolaget når parabolen holdes mot lyset. Dette dissosiasjon kan også overvåkes ved hjelp av en omvendt mikroskop; denne tilnærmingen anbefales for nybegynnere.
    2. Stoppe trypsin reaksjonen ved å tilsette 10 ml GM og vaske fatet godt ved hjelp av en pipette for å løsne alle cellene. Overføre 1 ml av suspensjonen til en ny 100 mm petriskål og legge til 9 ml GM (1/10 splitt av celler).
      NOTAT:
  3. Nedfrysing av OS primærkulturer og OSA
    MERK: Frys en konfluent 100 mm petriskål inn 4-5 cryovials. Prosessen med nedfrysing må utføres raskt fordi DMSO, som beskytter cellemembraner under frysingen, er giftig for celler ved ikke-frysetemperaturer.
    1. Dissosiere cellekulturer fra den monolaget ved trypsinering (se avsnitt 2.2), pellet-celler ved sentrifugering ved 400 xg i 5 minutter, fjern supernatanten ved aspirasjon, og deretter raskt å suspendere cellepelleten i FM.
    2. Aliquot 1 ml av denne suspensjon pr kryogen hetteglass. Umiddelbart de fylte ampuller i en fryser boks med en jakke av 2-propanol og lagre immediately ved -80 ° CO / N. Overføring cryovials til flytende nitrogen neste dag for langtidslagring.
  4. Tining OS cellelinjer og primærkulturer
    1. Tining OS-cellelinjer fra flytende nitrogen lagring, tining cryovials raskt ved å plassere dem i et laboratorium vannbad ved 37 ° C. Overfør innholdet av cryovials inn i en 15 ml konisk rør og tilsett ca 10 ml av GM (Se ​​avsnitt 2.3 for å fjerne DMSO). Supernatanten fjernes ved aspirasjon og suspen cellepelleten i 10 ml GM. Plate cellesuspensjonen i en 100 mm petriskål og inkuberes i et 37 ° C, 5% CO2 inkubator.

3. Sarcosphere analysen å isolere OS-cscs

MERK: Dette forsøket er utført på OSA. Varigheten av dette eksperimentet er relatert til kapasiteten av cellene til å danne disse kule kolonier (sarcospheres), og tidsperioden som er 7, 14, 21, og 28 d.

  1. Estabringen av sarcosphere assay
    1. Klargjør hemocytometer kammeret og alle reagenser på forhånd.
    2. Fjern mediet ved aspirasjon og dissosierer cellene fra den monolaget ved trypsinering (se avsnitt 2.2). Bland cellesuspensjonen grundig, pipettering for å dispergere eventuelle klumper, og samle 10 ul ved bruk av en 20 ul pipettespiss.
    3. Overfør 10 ul cellesuspensjon umiddelbart til hemocytometer kammeret kant, utvise suspensjonen, og tillate den å bli trukket under dekkglass ved kapillærvirkning.
    4. Observer hemocytometer kammeret under fase kontrast. Velg en 10X objektiv og fokusere på rutenettlinjene i kammeret. Telle celler som ligger i dette en mm 2 område ved hjelp av underavdelinger (også bundet av tre parallelle linjer) og enslige rutenettlinjer som et hjelpemiddel for telling.
    5. Måle konsentrasjonen og anvende den følgende ligning: 1 ml = n * 10 4 / z (n: hele antall celler i alle de tellestorg 1 mm 2; z: antallet telte torg 1 mm 2). Beregne volumet av cellesuspensjonen er nødvendig for å plate en total mengde på 240.000 celler inndelt i 40.000 celler til hver brønn i 6-brønns ultra-lav festeplate.
      MERK: Pass å plate riktig antall celler ved utsåing celler til én ekstra godt. Derfor er den totale mengden av celler som skal bli belagt er 280.000 celler.
    6. Fremstille 35 ml SGM ved tilsetning av 50% av 2% MC (SGM-MC) i en 25 cm2 kolbe. Fremstille totalvolumet av SGM vurderer 5 ml ekstra for å plate en ekstra godt.
    7. Legg det beregnede volum av cellesuspensjonen til den SGM-MC fremstilt i kolben, og bland forsiktig ved hjelp av en pipette for å dispergere eventuelle klumper. Plate cellene i en 6-brønns ultra-lav festeplate og bruke et invertert mikroskop for å observere hvordan cellene ser ut etter å ha blitt belagt.
    8. Cellene inkuberes i et 37 ° C, 5% CO2 inkubator. Hver 3 d, legge frESH alikvoter av bFGF og EGF til hver brønn for å oppdatere konsentrasjonen av vekstfaktorer. Tilsett 2 mL bFGF og 5 mL EGF for å opprettholde både ved sluttkonsentrasjon på 10 ng / ml i hver brønn.
  2. Isolering av sarcospheres
    MERK: Overvåk god fremgang av sarcosphere analysen på 7, 14, 21, og 28 d å bestemme når det er nødvendig å isolere sarcospheres som dannet.
    1. Forbered alle reagenser og utstyr i laminær hette (figur 3A, B). Monter filtreringsenhet ved å anbringe en netto filter av 25 mm diameter og en 40 pm sikt til en membranfilterholder; Steriliser ved autoklavering (figur 4A-E).
    2. For hver brønn, overføre medium inneholdende sarcospheres til en sprøyte med et sterilt membranfilter holderen ved hjelp av en steril pipette med en 1000 mL spiss. Etter fullstendig fjerning av medium som inneholder sarcospheres, vaske godt av adding 5 ml GM for å være sikker på å overføre alle kulene til en sprøyte. Bruk mikroskop for å bekrefte om alle sarcospheres er gjenvunnet. Hvis ikke, gjør ved å gjenta dette trinnet.
    3. Filtrer suspensjonen med en membranfilterholder bare av tyngdekraften uten trykk, for å forhindre skade på kulene og for å unngå å ha sarcospheres krysser gjennom filteret, for derved å unngå tap av kuler. Fjern luftbobler ved å hjelp av en steril glass Pasteur pipette.
      MERK: Noen ganger filtrerings er blokkert av tilstedeværelsen av en luftboble i membranfilterholderen.
    4. Vask filtreringsenheten ved å tilsette 10 ml GM til sprøyten og la den filtrere uten press for å være sikker på å eliminere enkeltceller. Ta fra hverandre filterenheten fra sprøyten og sette det inn i en petriskål.
    5. Fjern nettet filter fra membranen filterholderen ved hjelp av Perry pinsett og vask den ved å riste den forsiktig med pinsett i et 60 mmPetriskål å frigjøre sarcospheres fra floke av membranen. Deretter plasserer membranen i et godt og bekreft ved mikroskopisk observasjon at det ikke er flere kuler fast i membranen. Hvis kuler fremdeles fast i membranen, fortsette med en annen vask som beskrevet i trinn 3.2.4.
    6. Observer de frigitte sarcospheres ved hjelp av et mikroskop. Inkuber utgitt sarcospheres i en 37 ° C, 5% CO 2 inkubator. Gjenta alle trinnene for hver brønn i en 6-brønns ultra-lav festeplate.

