Kanser kurulması İnsan Konvansiyonel Osteosarkom Hücre Kültürleri Kök

Cancer Research
 

Summary

Kemik sarkomlarda kanser kök hücrelerinin varlığı (rulmanları) son zamanlarda onların patogenezi ile bağlantılı olmuştur. Bu makalede, yapışmayan koşullarda büyümeye CSCS yeteneğini kullanılarak geleneksel osteosarkoma (OS) insan biyopsilerinden elde edilen birincil hücre kültürlerinden CSCS izole sunulmuştur.

Cite this Article

Copy Citation | Download Citations

Palmini, G., Zonefrati, R., Mavilia, C., Aldinucci, A., Luzi, E., Marini, F., Franchi, A., Capanna, R., Tanini, A., Brandi, M. L. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. J. Vis. Exp. (116), e53884, doi:10.3791/53884 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

osteosarkom (OS) karşı tedavide güncel gelişmeler kanser hastalarının hayatlarını uzun süreli, ancak metastaz meydana geldiğinde beş yıl hayatta kalma oranı yetersiz kalmaktadır. Kanser Kök Hücre (CSC) teorisi tümörü korumak ve çoklu ilaç kemoterapi karşı kapasitesi dahil olmak üzere kök benzeri özelliklere sahip tümör içindeki tümör hücrelerinin bir alt kümesi olduğunu tutar. Bu nedenle, işletim sistemi biyoloji ve patogenezi daha iyi anlaşılması bu özel alt kümesini ortadan kaldırmak için ve hastalar arasında morbidite ve mortalitenin azaltılması için hedeflenen tedavilerin gelişimini ilerletmek için gereklidir. , CSCS Yalıtımlı CSCS hücre kültürleri kurulması ve onların biyoloji okuyan OS biyoloji ve patogenezi daha iyi anlamamızı sağlayan önemli adımlardır. OS biyopsileri insan kaynaklı OS CSCS kurulması nonadhere altında 3 boyutlu kök hücre kültürleri oluşturmak için kapasite de dahil olmak üzere çeşitli yöntemlerle mümkün olmuşturnt koşulları. Bu koşullar altında, CSCS kızı kök hücreler tarafından oluşturulan küresel yüzen koloniler oluşturmak edebiliyoruz; Bu koloniler "hücresel küreler" olarak adlandırılmaktadır. Burada, işletim biyopsi elde edilen geleneksel OS'nin primer hücre kültürlerinden CSC kültürleri kurmak için bir yöntem açıklanmaktadır. Biz açıkça CSCS izole etmek ve karakterize etmek gerekli birkaç pasajlar açıklanmaktadır.

Introduction

Sarkomlar embriyonik mezodermden 1 ağırlıklı olarak köken nadir görülen malign bağ dokusu tümörleri heterojen bir grup. farklı kemik sarkomu ve yumuşak doku sarkomu içerir. Kemik sarkomları, nispeten nadir primer tümörlerin grubu, osteosarkom (OS) dahil olmak üzere çeşitli alt tipleri, oluşur. OS kemiğin en sık primer tümörlerin biri, yoğun klinik, histolojik ve moleküler farklılıklarını 2, 3 sergileyen bir mezenkimal malignitedir. Ne yazık ki, OS 5, çocuklarda ve genç erişkinlerde 4 ağırlıklı olarak oluşur ve% 60 temsil çocukluk çağında kemik sarkomu ortak histolojik alt tipler 6, 7. OS genellikle etkileyen hızlı kemik büyümesi ile karakterize edilir iskelet alanlar, (örneğin, uzun kemiklerin metafiz). Ayrıca medüller veya merkezi işletim sistemi olarak adlandırılan işletim sistemi, geleneksel işletim sistemi, histolojik farklı alt tipleri arasında, malignite yüksek dereceli ve kota SHA vardır% 80, 8: Yeniden. Bu% 80% 60, geleneksel osteoblastik OS,% 10 kondroblastik OS ve 10% fibroblastik OS 6, 8-10 oluşmaktadır. Diğer işletim alt tipleri anaplastik, telenjiektazik, dev hücre açısından zengin ve küçük hücreli OS sayılabilir. Kombine cerrahi ve OS yönetimindeki kemoterapi ilerlemelere rağmen, sonuç metastazı 11, 12 olmayan hastalarda% 65-70 arasında bir uzun süreli sağkalım oranı ile, zayıf kalmaktadır. Uzak nüks sık metastaz olarak, ya da, daha az sıklıkla akciğer metastazları olarak ortaya uzak kemikleri ve lokal nüks 13. Metastaz, genellikle geleneksel tedavilere karşı dirençlidir. Bu direnç 10 yıllık hastalıksız sağkalım tanı 14, 15 metastatik hastalığı olan hastalarda yaklaşık% 30 olmasının nedeni de budur.

Normal doku ile de, kanser, doku hücre tipleri heterojen bir toplanması oluşmaktadır. tümör içindeki hücrelerin farklı gelişim aşamalarında karşılık görünüyor. her bir N içindeormal dokusu ve böylece doku homeostazında için progenitörleri ve olgun hücreler sağlayan selfrenew yeteneği ile hücrelerin bir alt bulunur. Benzer bir şekilde, kanser çoğalması ve tümör oluşturucu potansiyeli farklı derecelerde, farklı gelişim safhalarında hücrelerin benzer bir heterojen popülasyonda oluşmaktadır. Bu, kanser hücrelerinin bir alt kümesi, Cancer kök hücreler (rulmanları), tümör kitlesinin 16 oluşturan farklı hücre soyları bu nedenle, tümör malign potansiyelini selfrenew ve korumak için özel bir yetenek ile hücrelerin selfsustaining üreten bir rezervuar oluşturan olarak adlandırılır. 1990'lı yıllarda, akut myeloid lösemi çalışmaları CSC alt popülasyonlar 17, 18 varlığı için ilk güçlü kanıtlar sunmuştur. CSCS beri böylece kanser araştırmalarında en çok araştırılan konulardan biri haline solid tümörlerin 19 çok sayıda izole edilmiştir. CSCS gerçekten normal bir hale genlerdeki mutasyonlarla, normal kök hücrelerinin doğabilecek20-23 kanserli kök hücreler. mikroçevresinin ile birden dönüştüren mutasyonlar ve etkileşimleri de CSCS simgelemek selfrenewal kapasite ve ölümsüzlüğü elde sağlıklı atalarıdır ve olgun hücrelere katkıda bulunabilir. Bu dönüşümle ilgili çeşitli hipotezler vardır. Sağlıklı progenitörler sağlıklı, olgun hücreler ve kanser hücrelerinin, selfrenewal ilişkili genlerin 24-28 aktive bir mil benzeri fenotip elde edilmesi, kök hücrelerin dediferansiye olabilir. Yapılan son araştırmalara rağmen, CSCS kökenleri henüz keşfedilmeyi var.

CSCS belirgin bir özelliği, kapasite farklı ilaçlar ile birlikte cerrahi ve kemoterapi oluşur çoklu tedavi yaklaşımı, karşı olmasıdır. Son çalışmalar CSCS da kemoterapi ajanları sitotoksik sonradan dirençli hale gelebilir göstermiştir. Bu direnç için mümkün açıklamalar ATP-bağlayıcı kaset (ABC) çoklu ilaç taşıyıcı aşırı ekspresyonu dahil (yani,MDR1 ve BCRP1), örneğin aldehit dehidrogenazın 1 (ALDH1), ve / veya hücre döngüsü kinetiği 30-33 değişiklikler gibi kemoterapi metabolize edici enzimlerin aşırı. şimdiye kadar tarif edilmiştir tüm bu kavramların doğrudan sonucu CSC ICSI'nin tamamen ortadan kaldırıldı yalnızca hatta tek CSC hayatta ise lokal nüks veya uzak metastaz oluşabilir iken kanser tedavisi, verimli olacaktır olmasıdır.