4. OS-CSC Lines

MERK: OS-cscs er hentet fra sarcospheres som viser tilhenger utvidelse av gjeninnføre og reculturing disse cellene i en mono etter at de er belagt i små 60 mm petriskåler ikke lenger under ultra-lave festeforhold.

  1. OS-CSC kulturer
    1. For å muliggjøre videre vekst, subkultur cellene når de kommer ca 90% samløpet i en 60mm petriskål. Gjenta trinn 2.2.1 til å etablere OS-CSC kulturer.
    2. Stopp trypsinering ved å tilsette 4 ml SCGM og vaske fatet godt, ved hjelp av en pipette til å løsne alle cellene. Overfør cellesuspensjonen til en ny 100 mm petriskål og tilsett 6 ml SCGM. Når OS-cscs nå 90% samløpet, subkultur ved å gjenta punkt 2.2.
      NB: For in vitro-analyse for å karakterisere stamcelle-lignende fenotype av isolert OS-cscs kan celler sådd ut i forskjellige typer av platene.
    3. Bevar de etablerte OS-CSC linjer ved nedfrysing (gjenta alle trinnene i avsnitt 2.3). Avrime cryokonservert OS-cscs ved å gjenta alle trinnene i § 2.4.

5. In vitro En nalysis å karakter OS-cscs:

  1. Utarbeidelse av celler for immunfluorescens
    MERK: Celler er løst i paraformaldehyde når de kommer rett karakteren samløpet i hver brønn i en 24-brønns plate. Graden av sammenløpet er relatert til type eksperimenter.
    1. Plate OS-cscs i en 24-brønns plate for å studere overflaten stamceller (MSC) markører ved immunfluorescens. Fix celler i hver brønn når de når 50-60% samløpet. Fjern det SCGM ved avsugning og vask to ganger i DPBS en 24-brønns plate.
    2. Under en kjemisk hette, tilsett 500 mL 4% PFA / DPBS til hver brønn. Inkuber ved RT i 10 min. Ta av PFA / DPBS og vask 3x med ultra dH 2 O. Tillat den 24-brønners plate for å tørke i avtrekksskap.
  2. Immunfluorescens for MSC markører
    MERK: Immunofluorescens farging av OS-cscs fiksert i 4% PFA / DPBS kan brukes til å undersøke MSC-lignende fenotype av OS-cscs ved hjelp av antistoffer rettet mot CD44, Stro-1 og CD105. Følgende metode er anvendt rutinemessig av forfatterne.
    1. I en kjemisk hette, permeabilize celler som har blitt løst i 4% PFA / DPBS ved å tilsette 500 mL 0,2% Triton X-100 / DPBS til hver brønn. Inkuber cellene ved 37 ° C i 30 minutter. Vask forsiktig cellene 3x med DPBS. Tilsett 300 ul RNase fortynnet 1/1000 med 2% BSA / DPBS til cellene og inkuberes ved 37 ° C i 30 minutter.
    2. Vask forsiktig cellene 3x med 2% BSA / DPBS. Flekk cellene for MSC markører. Legge til den primære antistoff bare til brønnene valgt som positive kontroller for hvert antistoff.
      1. Legg 300 mL anti-CD105 fortynnet 1/10 med 2% BSA / DPBS, 300 mL anti-CD44 fortynnet 1/10 med 2% BSA / DPBS, 300 mL anti-Stro-en fortynnet 1/10 med 2% BSA / DPBS og bare 200 mL 2% BSA / DPBS til brønnene valgt som negative kontroller for hvert antistoff.
      2. Inkuber cellene i et fuktig miljø ved 4 ° CO / N. Vask brønnene 3x med DPBS og deretter to ganger med 2% BSA / DPBS.
    3. Avslør primære antistoffer ved å legge spesifikke sekundære antistoffer.
      1. Tilsett 300 ul anti-kanin-IgG (esel-anti-kanin-IgG [H + L]) fortynnet 1/100med 2% BSA / dPBS i hver brønn valgt som positiv og negativ kontroll for CD44 og CD105. Tilsett 300 pl FITC-anti-mus-Ig (FITC-kanin-anti-mus IgG [H + L]) fortynnet 1/100 med 2% BSA / DPBS i hver brønn valgt som positive og negative kontroll for Stro-1. Inkuber cellene i mørke ved RT i 60 min. Vask brønnene 6x med DPBS.
    4. Stain MSC markør-positive celler for cytoskeletal aktin ved å legge 300 mL phalloidin fortynnet 1/100 med 2% BSA / dPBS i hver brønn farget for MSC markør immunfluorescens.
    5. Cellene inkuberes i 40 min ved RT. Vask brønnene 3x med DPBS og deretter vaske dem to ganger med ultra dH 2 O. Fortsett til kontra av kjernene etter immunfluorescens farging beskrevet ovenfor. Forbered propidiumjodid- løsning 10 -5 M i DPBS (lager 1,5 x 10 -3 M) i en avtrekkshette.
      1. Tilsett 200 mL propidium jodid-løsning til hver brønn farget som beskrevet ovenfor. Inkuber cellens 2 - 3 min ved RT. Vask brønnene to ganger med ultra dH 2 O.
        MERK: Gjenta alle trinnene i avsnittene 5.1 - 5.2 på cellelinjen HCT8, en primær kontinuerlig differensiert koloncancer cellelinje som blir brukt som en negativ kontroll.
  3. Osteogene differensiering assay
    MERK:
    osteogene differensiering varer i 20 d.
    1. Plate-OS cscs i 24-brønners plater ved en celletetthet på 1 x 10 4 celler / cm2 i SCCGM. La cellene vokse i SCGM inntil de nå 80 - 90% konfluens i hver brønn.
    2. Begynn osteogene differensiering ved å endre SCGM til OM. La cellene til å vokse i OM og oppdatere medium hver 3-4 d. Stoppe den osteogene differensiering analysen ved 10 d for å evaluere nærværet av alkalisk fosfatase (ALP).
    3. Fix celler i 4% PFA / DPBS (se pkt 5.1). Vurdere osteoblastiske fenotype ved cytokjemiske farging for ALP og for HAbruker Alizarin Red S farging.
    4. ALP cytokjemiske farging
      MERK: Klargjør dye blandingen i en kjemisk hette umiddelbart før farging.
      1. Oppløs 40 mg ekte blå BB eller Fast Red Violet LB salt i 50 ml Tris-HCl, pH 9 (løsning A). Oppløse 5 mg naftol-AS-MX fosfat natriumsaltet i en ml DMSO (løsning B). Legg Løsning B helt til løsning A og bland godt, skaffe Solution C. Vask cellene to ganger med DPBS.
      2. Legg 500 mL - 1 ml oppløsning C til hver brønn og inkuber ved 37 ° C og 5% CO2. Overvåke forløpet av flekker hvert 10 min ved observering av cellene under mikroskopet.
      3. Stopp farging når ALP-positive celler blir intenst farget (blå med den vaskeekte blå BB salt eller rød med Fast Red Violet LB salt), som vanligvis skjer i løpet av 30 min. Vask cellene 3x med ultra dH 2 O for å fjerne alle rester av løsnings C. Hvis en utfelling av flekken jeger til stede, vask cellene hurtig en gang med absolutt etanol.
      4. Fortsette til kontra av kjernene etter ALP farging som beskrevet i trinn 5.2.5 og 5.2.5.1.
    5. Alizarin Red S cytokjemiske farging
      MERK: Klargjør dye blandingen før du starter eksperimentet.
      1. Klargjør 2% Alizarin Red S (2 g Alizarin Red S i 100 ml ultrarent H 2 O). Legg 2,5% NH3 til 2% Alizarin Red S for å nå pH 6,0. Oppbevares 2% Alizarin Red S løsning ved 4 ° C. Vask cellene gang med DPBS.
      2. Legg Alizarin Red S til cellene for bare noen få sekunder.
      3. Vask brønnene med ultra dH 2 O for å kontrollere graden av flekker; hvis HA innskudd er ikke intenst farget, gjenta trinn 5.3.5.2. Stopp flekker når HA forekomster blir intenst rød, noe som vanligvis skjer innen få minutter. Vask brønnene med ultra dH 2 O.
    6. Adipogenic differensiering
      MERK: Analyse varighet avhenger av OS-CSC linjer. Analysen kan vare 14-30 d.
      1. Plate-OS cscs i 24-brønners plater ved en celletetthet på 1 x 10 4 celler / cm2 i SCGM. La cellene vokse i SCGM inntil de nå 80 - 90% konfluens i hver brønn. Initiere adipogenic differensiering ved å endre SCGM til AM. La cellene til å vokse i AM og oppdatere AM to ganger i uken.
      2. Stopp adipogenic differensiering analysen når lipidvesikler er synlige. Vurdere adipogenic fenotype av Oil Red O farging og ved haematoxylin kontra for kjerner.
      3. Haematoxylin kontra for kjerner
        MERK: Klargjør dye blandingen før du starter eksperimentet.
        1. Klargjør 5% haematoxylin løsning, kalt Emallume Carazzi 39. Oppbevar løsningen ved 4 ° C. Legg Emallume Carazzi for bare 2 min. Vask brønner med ultrapure dH 2 O.
    7. CFU assay
      MERK: Dette eksperimentet må utføres i tre paralleller.
      1. Plate-OS cscs i 100 mm petriskåler ved en celletetthet på 450 celler / cm2 i CFUM. Inkuber cellene i et 37 ° C, 5% CO2 inkubator i 4 uker. Oppdater CFUM to ganger i uken.
      2. Stain CFU med toluidinblått. Tell fargede kolonier ved hjelp av en invertert mikroskop. Beregn CFU effektivitet i henhold til følgende formel: (antall kolonier dannet / antall celler utsådd) * 100.
    8. ALDH aktivitet analyse