Hastaların daha sonra nüks birçok tedavi başlangıçta etkili gibi görünmektedir neden olarak olası bir açıklama, ancak, çünkü insan sarkomlardan 34, özellikle OS 35 veya başka herhangi bir kemik ve yumuşak doku kanserlerinde, içinde CSCS bulunması büyük klinik öneme sahiptir. Bu nedenle, geleneksel işletim karşı gelecek savaş için umut bu alt moleküler karakterizasyonu OS-CSCS sayesinde yönelik yenilikçi ilaçların geliştirilmesi dayalı yeni ve özel hedefli tedaviler bulmak içinNüfus ve CSC biyoloji çalışmaya.

1992 yılında, kök hücrelerinin bir alt kümesi, yetişkin memeli beyninde mevcut olup olmadığını araştıran edildi Reynolds ve arkadaşları, kök benzeri hücreler 36, 37 olduğundan şüphelenilen hücreleri izole etmek için bir yöntem geliştirdi. Bu yöntem özellikle yeteneğine dayanır yapışmayan koşullar altında yetiştirilen bu hücreler küresel koloniler oluşturmak için. Benzer teknikler kemik sarkomlarında 38 kök benzeri hücrelerin bir ICSI'nin incelemek için 2005 yılında Gibbs ve arkadaşları tarafından istihdam edildi. izole edilmesi ve geleneksel bir işletim sisteminin farklı türde birincil hücre kültürlerinden OS CSCS karakterize etmek için, işletim hücre hatları için bu tekniği adapte verdi.

Burada, alışılmış OS insan biyopsilerinden elde edilen sonlu birincil hücre hatları OS CSCS izole etmek için kullanılabilir "sarcosphere deney" olarak adlandırılan alan oluşum analizinde uyarlanmış bu yöntem, tarif eder. Biz de tüm teknikleri u tarifBu deneyde ile izole edilmiş hücre çizgilerinin mil benzeri CSC fenotipi doğrulamak sed: ve CSCS bir göstergesi olan CD133 geninin) pluripotent kök hücreleri (ESCs karakterize genlerin sentezlenmesinin 1) değerlendirilmesi; 2) koloni oluşturan birimi (CFU) deneyi; 3), uygun koşullar altında farklılaşma osteoblast ve adipositlere ayırt etmek için, bu hücrelerin yeteneğinin değerlendirilmesi; Immünofloresan boyama ile ve akım sitometri analizi ile Mezenkimal Kök Hücre yüzey belirteçleri (MKH) (yani, CD44, CD105 ve Stro-1) 4) çalışması; Bu hücrelerin ALDH aktivitesinin 5) değerlendirilmesi.

Protocol

Burada açıklanan insan dokuları kullanılarak tüm deneyler için yerel etik kurul (Rif. N. 141/12) tarafından onaylandı. doku örneklerinin toplanması için numune kullanım ve saklama için onay AOUC de vericilerden elde edilmiştir.

Kültür 1. Hazırlık

  1. % 10 Fetal Sığır Serumu (FBS), 100 lU / ml penisilin ve 100 ug / ml streptomisin Coon modifiye Ham F12 ortamı eklenerek büyüme kültür ortamı (GM) hazırlayın. Filtre ve 0.22 um filtre kullanılarak GM sterilize edin. 1 aya kadar 4 ° C'de saklayın GM.
  2. Coon modifiye Ham F12 ortamı için% 20 FBS, 100 lU / ml penisilin, 100 ug / ml streptomisin ve 3 mg / ml kollajenaz tip II ekleyerek kolajenaz madde () hazırlayın. Filtre ve 0.22 mikron filtre kullanılarak CM sterilize edin. 1 aya kadar -20 ° C'de saklayın CM.
  3. % 40 FBS ekleyerek (FM) dondurma hücre için orta hazırlayın, 100 lU / ml penisilin, 100 ug / ml streptomisin ve 6Coon modifiye Ham F12 ortamı .5% dimetilsülfoksit (DMSO). Filtre 0.22 mikron filtre kullanılarak FM sterilize ve. 1 aya kadar 4 ° C'de saklayın FM.
  4. Coon modifiye Ham F12 ortamı için% 20 FBS, 100 lU / ml penisilin ve 100 ug / ml streptomisin eklenmesi ile CFU tahlili (CFUM) için hazırlarlar. Filtre 0.22 um filtre kullanılarak CFUM sterilize ve. Mağaza CFUM 1 aya kadar 4 ° C'de.
  5. Mi Dulbecco Fosfat Tamponlu Salin (DPBS) 2 + Ca + 2 ve Mg olmayan 1.000 glikoz anhidre - 400 mg tripsin, 200 mg EDTA ve 1000 mg D (+) çözülmesiyle tripsin hazırlayın.
    Not: 3 aya kadar, -20 ° C de 0.22 mikron filtre ve dondurma kullanılarak 25 cm, 50 ml alikotları 2 şişe taze tripsin-EDTA bölün. Mağaza aktivite kaybı olmadan 4 ° C sıcaklıkta filtre ile sterilize alikotları çözülmüş.
  6. 100 lU / ml penisilin, 100 ug / ml streptom% 10 FBS ekleyerek kök hücre büyüme ortamı (SCGM) hazırlanmasıCoon modifiye Ham F12 ortamına İçin, ve 10 ng / ml bFGF (25 ug / ml stok). 4 ° C'de 2 hafta kadar bir 0.22 mikron filtre ve mağaza SCGM kullanılarak SCGM filtre.
  7. 3 gün 4 ° C'de ultra saf H2O MC çözülmesiyle% 2 metilselüloz (MC) hazırlayın. MC tamamen çözülür, otoklav ve 4 ° C'de depolayın.
    NOT: MC sterilize edilir sonra bir katı haline gelir. 4 ° C'de sıvı devlet, mağazaya MC getirmek için.
  8. sarcosphere büyüme ortamı (SGM) hazırlayın. 100 ug / ml insan bFGF (25 ng / ml stok), 100 lU / ml penisilin ekleyerek bu madde, taze su (en fazla 2 hafta kullanımdan önce) hazırlayın, 20 nM progesteron (10 uM stok), 100 uM putresin, 30 nM sodyum selenit (30 uM stok), 25 ug 2X / ml transferin (25 mg / ml stok), 20 ug / ml insülin (20 mg / ml stok) ve 10 ng / ml insan EGF (10 ng / ml stok) Coon'un Ham F12 ortamı değiştirilmiş. Filtre ve 0.22 um fil ile SGM sterilizeter. 4 ° C 'de 2 hafta saklayın.
  9. (% 10 FBS (Güney Amerika menşeli), 100 lU / ml penisilin / ml streptomisin, 10 nM deksametason (100 uM stok), 100 ug, 0.2 mM sodyum L-askorbil-2-fosfat eklenerek 1 osteojenik ortamı (OM) hazırlanması M stok), Coon modifiye Ham F12 ortamı 10 mM β-gliserofosfat (5 mg / ml stok) ve 1 ug / ml kalsein (200 ug / ml stok). Filtre 0.22 mikron filtre kullanılarak OM sterilize ve. 4 ° C'de saklayın.
    NOT: Sıvı azot altında saklayın deksametazon stok çözeltileri faaliyetlerini sürdürmek için. orta farklılaşması potansiyeli sağlamak için deksametazon aktivitesi sağlamak için her 2 haftada bir taze OM hazırlayın.
  10. , 1.66 mg NH 4 Cl çözülerek 0.2 mg K 2 HPO 4 ve 200 ml 0.007 mg EDTA distile su (dH 2 O) eritrosit lizis tamponu (ELB) hazırlayın. Filtre ve 0.22 mikron filtre kullanılarak ELB sterilize edin. 4 ° MağazaC.
  11. ekleyerek adipojenik ortamı (GM) hazırlanması% 10 FBS (Güney Amerika menşeli), 100 lU / ml penisilin, 100 ug / ml streptomisin, 1 uM deksametazon (1 mM), 1 uM sığır insülini (10 mM stok), 0.5 mM izobütil (IBMX) (500 mM stok) ve Coon modifiye Ham F12 ortamında 100 uM indometasin (200 mm). Filtre ve 0.22 mikron filtre kullanılarak AM sterilize edin. 4 ° C'de saklayın.
    NOT: Sıvı azot altında saklayın deksametazon stok çözeltileri faaliyetlerini sürdürmek için. orta farklılaşması potansiyeli sağlamak için deksametazon aktivitesi sağlamak için her 2 haftada bir taze PM hazırlayın.
  12. Hazırlama% 2 DPBS Sığır Serum Albumin (BSA) (BSA / DPBS). 500 mi DPBS 10 g BSA çözülür ve 50 ml konik tüp 50 ml stok çözeltisi aliquotting ile stok çözelti hazırlayın. -20 ° C'de saklayın.
  13. DPBS (PFA / DPBS) içinde% 4 paraformaldehit (PFA) içindeki bir çözeltisi hazırlandı. Bir chemical kaput, DPBS paraformaldehid sulandırmak ve 50 ml konik tüpler 50 ml stok solüsyonu aliquotting ile stok solüsyon hazırlanır. 4 ° C'de saklayın.