      MERK: ALDH-aktivitet har blitt evaluert ved anvendelse av en kolorimetrisk ALDH Activity Assay Kit på de to OS-CSC linjer og på en endelig fibroblast-linje, som ble anvendt som en negativ kontroll. Dette settet kvantifiserer ALDH enzymatisk aktivitet ved absorbans lesing på 450 nm. Alle tester er utført i tre paralleller.
      1. Distansere cellekulturer fra monolaget ved trypsinering (se avsnitt 2.2). Pellet celler ved sentrifugering ved 400 xg i 5 minutter. Følg produsentens protokoll.
    9. Flowcytometrisk analyse:
      MERK: Enkeltcellesuspensjoner er nødvendig for optimal farging av prøver for strømningscytometri. En enkelt cellesuspensjon må være forberedt for hvert antistoff som skal testes. Distansere cellekulturer fra monolaget ved trypsinering (se avsnitt 2.2).
      1. Plasser cellesuspensjonen i et konisk rør, utføre en celletelling ved hjelp av Burker tellekammer, sentrifuger cellene ved 400 x g og resuspendert i et egnet volum av separasjon buffer for å oppnå en cellesuspensjon ved en sluttcellekonsentrasjon på 1 x 10 5 celler / ml.
      2. Sentrifuger cellesuspensjonen i 5 min ved 4 ° C. Kast supernatanten og vask det pellet med separasjonsbuffer. Gjenta dette trinnet to ganger.
      3. Flekke celler for MSC markører (dvs. CD44, CD105 og Stro-1) 40.
      4. Analyser positivt fargede cellesuspensjoner i et flowcytometer. Analyser merket prøvene innen 1 d. Inkuber disse prøvene ved 4 ° C inntil analyse.
    10. RT-PCR
      1. Utvinning og isolering av RNA
        1. Tilsett 1 ml lysereagensen til de cellulære frosne pakket prøver av OS-cscs og lysere cellene direkte i røret ved pipettering pelleten opp og ned flere ganger.
        2. Sentrifuger prøvene ved 12 000 xg i 1 min ved 4 ° C. fjern supernatanten forsiktig. Overfør supernatanten til et nytt rør, tilsett 200 ul kloroform, og hetten røret sikkert. Rist røret kraftig i 15 sekunder og inkuberes prøven i 5 min ved RT.
        3. Sentrifuger prøvene ved 12 000 xg i 15 min ved 4 ° C. Blandingen skiller seg i tre forskjellige faser. RNA er utelukkende i den fargeløse øvre vandige fase.
        4. Å være particularly imidlertid fjerne bare den vandige fasen og overføre denne fase inn i et nytt rør for å fortsette med RNA-isolering. Legg 500 mL isopropanol til røret som inneholdt den vandige fase. Rist røret forsiktig for hånd. Inkuber prøven ved RT i 10 min. Sentrifuger prøven ved 12 000 xg i 10 min ved 4 ° C.
          MERK: Etter at prøven blir sentrifugert, er det mulig å se den RNA, som danner en gel-lignende pellet på siden og på undersiden av røret.
        5. Fjern supernatanten fra røret, er forsiktig med å forlate pellet av RNA på bunnen. Tilsett 1 ml 75% etanol til røret. Vortex røret for hånd i noen få sekunder og deretter sentrifuger røret ved 7500 xg i 5 min ved 4 ° C.
        6. Kast etanol og lufttørker RNA pellet. Når pelleten er tørr, resuspender pelleten RNA i RNase-fritt vann (minst 10 - 50 ul) ved å pipettere løsningen opp og ned flere ganger.
        7. Bestem utbytte og renhet av RNA ved measuring absorbansen ved 260 nm og 280 nm ved hjelp av et spektrofotometer. Evaluere integriteten av det totale RNA på standard 1% agarosegel. Oppbevar RNA ved -80 ° C.
      2. Omvendt polymerasekjedereaksjon
        1. Syntetisere første tråds cDNA fra 500 ng RNA prøver ved hjelp av en omvendt transkripsjon kit. Tine RNA prøver på is og tine de nødvendige løsninger som inngår i settet på RT. Fortsett å syntetisere cDNA følgende produsentens protokoll.
      3. Semi-kvantitativ revers transkriptase-polymerasekjedereaksjon (RT-PCR)
        1. Utføre alle PCR ved å bruke 1 pl cDNA for hver prøve som en templat i et endelig reaksjonsvolum på 24 ul. Bruk primersekvensene som er oppført i tabell 1 for amplifikasjon av Nanog, oktober 3/4, SOX2 og CD133 gener.
        2. Separer RT-PCR-produkt til 1,8% agarose-gel-elektroforese og flekken med etidiumbromid. Foto under UV Illumination.

Representative Results

OS-prøvene oppnådd ved nål aspirasjon eller kirurgisk fjerning av en liten del av tumoren (figur 1 A, B) tillater isolering av bare ett OSA hvis behandlet nøyaktig som beskrevet i protokollen seksjonen (figur 2A, B). Dessverre, er det antall celler isolert fra biopsier lav, med et utgangs området fra 30 - 50%. Utgangen er avhengig av type og dimensjon av biopsier (figur 5A, B). Disse cellene må behandles nøyaktig. Følgelig er omtrent en måned er nødvendig for den primære kulturene for å oppnå konfluens i en 100 mm petriskål. Etter denne tid blir OSA oppnådd fra to prøver merket OS OSA5 og OSA6 (figur 6A, B). Deretter, er det nødvendig å subkultur den primære cellelinje for å oppnå et tilstrekkelig antall celler for å utføre karakterisering analyse og for å cryopreservere cellen lines. På den 3. passasje av subkultur, når begge OSA primære cellelinjene når sammenflyting, blir de sådd ut i 6-brønns ultralave festeplater for sarcosphere analysen. Denne type plate blir brukt fordi det tillater oss å opprettholde celler i en suspendert tilstand, for å hindre at stamceller fra feste-mediert differensiering, for å hindre at forankringsavhengige celler å dele seg, og til slutt, for å redusere festing til substratet. Derfor, tillater deres anvendelse oss med en stresstilstand for kreftcellene, noe som er nødvendig for valg av cscs. Ved 24 timer etter starten av analysen, vises celler isolert fra hverandre (figur 7). Etter 7 dager for å overvåke progresjonen av analysen, har små sfæriske kolonier begynt å danne og er synlige (figur 8). Ved 28 d, kan flere store kuleformede kolonier som er dannet i hver brønn bli observert (figur 9A, B). Etter sarcospheres have blitt dyrket i 28 dager, kan disse store kuleformede kolonier isoleres. Figur 10 viser trinnene for isolering sarcospheres fra 6-brønners ultralave festeplatene og reculturing dem under adherente betingelser. Figur 11 viser de flytende kuleformede kolonier etter isolering. De store kuleformede kolonier belagt i normale festeplatene viser vedhengende utvidelse etter isolering (figur 12A, B). Celler som utvider fra enkelt sarcospheres er sannsynligvis kreftceller med stamcelleliknende fenotype. Derfor, etter isolering, OS-cscs ble trolig oppnådd. Disse cellene er oppkalt OSA5-cscs og OSA6-cscs (figur 13A, B).

På dette punkt, er det nødvendig å fortsette med den karakteriseringen av stamcelle-lignende fenotype for de to OS-CSC linjer som oppnås, slik som beskrevet ovenfor. Analysene for karakterisering av stamcelle-lignende fenotype were utført på 4 th passering av subkultur etter sarcospheres for hver OS-CSC linjen ble isolert. De to cellelinjer, OSA5-cscs og OSA6-cscs, viste sterk positivitet for overflate MSC markører (CD105 og CD44) (figur 14A, B og figur 15A, B), mens de viste moderat positivitet for overflaten MSC markør Stro- 1 (figur 16A, B). Våre observasjoner er bekreftet av negative resultater oppnådd med den kommersielle og differensiert tykktarmskreft cellelinje HCT8 (figur 14C, Figur 15C, figur 16C). En total mangel av spesifikk og ikke-spesifikk farging for disse overflatemarkører i HCT8 cellelinjen ble observert.

For å evaluere MSC fenotype av de to OS-cscs, vi også utført flowcytometrisk analyse. Både OS-CSC linjer uttrykte høye nivåer av CD44 og CD105. Imidlertid, av cellene i begge cellelinjer, uttrykt bare 1,14% Stro-1. Derfor er denne reSult bekreftet moderat nærvær av Stro-en som demonstrert ved immunfluorescens farging. I kontrast, 99,62% av OSA5-cscs uttrykt CD44 og 87,38% av disse cellene uttrykte CD105; 99,88% av den OSA6-cscs uttrykte CD44 og 95,79% av disse cellene uttrykte CD105. I tillegg er begge cellelinjer er CD45-.

Vi vurderte uttrykk av 3 MGP markører (Nanog, Oct 3/4, Sox2) og av CD133 genet, en annen cscs markør, ved RT-PCR. Vi la merke til at alle disse genene ble uttrykt i begge OS-CSC linjer (figur 17). De adipogenic og osteogene differensieringsanalyser viste kapasiteten av begge isolerte OSA-CSC linjer til å differensiere til osteoblaster (figur 18A - D og Figur 19A - D) og inn i adipocytter (figur 20A - D).