2. (OSA) Birincil OS Hücre Kültürleri ve OS Sonlu Hücre Hatları oluşturulması

Not: Primer OS hücre kültürleri "Unità Ortopedia Oncologica e Ricostruttiva" AOUC Careggi, Florence toplanan geleneksel işletim biyopsi, yeni numunelerden hazırlanmıştır. İğne aspirasyonu veya tümörün (Şekil 1A, B) arasında küçük bir kısmının cerrahi rezeksiyon ile elde edilmiş tüm biyopsiler hemen 100 IU / ml penisilin ve 100 ug / ml streptomisin (pH 7.4) ile takviyeli kültür ortamında yerleştirilmiştir onlar işlendi laboratuara nakletti. Tüm açıklanan manipülasyonlar laminer akış kaput kullanarak aseptik şartlarda gerçekleştirilmiştir.

  1. İşletim hücrelerinin izolasyonu
    1. Bir biyopsi yerleştirinGM küçük bir hacme 100 mm Petri kabı. Steril bir bisturi ve Perry cımbız ile, mümkün olduğunca küçük parçalar halinde keserek OS doku örnekleri kıyma (0,5-1 mm) (Şekil 2A, B).
    2. Enzimatik sindirme (Şekil 2B) 10 mi CM doku parçaları örtün ve 37 ° C,% 5 CO2 inkübatörü içinde, 3 saat süreyle inkübe edin. Yavaşça pipet kullanarak parçalarının askıya çıkarmak ve parçalar topak haline derhal santrifüj (5 dakika boyunca 400 xg) için 15 ml konik tüp aktarın.
      Not: biyopsiler eritrosit zengin ise Santrifüj işleminden sonra, eritrositlerin oluşan kırmızı yatırma parçaları üzerinde görülebilir. Bu nedenle, mekanik dağılım geçmeden önce, eritrosit lizis tamponu ile örnek davranın. Aspirasyon ile süpernatantı atın ve 5 ml ELB ekleyin.
    3. 1 dakika boyunca pelet parçaları Askıya ve 2 400 xg'de süspansiyon santrifüjMin. Aspirasyon ile süpernatantı. 20 kez - 10 ml serolojik pipet (açılış boyutu, 1.5 mm iç Ø) 10 kullanılarak fragmanlar dağıtmak mekanik 5 ml GM ekleyin.
    4. 5 dakika boyunca 400 x g'de süspansiyon santrifüj. , Aspirasyon ile süpernatantı 10 ml GM ile hücre pelet askıya ve daha sonra 100 mm Petri kabı içine çıkan hücre süspansiyonu aktarın. 37 ° C,% 5 CO2 inkübatör Petri kabı inkübe ve taze tam GM her 3 gün ile GM değiştirin.
      NOT: Oldukça sık, iğne aspirasyonu ile elde edilen OS doku örnekleri kollajenaz ile enzimatik sindirme ile sindirilir değil kemik parçaları, çok küçük ve içerirler. Süpernatan çıkarıldıktan sonra, bu nedenle, bir pipet ile pelet fragmanları ezme kemik dokusu hücreleri ayırmak için çalışır.
  2. alt kültür
    NOT:
    Hücreler yaklaşık izdiham ulaştığınızda bir OSA kurmak için, thei bunları kaldırmakr kültür gemi, sulandırmak ve daha fazla büyüme sağlamak için yeni bir plaka yerleştirmek. Bu altkültür prosedürü trypsinization adlandırılan enzimatik prosedür kullanılarak elde edilir.
    1. Aspirasyon ile orta çıkarın. - (20 ° C max 18) hafifçe bir kez sallayın ve aspirasyon ile hemen tripsin kaldırmak oda sıcaklığında 3 ml tripsin - hücre tek tabaka ayırmak, 2 ekleyin. İki kez tekrarlayın. onlar ayırmak alıncaya kadar 4 dakika - 3 37 ° C'de inkübe hücreleri.
      NOT: İyi trypsinization çanak ışık tutulduğunda hafif opak tek tabaka oluşturan küçük delikler gibi deneyimli bir kullanıcı tarafından görülebilir. Bu ayrılma, aynı zamanda ters çevrilmiş mikroskop kullanılarak izlenebilir; Bu yaklaşım, başlayanlar için tavsiye edilir.
    2. 10 ml GM ekleyerek tripsin reaksiyonu durdurmak ve tüm hücreleri ayırmak için bir pipet kullanarak iyi çanak yıkayın. Aktarım 1 yeni bir 100 mm Petri kabı süspansiyonun mi ve 9 ml GM (hücre 1/10 bölünmüş) ekleyin.
      NOT:
  3. OS primer kültürlerinde ve OUA'nın Kryoprezervasyon
    NOT: 4-5 cryovials içine bir konfluent 100 mm Petri kabı dondurun. dondurarak saklama işlemi dondurma sırasında hücre zarlarını korumaktadır DMSO olmayan, donma sıcaklıklarında hücreler için toksik olduğundan, hızlı olmalıdır.
    1. Trypsinization tarafından tek tabaka hücre kültürleri ayırmak, 5 dakika boyunca 400 xg'de santrifüj, pelet hücreleri (Bölüm 2.2) aspirasyon ile süpernatantı kaldırmak ve daha sonra hızlı bir şekilde FM hücre pelet askıya.
    2. Kısım kriyojenik vialde Bu süspansiyona 1 ml. Hemen 2-propanol ve mağaza immedia bir ceket ile bir dondurucu kutusuna doldurulan şişeler, yertely -80 ° CO / N at. Aktarım sıvı azot uzun süreli depolama için ertesi gün cryovials.
  4. Defrost OS hücre hatları ve primer kültürlerinde
    1. Sıvı azot depolama Defrost OS hücre hatları, 37 ° C'de bir laboratuar su banyosuna yerleştirilerek hızla çözülme cryovials. 15 ml konik tüp içine cryovials içeriğini aktarmak ve GM yaklaşık 10 ml (DMSO kaldırmak için Bölüm 2.3 bakınız) ekleyin. Aspirasyon ile süpernatantı alın ve 10 ml GM hücre pelet askıya. 100 mm Petri kabındaki hücre süspansiyonu plaka ve 37 ° C,% 5 CO2 inkübatörü içinde inkübe edilir.