Videre er det en CFU ssay (figur 21) viste en god hastighet på klonogene effektivitet, med 13% for OSA5-cscs og 14% for OSA6-CSC. Flere nyere studier har vist at høye nivåer av ALDH-aktivitet er karakteristisk for forskjellige typer av kreft. Denne parameteren kan bli brukt som en kreftstamcelle markør og er korrelert med en dårlig prognose. Den ALDH aktivitetsanalyse viste at begge OS-CSC linjer har høye nivåer av ALDH-aktivitet (figur 22), mens ALDH-aktivitet ble observert ved den laveste målbare grense på fibroblast-linje som ble brukt som en negativ kontroll i denne analysen.

Figur 1
Figur 1. Eksempler på OS biopsiprøver. (A). Biopsiprøve innhentet av nål aspirasjon. (B). Biopsiprøve erholdt ved kirurgisk fjerning av en del av tumoren.884 / 53884fig1large.jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Mekanisk Disaggregering en OS Sample. (A) Fragmentering av en prøve ved hjelp av Perry pinsett og en lansett. (B) Fragmenter suspendert i CM (indikert med pil). Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Utstyr og forbruksvarer Trengs for å isolere Sarcospheres. (A). Alt utstyret som er nødvendig for celleisolasjon. 1. En steril sprøyte med et sterilt membranfilter holderen; 2. To ulike medier: GM ennd SCGM; 3. En steril glass Pasteur pipette. (B) Detalj av sprøyten montert på en støtte, med membranfilterholderen. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. filtreringsenhet. Flere komponenter som trengs for å montere filtreringsenheten (A) (netto filteret er indikert med pilen). Fasekontrast observasjon av de 40 um masker (mesh en er indikert med pilen) i den nettfilteret (B). Original forstørrelse: 10x. Filtreringsenheten montert (C - D). Filtrering enhet sterilisert (E). Klikk her for å se et større version av dette tallet.

Figur 5
Figur 5. primære cellekulturer til Konvensjonell OS. Fase kontrast observasjon av primære cellekulturer av høy klasse OS. I (A), flere lyse benfragmenter er synlige, mens i (B), flere små avrundede og flytende erytrocytter er til stede. Original forstørrelse: 10x. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 6
Figur 6. Konvensjonell Osteosarkom Finite cellelinjer (OSA). (A) OSA5 og (B) OSA6. Observasjon i fase kontrast.Original forstørrelse: 10x. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 7
Figur 7. Sarcosphere Assay av OSA5 og OSA6. Etter 24 timer fra starten av analysen, ble cellene flytende og isolert fra hverandre (-celler er angitt med pilene). Observasjon i fase kontrast. Original forstørrelse. 20X Klikk her for å se en større versjon av dette tallet.

Figur 8
Figur 8. Sarcosphere Assay av OSA5 og OSA6 ved 7 D. 7 d inn i analysen, flere små kuleformetl kolonier omgitt av enkeltceller kunne observeres. De sarcospheres (noen av disse sarcospheres er angitt med piler) vises som flyter i mediet eller svakt slo seg ned i bunnen av brønnen. Observasjon i fase kontrast. Original forstørrelse: 20X. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 9
Figur 9. Sarcosphere Assay av OSA5 og OSA6 ved 28 D. Etter 28 d, blir flere store rav sarcospheres observert i hver brønn i platene for hvert OSA cellelinje, OSA5 (A) og OSA6 (B). Bar Størrelse: 100 mikrometer. Klikk her for å se en større versjon av dette tallet. </ P>

Figur 10
Figur 10. passasjer for isolering av Sarcospheres Trinnene for å isolere sarcospheres fra 6-brønnen ultra-lave festeplater og deres reculturing henhold tilhenger vilkår er vist (A) Alt utstyr som trengs for isolering..: 1. En seks-brønns ultra-lav plate med dannet sarcospheres i hver brønn, 2. sprøyte med nettet filterholderen, 3. pipette, 4. 1000 mL sterile tips, 5. 2 sterile Perry pinsett, 6. 2 annen kultur media , 7. steril Pasteur pipette 8. petriskåler. (B) Innsamling av sarcospheres. Mediet inneholdt i hver brønn blir samlet inn ved hjelp av en pipette med en steril 1000 mL spiss. (C) Samle suspensjonen i sprøyten. Det oppsamlede Suspensjonen ble overført til sprøyten for å starte den naturlige filtreringsprosessen ved å brukemembranfilterholderen. (D) Naturlig filtrering. (E) Demontering av membranfilterholderen fra sprøyten. Tross alt filtreres suspensjonen er netto filterholderen tatt fra hverandre og satt i en petriskål; (F) Demontering membranfilter holderen. Sarcospheres inneholdes i porene i nett filteret i nettet filterholderen, slik at de må bli frigjort ved hjelp av de Perry pinsett. (G, H) Fjerning av sarcospheres fra membranfilter. Klikk her for å se en større versjon av dette tallet.