3. Sarcosphere Testi yalıtmak için OS CSCS

NOT: Bu deney, OKA gerçekleştirilir. Bu deney süresi, bu küre koloniler (sarcospheres) oluşturmak için hücre kapasitesi ile ilgili olarak, ve zaman aralığı 7, 14, 21 ve 28 gün olduğu edilir.

  1. estabsarcosphere tahlilinde kurulması da
    1. hemositometre odasını ve önceden tüm reaktifler hazırlayın.
    2. Aspirasyon ile orta çıkarın ve tripsinizasyonla tek tabaka hücreleri ayırmak (Bölüm 2.2). pipet herhangi kümeleri dağıtmak ve 20 uL pipet kullanarak 10 mcL toplamak için, iyice hücre süspansiyonu karıştırın.
    3. , Hemositometre odası kenarına hemen 10 uL hücre süspansiyonu transfer süspansiyon dışarı atılması ve kılcal hareket ile lamel altında çıkmasına izin verirler.
    4. Faz kontrast altında hemositometre odasını gözlemleyin. 10X objektif seçmek ve odasında ızgara hatları üzerinde durulacak. Sayma için bir yardım olarak (aynı zamanda üç paralel çizgiler bağlı) alt bölümleri kullanarak bu 1 mm 2 alanda yatan hücreleri ve tek kılavuz çizgileri sayın.
    5. Konsantrasyonu ölçmek ve aşağıdaki denklem uygulanır: (1 ml = n * 10 4 / z n: sayılan tüm hücrelerin tam sayıkareler 1 ila 2 mm; z: sayılan kareler 1 mm 2) sayısı. 6-çukurlu ultra düşük bağlanma plakanın üzerindeki çukurların her 40.000 hücrelere bölünmüş 240.000 hücre toplam miktar plaka için gerekli hücre süspansiyonu hacmi hesaplayın.
      NOT: Bir ekstra kuyuya hücreleri kaplama hücrelerin sayısını doğru plaka emin olun. Bu nedenle, kaplama için hücrelerin toplam miktarı, 280.000 hücredir.
    6. 25 cm 2 balonuna% 2 MC (SGM-MC)% 50 ilave edilerek 35 ml SGM hazırlayın. ekstra bir kuyu plaka için ekstra 5 ml göz önünde SGM toplam hacmi hazırlayın.
    7. şişede hazırlanır SGM-MC hücre süspansiyonu hesaplanan hacim ekleyin ve herhangi bir yığınının dağıtmak için bir pipet kullanılarak yavaşça karıştırın. 6-çukurlu ultra düşük bağlanma plaka, hücreler plaka ve kaplama sonra hücreler nasıl göründüğünü gözlemlemek için bir ters mikroskop kullanımı.
    8. 37 ° C,% 5 CO2 inkübatöründe inkübe hücreleri. Her 3 d, fr eklemekHer bir oyuğa bFGF ve EGF ESH alikotları büyüme faktörlerinin konsantrasyonu yenileyin. her bir 10 ng / ml nihai konsantrasyonda, her iki muhafaza 2 uL bFGF ve 5 uL EGF ekleyin.
  2. Sarcospheres İzolasyonu
    NOT: oluşturduğu sarcospheres izole etmek gerektiğinde karar 7, 14, 21, ve 28 d sarcosphere testinin iyi bir ilerleme izleyin.
    1. Laminer akış kaputu (Şekil 3A, B) tüm reaktifler ve ekipman hazırlayın. 25 mm çapında bir net filtre ve bir membran filtresi tutucusuna, 40 mikron örgü yerleştirerek filtrasyon ünitesi monte; otoklav (Şekil 4A-E) ile sterilize edin.
    2. her bir için, 1000 uL ucu ile bir steril pipet kullanılarak steril bir membran filtresi tutucusuna sahip bir şırıngaya sarcospheres içeren ortam transfer. tamamen sarcospheres içeren ortamı çıkardıktan sonra, eklenti tarafından iyice yıkayın5 ml GM ing bir şırıngaya tüm küreler aktarmak emin olmak için. Tüm sarcospheres kurtarıldı olup olmadığını teyit etmek için mikroskop kullanın. Değilse, bu adımı yineleyerek devam edin.
    3. küreler zarar görmesini önlemek için ve böylece kürelerin kaybını önlemek, filtre içinden geçen sahip sarcospheres önlemek için basınçsız yalnızca yerçekimi ile bir membran filtresi tutucusuna sahip bir süspansiyon filtre. nazikçe steril bir cam Pasteur pipeti kullanarak hava kabarcıklarını çıkarın.
      NOT: Bazen filtrasyon membran filtre tutucu bir hava kabarcığı varlığı ile engellenir.
    4. şırıngaya 10 ml GM ekleyerek ve tek hücreleri ortadan kaldırmak için emin olmak için baskı olmadan filtre vererek filtrasyon ünitesi yıkayın. şırınga filtre ünitesini ayırabilir ve bir Petri kabı içine koydu.
    5. Perry cımbız kullanarak membran filtre tutucu net filtreyi çıkarın ve 60 mm cımbız ile hafifçe sallayarak yıkayınPetri zarının arapsaçı gelen sarcospheres serbest bırakmak için. Daha sonra, bir kuyu içinde membran yerleştirmek ve membran karışık fazla küreler olduğu mikroskopik gözlem ile teyit etmektedir. küreler de membran karışık Eğer aşama 3.2.4 de tarif edildiği gibi, bir yıkama devam edin.
    6. Bir mikroskop kullanılarak serbest sarcospheres gözlemleyin. 37 ° C,% 5 CO2 inkübatörü içinde serbest sarcospheres inkübe edin. 6-çukurlu ultra düşük bağlanma plakanın her bir seyahati adımları tekrarlayın.

4. OS CSC Hatları

Not: OS-CSCS reintroducing ve ultra düşük bağlanma koşulları altında, artık 60 mm kültür kaplarına kaplanır sonra bir tek tabaka bu hücrelerin yeniden kültüre edenler tarafından yapışmış genişleme sergileyen sarcospheres elde edilir.

  1. OS CSC kültürleri
    1. Onlar 60 yaklaşık% 90 izdiham ulaştığınızda daha fazla büyüme, alt kültür hücreleri etkinleştirmek içinmm Petri kabı. Adımı tekrarlayın 2.2.1 OS CSC kültürleri kurmak.
    2. tüm hücreleri ayırmak için bir pipet kullanarak, 4 ml SCGM ekleyerek trypsinization durdurmak ve iyi yemeğin yıkayın. Yeni 100 mm Petri kabı hücre süspansiyonu aktarın ve 6 ml SCGM ekleyin. OS CSCS bölüm 2.2 tekrar ederek% 90 izdiham, alt kültür ulaştığınızda.
      Not: İzole OS-CSCS kök hücre benzeri fenotip karakterize etmek için in vitro analizi için, hücreler, plakaların farklı tipte kaplama olabilir.
    3. dondurulması tarafından kurulan OS CSC hatları (bölüm 2.3 tüm adımları yineleyin) koruyun. bölüm 2.4 tüm adımları tekrarlayarak Kriyoprezerve OS CSCS defrost.

5. In vitro bir nalysis OS CSCS karakterize etmek:

  1. Imüno hücrelerin hazırlanması
    NOT: 24-iyi pla her bir kuyunun içinde izdiham sağ notu ulaştığında Hücreler paraformaldehid giderilente. izdiham sınıf deney türüne bağlıdır.
    1. Plaka OS CSCS immünofloresan yüzey Mezenkimal Kök Hücre (MSC) işaretçileri incelemek için 24 plaka. % 60 izdiham - onlar 50 ulaştığınızda her bir kuyunun hücreleri sabitleyin. Aspirasyon ile SCGM çıkarın ve DPBS 24 oyuklu bir plaka içerisinde iki kez yıkanır.
    2. Bir kimyasal başlık altında, her bir göze 500 uL% 4 PFA / DPBS ekleyin. 10 dakika boyunca oda sıcaklığında inkübe edin. PFA / DPBS kaldırmak ve ultra saf dH 2 O ile 3 kez yıkayın 24 plaka davlumbaz kurumaya bırakın.
  2. MSC belirteçleri için İmmünofloresan
    Not: OS-CSCS immünofloresan boyama% 4 PFA / DPBS sabit CD44 Stro-1 ve CD105 karşı antikorların kullanıldığı OS CSCS MSC benzeri fenotip araştırmak için kullanılabilir. Aşağıdaki yöntem yazarlar tarafından rutin olarak kullanılmaktadır.
    1. Bir kimyasal kaput, uL 0.2 500 ekleyerek% 4 PFA / DPBS sabit olmuştur hücreleri permeabilize% Triton X-100 / çukur her DPBS. 30 dakika boyunca 37 ° C'de inkübe hücreleri. Yavaşça hücreler DPBS ile 3x yıkayın. 300 uL RNase% 2 BSA ile 1 / 1,000 seyreltilmiş ekleme / hücrelere DPBS ve 30 dakika 37 ° C'de inkübe edin.
    2. Yavaşça hücreler% 2 BSA / DPBS ile 3 kez yıkayın. MSC belirteçleri için hücreleri leke. Sadece her bir antikor için pozitif kontroller olarak seçilen kuyucuklara primer antikor ekleyin.
      1. Ekle 300 ul anti-CD105, anti-Stro-1,% 2 BSA / DPBS ile 1/10 seyreltilmiş 300 ul anti-CD44,% 2 BSA ile 1/10 seyreltilmiş 300 uL% 2 BSA / DPBS / DPBS ile 1/10 seyreltilmiş ve sadece 200 uL% 2 BSA / her bir antikor için negatif kontroller olarak seçilen kuyucuklara DPBS.
      2. 4 ° CO / N bir nemli ortamda inkübe hücreleri. Kuyular% 2 BSA / DPBS ile iki kez daha sonra DPBS ile 3 kez yıkayın.
    3. Belirli sekonder antikorlar ekleyerek birincil antikorlar ortaya koymaktadır.
      1. 300 ul anti-tavşan IgG (eşek anti-tavşan IgG [H + L]) 1/100 seyreltilmiş ekleme% 2 BSA ile / oyuk CD44 ve CD105 pozitif ve negatif kontrol olarak seçilen her birine DPBS. % 2 BSA ile 1/100 seyreltilmiş 300 uL FITC anti-fare Ig (FITC tavşan anti-fare IgG: [H + L]) ekleyin / her bir Stro-1 için pozitif ve negatif kontrol olarak seçilmiştir içine DPBS. 60 dakika boyunca oda sıcaklığında karanlıkta inkübe hücreleri. Kuyular DPBS ile 6x yıkayın.
    4. % 2 BSA ile seyreltildi 1/100 falloidin 300 uL eklenmesiyle sitoskeletal aktin için leke MSC markör-pozitif hücre / oyuk MSC markör imüno her birine DPBS.
    5. Oda sıcaklığında 40 dakika boyunca inkübe hücreleri. Kuyular DPBS ile 3x yıkayın ve sonra ultra saf dH 2 O ile iki kez yıkayın Yukarıda açıklanan immünofloresan boyama sonra çekirdeklerin counterstaining geçin. Davlumbaz M DPBS (stok 1.5 x 10 -3 M) propidium iyodür çözeltisi 10 -5 hazırlayın.
      1. her bir yukarıda tarif edildiği gibi renk 200 uL propidyum iyodid solüsyonu ekleyin. hücre inkübeOda sıcaklığında 3 dakika - 2 s. Ultra saf dH 2 O ile iki kez kuyuları yıkayın
        Not: - hücre hattı HCT8 5.2, negatif kontrol olarak kullanılan bir primer, sürekli farklı kolon kanser hücresi dizisi bölümleri 5.1 tüm adımları tekrarlayın.
  3. Osteojenik farklılaşma denemesi
    NOT:
    osteojenik farklılaşma 20 gün boyunca sürer.
    1. SCCGM 1 x 10 4 hücre / cm2'lik bir hücre yoğunluğunda, 24 yuvalı plakalar içinde Levha OS CSCS. her bir% 90 confluency - onlar 80 ulaşana kadar hücreleri SCGM büyümeye izin verin.
    2. OM SCGM değiştirerek osteojenik farklılaşma başlayın. 4 d - hücreleri OM büyümek ve orta her 3 yenilemek için izin verin. alkalin fosfataz (ALP) varlığını değerlendirmek için 10 d osteojenik farklılaşma tahlil durdurun.
    3. % 4 PFA / DPBS hücreleri Fix (bölüm 5.1'e bakınız). ALP ve HA için sitokimyasal boyama ile osteoblastik fenotip değerlendirinAlizarin Kırmızısı S boyama kullanılarak.
    4. ALP sitokimyasal boyama
      NOT: hemen boyama başlamadan önce bir kimyasal kaputu boya karışımı hazırlayın.
      1. 40 mg çözündürülür Fast Blue BB ya da 50 ml Tris-HCl Fast Red Violet LB tuzu, pH 9 (Çözelti A). 1 ml DMSO (solüsyon B) 'de, 5 mg naftol-AS-MX fosfat sodyum tuzu çözülür. tamamen bir çözelti A Çözelti B ekleyin ve DPBS ile iki kez Çözelti, yıkama hücreler elde etmek, iyice karıştırın.
      2. Her kuyuya, 1 ml C çözeltisi ve CO2 37 ° C'de inkübe ve% 5 - 500 ul ekle. mikroskop altında hücrelerin gözlemleyerek her 10 dakikada boyama seyrini izlemek.
      3. ALP-pozitif hücreler yoğun genellikle 30 dakika içinde gerçekleşir, (Fast Red Violet LB tuzu ile Fast Blue BB tuz veya kırmızı mavi) renkli hale ne zaman boyama durdurun. Hücreler ultra saf dH ile 3x yıkayın 2 O ise Çözüm C tüm kalıntılarını çıkarmak için leke i bir çökeltiMevcut s, mutlak etanol ile hızlı bir şekilde bir kez hücreleri yıkayın.
      4. adımlar 5.2.5 ve 5.2.5.1 açıklandığı gibi ALP boyandıktan sonra çekirdeklerin counterstaining geçin.
    5. Alizarin Kırmızı S sitokimyasal boyama
      NOT: deney başlamadan önce boya karışımı hazırlayın.
      1. (Ultra saf H2O, 100 ml 2 g Alizarin Kırmızısı S)% 2 Alizarin Kırmızısı S hazırlayın. PH 6.0 ulaşmak için% 2 Alizarin Kırmızı S% 2,5 NH 3 ekleyin. 4 ° C'de saklayın% 2 Alizarin Kırmızısı S çözeltisi. DPBS ile bir kez hücreler yıkanır.
      2. sadece bir kaç saniye için hücrelere Alizarin Kırmızısı S ekleyin.
      3. Ultra saf dH boyama derecesini kontrol etmek için 2 O kuyuları yıkayın; HA mevduat yoğun renkli değilse, adım 5.3.5.2 tekrarlayın. HA mevduat genellikle birkaç dakika içinde ortaya çıktığı, renkli yoğun kırmızı olunca boyama durdurun. Ultra saf dH 2 O ile kuyu yıkayın
    6. adipogenic farklılaşma
      NOT: Deney süresi OS CSC hatları bağlıdır. 30 d - deney 14 sürebilir.
      1. SCGM 1 x 10 4 hücre / cm2'lik bir hücre yoğunluğunda, 24 yuvalı plakalar içinde Levha OS CSCS. her bir% 90 confluency - onlar 80 ulaşana kadar hücreleri SCGM büyümeye izin verin. AM SCGM değiştirerek adipogenic farklılaşma başlatın. Hücreler AM büyümek ve haftada iki kez AM yenilemek için izin verin.
      2. Lipid veziküller görünür olduğunda adipogenic farklılaşma tahlil durdurun. Oil Red O boyama ile ve çekirdeklerin için counterstaining hematoksilin tarafından adipogenic fenotip değerlendirin.
      3. Çekirdekleri için Haematoksilin karşıt
        NOT: deney başlamadan önce boya karışımı hazırlayın.
        1. Emallume Carazzi 39 olarak adlandırılan,% 5 hematoksilen çözeltisi hazırlayın. 4 ° C'da, çözelti saklayın. sadece 2 dakika için Emallume Carazzi ekleyin. Ult ile kuyu yıkayınrapure DH 2 O
    7. CFU tahlili
      NOT: Bu deney üçlü olarak gerçekleştirilmelidir.
      1. Levha OS CSCS 100 mm Petri tabaklarda CFUM 450 hücre / cm2 bir hücre yoğunluğunda. 4 hafta boyunca 37 ° C,% 5 CO2 inkübatöründe inkübe hücreleri. Haftada iki kez CFUM yenileyin.
      2. toluidin mavisi ile CFU Leke. içbükey bir mikroskop kullanarak renkli kolonileri sayın. aşağıdaki formüle göre CFU verimi olarak hesaplanır (oluşan koloni sayısı / hücre sayısı tohumlanmış) * 100.
    8. ALDH aktivite analizi
      Not: ALDH aktivitesi, iki OS CSC hatlarında ve bir negatif kontrol olarak kullanılmıştır sonlu fibroblast hattına, bir ALDH aktivitesi kolorimetrik deney takımı ile değerlendirilmiştir. Bu kit 450 nm'de okuma absorbans tarafından ALDH enzimatik aktivite rakamlarla. Tüm testler üçlü olarak gerçekleştirilmiştir.
      1. Trypsinization tarafından tek tabaka hücre kültürleri ayırmak (Bölüm 2.2). 5 dakika boyunca 400 x g'de santrifüj ile pelet hücreleri. Üreticinin protokolü takip edin.
    9. Flow sitometri yöntemi:
      Not: Tek hücre süspansiyonları, akış sitometrisi için numune uygun boyama için gereklidir. her antikor, test edilecek için tek bir hücre süspansiyonu hazırlandı olmalıdır. Trypsinization tarafından tek tabaka hücre kültürleri ayırmak (Bölüm 2.2).
      1. / 1 x 10 5 hücre bir nihai hücre konsantrasyonunda, bir hücre süspansiyonu elde etmek için ayrılması tamponu uygun bir hacimde bir bölmenin sayma Bürker kullanılarak hücre sayısı, santrifüj hücreler 400 x g'de ve tekrar süspansiyon yerine, konik bir tüp içinde bir hücre süspansiyonu yerleştirin mi.
      2. 4 ° C'de 5 dakika boyunca bir hücre süspansiyonu santrifüj. Süpernatantı atın ve ayırma tamponu ile pelet yıkayın. İki kez bu adımı yineleyin.
      3. MS için Leke hücreleriCı belirteçleri (örneğin, CD44, CD105 ve Stro-1) 40.
      4. bir akış sitometresinin olumlu boyanan hücre süspansiyonları analiz edin. 1 gün içerisinde işaretli örnekleri analiz edin. analize kadar 4 ° C 'de, bu örneklerin inkübe edin.
    10. RT-PCR
      1. Ekstraksiyon ve RNA'nın izolasyonu
        1. OS CSCS hücresel donmuş paketlenmiş numuneler 1 ml lizis reaktif ekleyin ve yukarı ve aşağı birkaç kez pelet pipetleme tüp doğrudan hücrelerin lize.
        2. 4 ° C'de 1 dakika için 12,000 x g'de santrifüjleyin örnekleri. Yavaşça süpernatant kaldırmak. Yeni bir tüp süpernatantı aktarın 200 uL kloroform ekleyin ve güvenli tüp kap. 15 saniye boyunca kuvvetli bir şekilde tüp çalkalanır ve oda sıcaklığında 5 dakika boyunca numune inkübe edin.
        3. 4 ° C'de 15 dakika boyunca 12,000 x g'de santrifüjleyin örnekleri. Karışım, üç farklı faza ayrılır. RNA, renksiz bir üst sulu fazda münhasıran.
        4. olmak particularly dikkat sadece sulu faz çıkarın ve RNA izolasyonu ile devam etmek için yeni bir tüp içine, bu faz transfer. Sulu faz ihtiva eden bir tüpe 500 uL izopropanol ekleyin. elle tüp hafifçe sallayın. 10 dakika boyunca oda sıcaklığında örnek inkübe edin. 4 ° C'de 10 dakika boyunca 12,000 x g'de santrifüjleyin.
          Not: Örnek santrifüj sonra, yan ve borunun altında bir jel benzeri pelet oluşturan RNA incelemek mümkündür.
        5. alt RNA pelet bırakmak için dikkatli olmak, tüpten çıkarın. tüpüne 1 mi% 75 etanol ekleme. Vorteks sonra birkaç saniye boyunca elle boru ve 4 ° C'de 5 dakika boyunca 7500 x g'de santrifüj tüpü.
        6. etanol atın ve hava RNA pelet kurulayın. aşağı yukarı birkaç kez çözelti pipetleme - (50 uL 10) pelet kuruduğunda, RNaz içermeyen su RNA pelletini.
        7. Ölçüm göre RNA verimi ve saflığı belirlemek260 nm ve bir spektrofotometre kullanılarak 280 nm'de absorbans uring. Standart% 1 agaroz jeli üzerinde toplam RNA'nın bütünlüğü değerlendirir. -80 ° C'de RNA saklayın.
      2. Ters polimeraz zincir reaksiyonu
        1. Bir ters transkripsiyon kiti kullanılarak 500 ng RNA örneklerinden birinci-şerit cDNA'larının sentez. buz üzerinde Çözülme RNA örnekleri ve oda sıcaklığında kitine dahil gerekli çözümleri Çözülme. Üreticinin protokolü takip cDNA'ları sentezlenmesi için devam edin.
      3. Yarı nicel ters transkriptaz-polimeraz zincir reaksiyonu (RT-PCR)
        1. 24 ul bir son reaksiyon hacmi içinde, bir şablon olarak, her numune için 1 uL cDNA kullanılarak, tüm PCR'ler gerçekleştirin. Nanog, Eki 3/4, Sox2 ve CD133 genlerinin amplifikasyonu için Tablo 1 'de listelenen primer dizileri kullanın.
        2. etidyum bromür ile% 1.8 agaroz jel elektroforezi ve boya ile, RT-PCR ürünlerini ayırmak. UV illum altında fotoğrafe.

Representative Results

Iğne aspirasyonu veya tümörün küçük bir kısmının cerrahi rezeksiyon ile elde edilen işletim sistemi örnekleri tam tedavi edilirse (Şekil 2A, B) Protokol bölümünde anlatıldığı gibi (Şekil 1A, B), sadece bir OSA izolasyonunu izin verir. % 50 - Ne yazık ki, biyopsilerinden izole edilmiş hücrelerin sayısı 30 bir çıkış aralığı, düşüktür. Çıktı türü ve biyopsi (Şekil 5A, B) boyut bağlıdır. Bu hücreler, tam olarak tedavi edilmelidir. Birincil kültürler 100 mm Petri kabındaki birleşik duruma ulaştılar için Sonuç olarak, yaklaşık bir ay gereklidir. Bu süre sonunda, OUA'nın OSA5 ve OSA6 (Şekil 6 A, B), iki işletim örneklerinden işaretlenmiş elde edilir. Sonra, o lin karakterizasyonu analizi gerçekleştirmek için ve hücre cryopreserve hücrelerin yeterli sayıda elde etmek için birincil hücre hattını alt-kültürü için gerekli olanes. Her iki OUA'nın primer hücre çizgileri birleşik duruma ulaştılar zaman alt kültür 3. geçişi de, bunlar sarcosphere tahlili için 6-çukurlu ultra düşük bağlanma plakalara plakalanır. Bu bizi izin verir, çünkü bu tip bir plakanın, bir süspansiyon halinde hücreleri korumak için bağlanma aracılığıyla farklılaştırma kök hücre önlemek için, bölme arasında bulunduğu bağımlı hücrelerin önlenmesi için ve son olarak da alt tabakaya iliştirme azaltmak için kullanılır. Bu nedenle, bunların kullanımı CSCS seçimi için gerekli olan kanser hücreleri için stresli bir durum oluşturmak olanak sağlıyor. Deneyin başlamasından 24 saat sonra, hücreler birbirine (Şekil 7) izole görünür. Testin ilerlemesini izleme 7 gün sonra, küçük küresel koloniler oluşturmaya başladı ve görünür (Şekil 8) vardır var. 28 d, her bir meydana olan birkaç büyük küresel koloni (Şekil 9A, B) gözlenebilir. sarcospheres hav sonraE 28 gün boyunca kültüre edilmiştir, bu büyük küresel koloniler izole edilebilir. 10 6-çukurlu ultra düşük bağlanma plakalardan sarcospheres izole edilmesi ve yapışık koşullar altında yeniden kültüre etme adımlarını göstermektedir. Şekil 11 izolasyondan sonra kayan küresel kolonileri gösterir. Normal bağlanma plakalara büyük küresel koloniler (Şekil 12 A, B), izole edildikten sonra yapışık genişleme gösterir. Tek sarcospheres gelen genişletmek Hücreler muhtemelen kök hücre benzeri fenotip ile kanser hücreleri vardır. Bu nedenle, izolasyon sonrası, OS CSCS muhtemelen elde edilmiştir. Bu hücreler OSA5-CSCS ve OSA6-CSCS (Şekil 13A, B) olarak adlandırılır.

Bu noktada, yukarıda anlatıldığı gibi, elde edilen iki OS CSC hattı kök hücre benzeri fenotip karakterizasyonu devam etmek için gereklidir. kök hücre benzeri fenotip wer karakterizasyonu için analizlerHer OS CSC hattı için sarcospheres izole edildikten sonra e altkültürünün 4. geçişi üzerinde yapıldı. Onlar yüzey MSC işaretleyici için orta pozitifliği gösterdi iki hücre hatları, OSA5-CSCS ve OSA6-CSCS, yüzey MSC belirteçleri için güçlü pozitif (CD105 ve CD44) (Şekil 14A, B ve Şekil 15A, B) gösterdi Stro- 1 (Şekil 16A, B). Gözlemlerimiz ticari ve farklı kolon kanser hücresi hattı HCT8 (Şekil 14C, Şekil 15C, Şekil 16C) elde edilen olumsuz sonuç ile teyit edilmiştir. HCT8 hücre soyu, bu yüzey belirteçleri için spesifik ve spesifik olmayan boyama toplam eksikliği görülmektedir.

İki OS CSCS MSC fenotipi değerlendirmek için, biz de gerçekleştirilen akım sitometri analizi. Hem OS CSC hatları CD44 ve CD105 yüksek seviyelerini ifade etti. Bununla birlikte, her iki hücre hücrelerin sadece% 1.14 Stro-1 olarak ifade edilmiştir. Bu nedenle, bu yenidenimmünofloresan boyama ile gösterildiği gibi Sult Stro-1 orta varlığını doğruladı. Bunun aksine, OSA5-CSCS bölgesinin 99.62% CD44 ifade ve bu hücrelerin 87,38% CD105 belirtilmiştir; OSA6-CSCS bölgesinin 99.88%, CD44 ifade ve bu hücrelerin 95,79% CD105 ifade edilmiştir. Ayrıca, her iki hücre hatları CD45- vardır.

Biz 3 ESC belirteçleri (Nanog, Ekim 3/4, Sox2) ve CD133 geninin, RT-PCR ile bir CSCS belirteci tanımını inceledik. Biz bu genlerin hepsi hem OS CSC hatları (Şekil 17) ifade edildi fark ettim. (Şekil 20A - D) ve adipositlere adipogenic ve osteojenik farklılaşma analizleri osteoblastlar (D - - Ge ve Şekil 19A Şekil 18A) içine ayırt etmek için hem izole OSA-CSC hatlarının kapasitesini gösterdi.

Ayrıca, cfu ssay (Şekil 21) OSA5-CSCS için% 13 ve OSA6-CSC için% 14 ile, clonogenic verimlilik iyi bir oran gösterdi. Son zamanlarda yapılan bazı çalışmalar, ALDH aktivitesinin yüksek seviyeleri birçok kanser türü için karakteristik olduğunu göstermiştir. Bu parametre, bir kanser kök hücre markeri olarak kullanılabilir ve kötü prognoz ile ilişkilidir. ALDH aktivitesi deneyi ALDH aktivitesi Bu deneyde, bir negatif kontrol olarak kullanılmıştır fibroblast hattına alt ölçülebilir sınırında gözlenmemiştir, OS-CSC hatları, ALDH aktivitesinin (Şekil 22) yüksek düzeyde olduğunu göstermiştir.

Şekil 1
Şekil OS Biyopsi Örneklerinin 1. örnekler. (A). Biyopsi örneği iğne aspirasyonu ile elde edilmiştir. (B). tümörün bir parçasının cerrahi rezeksiyon ile elde edilen biyopsi örneği.884 / 53884fig1large.jpg "target =" _ blank "> bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

şekil 2
OS Numune Şekil 2. Mekanik Ayrıştırma. Perry cımbız ve bir neşter kullanarak bir örnek (A) Parçalanma. (Ok ile gösterilen) CM içinde süspanse (B) parçaları. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Sarcospheres yalıtmak için gerekli Şekil 3. Ekipman ve Sarf Malzemeleri. (A). Hücre izolasyonu için gerekli olan tüm ekipman. steril bir membran filtre tutucusu ile 1. Steril şırınga; 2. İki farklı medya: GMnd SCGM; 3. steril cam Pasteur pipeti. Membran filtre tutucusu ile bir destek üzerine monte şırınga, (B) Detay. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4. Filtrasyon Ünitesi. Filtrasyon ünitesi (A) montajı için gerekli bazı bileşenler (net filtre okla gösterilir). Net filtre (B) 40 mikron kafesleri (tek gözlü okla gösterilir) Faz kontrast gözlem. Orijinal büyütme: 10X. Filtrasyon ünitesi monte (C - D). Filtrasyon ünitesi sterilize (E). Daha büyük bir ettik görmek için buraya tıklayınızBu rakamın rsion.

Şekil 5,
Şekil Geleneksel OS 5. Primer Hücre Kültürleri. Yüksek dereceli OS'nin primer hücre kültürleri Faz kontrast gözlem. Birkaç küçük yuvarlak ve yüzer eritrositler mevcut olduğu (B) 'de ise, (A) olarak, çeşitli parlak kemik parçaları, görebilir. Orijinal büyütme: 10X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 6,
Faz aksine Şekil 6. Geleneksel Osteosarkom Sonlu Hücre Hatları (OSA). (A) OSA5 ve (B) OSA6. Gözlem.Orijinal büyütme: 10X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 7,
Şekil OSA5 ve OSA6 bölgesinin Sarcosphere Deneyi. Deneyinin başlangıcından itibaren 24 saat sonra, hücreler, yüzen 7. birbirinden izole edilmiş (hücreler oklar ile belirtilmiştir). Faz kontrast Gözlem. Orijinal büyütme:. 20X bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 8,
Tahlil 7 D. 7 D Şekil 8. OSA5 bölgesinin Sarcosphere tahlili ve OSA6, birkaç küçük sphericatek hücre ile çevrili l koloniler gözlenebilir. sarcospheres (oklarla gösterilmiştir, bu sarcospheres bazıları) ortam içinde kayan ya da hafif de alt kısmına yerleşmiş olarak görünür. Faz kontrast Gözlem. Orijinal büyütme: 20X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 9,
Şekil 9. Sarcosphere OSA5 tahlili ve OSA6 28 D'de 28 gün sonra, çok sayıda büyük sarı sarcospheres her bir OUA'nın hücre hattı, OSA5 (A) ve OSA6 (B) levhaların her gözlenmektedir. Bar boyutu: 100 mikron. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız. </ P>

Şekil 10,
Sarcospheres İzolasyonunda Şekil 10. Pasajlar 6 oyuklu ultra düşük bağlanma plakalardan izole sarcospheres adımları, ve yapışan koşullar altında yeniden kültüre etme gösterilmektedir (A) izolasyonu için gerekli tüm ekipman..: net filtre tutucu, 3. pipet, 4. 1000 uL steril ipuçları, 5. 2 steril Perry cımbız, 6. 2 farklı kültür ortamı ile her kuyu, 2. şırınga oluşan sarcospheres ile 1. Bir 6-kuyu ultra düşük plaka 7. steril Pasteur pipeti 8. Petri kapları. Sarcospheres (B) Koleksiyon. Her bir oyuk içerdiği, orta steril 1000 uL ucu olan bir pipet kullanarak toplanır. (C) şırınga süspansiyon toplayın. Toplanan süspansiyon kullanarak doğal filtreleme işlemini başlatmak için şırıngaya transfer edilirMembran filtre tutucusu. (D) Doğal filtrasyon. şırınga membran filtre yuvasını sökülmesi (E). Tüm Süspansiyon süzülür sonra, net filtre tutucu sökülüp bir Petri kabındaki konur; (F) Membran filtre yuvasını sökülmesi. Sarcospheres net filtre tutucu net filtrenin gözeneklerinden içerdiği, bu yüzden Perry cımbız kullanarak serbest gerekir. (G, H) Membran filtreden sarcospheres çıkartılması. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 11,
Şekil 11. Sarcosphere İzolasyonu. İzole sarcospheres 60 mm Petri kabındaki ortamda yüzer. Faz-kontrast Gözlem.Orijinal büyütme: 40X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 12,
Şekil OSA5 (A) ve OSA6 (B) yeniden yerleştirilmesi, aşağıdaki ve izolasyon 48 saat sonra yapışkan koşullar altında bir tek tabaka yeniden kültüre etme yapışık genişleme başında hücre çizgilerinden izolasyonu. Sarcospheres sonra 12. Sarcosphere. Faz-kontrast Gözlem. Orijinal büyütme: 20X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 13, Şekil İzolasyon sonra 7 D 13. Sarcospheres. OSA5 (A) ve OSA6 (b) hücre hatları Sarcospheres yeniden yerleştirilmesi takip eden ve izolasyonundan sonra 7 gün de yapışkan koşullar altında bir tek tabaka yeniden kültüre etme yapışık genişleme gösterdi. Faz-kontrast Gözlem. Orijinal büyütme: 20X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 14
Şekil 14. immünofloresan boyama için CD105. OUA'nın-CSC hatlarında CD105 için immünofloresan boyama OSA5-CSCS (A) ve OSA6-CSCS (B) ve bir negatif kontrol olarak kullanılmıştır sürekli hücre hattı HCT8 (C) bölgesi. Geleneksel renkte LSCM: CD105 için yeşil ve hücre iskeleti için kırmızı. Orijinal büyütme: 10X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 15
Şekil 15. immünofloresan boyama için CD44. OUA'nın-CSC hatlarında CD44 için immünofloresan boyama OSA5-CSCS (A) ve OSA6-CSCS (B) ve bir negatif kontrol olarak kullanılmıştır sürekli hücre hattı HCT8 (C) bölgesi. hücre iskeleti için CD44 için yeşil ve kırmızı: Konvansiyonel renklerde LSCM. Orijinal büyütme: 10X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.


Stro-1 OUA'nın-CSC hatlarında için Stro1. Immünofloresan boyama Şekil 16. immünofloresan boyama OSA5-CSCS (A) ve OSA6-CSCS (B) ve bir negatif olarak kullanılan sürekli hücre hattı HCT8 (C) bölgesi kontrol. Geleneksel renklerde LSCM: yeşil Stro-1 ve hücre iskeleti için kırmızı. Orijinal büyütme: 10X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 17
Nükleer ESC İşaretlerinin ve CD133 Gene., RT-PCR, Nanog, Eki 3/4, Sox2 ve CD133 OSA5-CSCS (A) ve OSA6-CSCS bölgesindeki (ekspresyonunu gösteren Şekil 17. Ekspresyon Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 18
Şekil 18. osteojenik Farklılaşma Deneyi -. ALP 0 d (A, B) ve de Hızlı Mavi BB ile ALP sitokimyasal lekeleme ile tespit edildiği üzere indüksiyon 10 d (C, D) sonra, osteojenik farklılaşma. mavi, ALP + hücrelerde; kırmızı, çekirdek propidyum iyodid ile karşıt. Aydınlık ve floresan Kompozit gözlem. Orijinal büyütme: 20X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 19 Şekil 19. osteojenik Farklılaşma Deneyi -. 0 d HA osteojenik farklılaşma (A, B) ve alizarin kırmızısı S ile hidroksiapatit (HA) için sitokimyasal lekeleme ile tespit edildiği üzere indüksiyon 20 D (C, D) sonra hücreler tezat HA / mavi, gri ve grenli mevduat kırmızı boyanır. Faz kontrast Gözlem. Orijinal büyütme: 40X. Bar boyutu:. 100 mikron bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 20
Şekil 20. adipojenik Farklılaşma Deneyi. Cytoch ile belirlenen şekilde indüksiyon 0 d (A, B) ve 14 D (C, D) sonra, adipojenik farklılaşmaKızıl Oil Red O. ile emical boyama, lipidik veziküller (büyük kesecikler siyah / kırmızı oklarla gösterilir; küçük kesecikler siyah / beyaz oklarla gösterilir); mavi / mor olarak, çekirdekleri hematoksilin ile zıt. aydınlık gözlem. Orijinal büyütme: 40X. Bar boyutu