Figur 11
Figur 11. Sarcosphere Isolation. Isolerte sarcospheres flyter i mediet i 60 mm petriskål. Observasjon i fase-kontrast.Original forstørrelse: 40X. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 12
Figur 12. Sarcosphere etter isolering. Sarcospheres fra OSA5 (A) og OSA6 (b) cellelinjer ved begynnelsen av heftende ekspansjon etter gjeninnføring og reculturing i et monosjikt i henhold til adherente betingelser ved 48 timer etter isolering. Observasjon i fase-kontrast. Original forstørrelse: 20X. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 13 Figur 13. Sarcospheres på 7 D etter isolering. Sarcospheres fra OSA5 (A) og OSA6 (b) cellelinjer viste tilhenger ekspansjon etter gjeninnføring og reculturing i et monosjikt i henhold til adherente betingelser ved 7 dager etter isolering. Observasjon i fase-kontrast. Original forstørrelse: 20X. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 14
Figur 14. Immunfluorescens Fargings for CD105. Immunofluorescens farging for CD105 i OSA-CSC linjer OSA5-cscs (A) og OSA6-cscs (B) og i den kontinuerlige cellelinje HCT8 (C), som ble anvendt som en negativ kontroll. LSCM i konvensjonelle farge: Green for CD105 og rødt for cytoskjelettet. Original forstørrelse: 10x. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 15
Figur 15. Immunfluorescens farging for CD44. Immunofluorescens farging for CD44 i OSA-CSC linjer OSA5-cscs (A) og OSA6-cscs (B) og i den kontinuerlige cellelinje HCT8 (C), som ble anvendt som en negativ kontroll. LSCM i vanlige farger: grønt for CD44 og røde for cytoskjelettet. Original forstørrelse: 10x. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.


Figur 16. Immunfluorescens farging av Stro1. Immunofluorescens farging for Stro-1 i OSA-CSC linjer OSA5-cscs (A) og OSA6-cscs (B) og i den kontinuerlige cellelinje HCT8 (C), som ble anvendt som en negativ kontroll. LSCM i vanlige farger: grønn for Stro-en og rødt for cytoskjelettet. Original forstørrelse: 10x. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 17
Figur 17. Expression of Nuclear MGP Markører og av CD133 Gene. RT-PCR viser uttrykk for Nanog, Oct 3/4, Sox2 og CD133 i OSA5-cscs (A) og i OSA6-cscs ( Klikk her for å se en større versjon av dette tallet.

Figur 18
Figur 18. osteogene Differensiering Assay -. ALP osteogene differensiering ved 0 d (A, B) og etter 10 d (C, D) av induksjon som bestemt ved cytokjemiske farging for ALP ved hjelp av vaskeekte blå BB. I blå, ALP + celler; i rødt, kjernen kontra med propidiumjodid. Kompositt observasjon i lysfelt og i fluorescens. Original forstørrelse: 20X. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 19 Figur 19. osteogene Differensiering Assay -. HA osteogene differensiering ved 0 d (A, B) og etter 20 d (C, D) av induksjon som bestemt ved cytokjemiske farging av hydroksyapatitt (HA) med Alizarin Red S Cellene blir kontrastert blå / grå og kornete forekomster av HA er farget i rødt. Observasjon i fase kontrast. Original forstørrelse: 40X. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 20
Figur 20. Adipogenic Differensiering-analysen. Adipogenic differensiering ved 0 d (A, B) og etter 14 d (C, D) av induksjon som bestemt ved cytochemical farging med Oil Red O. I rødt, de lipidic vesikler (de større vesikler er angitt med svart / røde pilene, de mindre vesikler er indikert med de hvite / sorte piler); i blå / fiolett, kjernene kontra av haematoxylin. Observasjon i lysfelt. Original forstørrelse: 40X. Bar størrelse. 100 mikrometer Klikk her for å se en større versjon av dette tallet.

Figur 21
Figur 21. CFU analysen. CFU analyse av OSA-CSC linjer farget med toluidinblått. Klikk her for å se en større versjon av dette tallet.

Figur 22 /> Figur 22. ALDH aktivitetsanalyse. Den ALDH kolo analysen oppdaget høye nivåer av ALDH aktivitet i de to OS-CSC linjer, OSA5-cscs og OSA6-cscs, mens analysen oppdaget fraværet av denne aktiviteten i det endelige differensiert cellelinje av fibroblaster, FIB. Feilfelt: SD. **: P <0,001 vs FIB; *: P. <0,01 vs FIB Klikk her for å se en større versjon av dette tallet.

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
Gene oligonukleotider Sequence (5¹-3¹) Amplikon størrelse (bp) Tₐ (° C)
Nanog Forward primer Reverse primer 87 60
oktober 3/2 Forward primer Reverse primer GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 Forward primer Reverse primer TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 Forward primer Reverse primer CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
bp, basepar av amplicon størrelse, Tₐ, avspenningtemperatur

Tabell 1. detaljert liste over Primer sekvenser for Nanog, Oct 3/4, Sox2 og CD133 med Amplicon Størrelse og glødetemperaturen

Discussion

Cscs har flere egenskaper som tillater identifikasjon av denne spesielle cellulære undersett i tumoren bulk. På bakgrunn av disse egenskapene, slik som ervervet resistens overfor cytotoksiske kjemoterapeutiske midler for overekspresjon av ATP-bindende kassett multilegemiddel efflux transportører 28, 32, 33, eller for oppregulering av ekspresjonen av avgiftning enzymer så som ALDH 32, for ekspresjon av en spesiell overflatemarkør, slik som CD133, CD44, CD34, CD90, og andre 30, 34, 35, 41, flere ulike metoder for å isolere cscs er blitt utviklet 42-44. En av disse teknikker er den sfære-analysen, som er basert på kapasiteten til cscs til å vokse under ikke-adherente betingelser.

Evnen av vev stamceller og cscs for dannelse av sfærer ble først beskrevet i studier på identifisering av nevrale stamceller av Reynolds et al., 37. Deretter Gibbs et al. 38 ossed disse studiene til å begynne å isolere cscs fra solide tumorer, spesielt fra bensarkomer. Vi har besluttet å bruke kula dannelsen analysemetoden illustrert av Gibbs et al. Å isolere cscs fra OSA cellelinjer hentet fra konvensjonelle OS biopsier. Vi tilpasset den opprinnelige metoden for å forbedre resultatene fra denne analysen og for å lette dens reproduserbarhet for andre cancercellelinjer. Med henvisning til etablering av kulen formasjonen assay bekreftet vi at plette 40.000 celler / brønn er en god praksis for å opprettholde celler i isolasjon ved begynnelsen av analysen. Det lure er meget viktig for å unngå muligheten for at de kuleformede kolonier stammer fra cellulær aggregering og ikke fra den spesielle og eksklusive kapasiteten til en enkelt CSC til å vokse under ikke-adherente betingelser og danner en sfærisk koloni. Denne evnen er et spesielt kritisk punkt i denne analysen.

Vi har også sertifisert at for å oppnå en god hastighet på kula formasjonEr det tilstrekkelig å oppdatere alikvoter av vekstfaktorer hver 3 d og ikke hver dag, som beskrevet i den opprinnelige metoden. I denne studien vi også etablert og omfattende beskrevet en god metode for å isolere de kuleformede kolonier som dannes når dyrket under ikke-adherente betingelser. Dette trinnet er kritisk i denne undersøkelse fordi det er meget viktig å forsøke å isolere så mange av de kuler som mulig som er dannet i hver brønn uten å skade dem. Det er også viktig å isolere bare kulene og ikke de enkelte celler, som kan forbli i suspensjon i løpet av analysen. For å overvinne disse kritiske punkter, har vi utviklet en spesiell isolasjonsmetoden, som, som vist ovenfor, ga gode resultater for CSC isolasjon. Selvfølgelig, er det mulighet for at ikke alle kulene som dannes kan utvinnes, men tapsprosenten er meget lav. Faktisk har vi også muligheten til å bruke et filter med 40 mikrometer porer å isolere kuler etter at de blir store (skjemaed ca 100-200 celler).

Denne isolasjonen stopper sfære formasjon, men gjør det mulig for enkeltceller, en del av methylcellulose residuet, og de minste kulene som skal filtreres. Denne eliminering utføres ved grundig filtrering som beskrevet i protokollen.

Dessuten er valget av de største sfæriske koloniene gjennom 40 pm sikt med derav følgende tap av de minste koloniene sfæriske gjør det mulig å velge de cscs med den høyeste evne til å danne kuleformede kolonier og med større stemness. Alle disse modifikasjoner ble utført for å forbedre analysen og for å hjelpe forskere studert cscs å forstå og reprodusere de mest kritiske trinn av den opprinnelige metoden av kulen formasjonen analysen.

Blant studier om in vitro-metoder for å isolere cscs, denne studien forsøkte å vise hvordan dette tilpasses sfære-analysen kan være en god metode for å isolere cscs fraOSA-cellelinjer. Tilpasningene til den opprinnelige metoden og den detaljerte isolasjon teknikk som er beskrevet forbedre dens effektivitet. I løpet av kort tid, kan godt antall cscs oppnås og brukes for flere forsøk. Derfor er det mulig å raskt få bekreftet stammen lignende fenotyper og, spesielt, for å studere den doble stilk-lignende fenotype som karakteriserer OS-cscs. Således kunne denne modifiserte analysen være en god teknikk for å isolere cscs og studere deres biologi. I fremtiden denne metoden, med ytterligere tilpasninger, kan også brukes til å isolere cscs fra andre begrensede kreftcellelinjer oppnådd ved biopsi av sjeldne solide tumorer.

Muligheten for å isolere cscs fra sjeldne faste tumorer, for eksempel OS, ikke bare tillater forbedring av studier om dette spesielt kreft, men også strekker seg til studier av ulike typer av kreft for å utvikle bedre fremgangsmåter for deres isolering og til fremtidige studier av biologien denne viktige cellulære undergruppe. Derfor, som vihar gjort i denne studien, er det viktig å forbedre metodene for CSC isolasjon gjennom studiet av CSC biologi, med det endelige mål å finne molekylære mål og å utvikle en meget spesifikk anticancerterapi rettet mot denne cellular undergruppe, som sannsynligvis er ansvarlig for opprettholdelse av primærtumor, utvikling av gjentagelse, og opprinnelsen av metastaser i flere organer. Studiet av CSC biologi er også viktig for å finne behandlingsformer som kan være skarpt i helbredelse av kreft, for eksempel OS, som overlevelse etter neoadjuvant behandling er fortsatt svært dårlig.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics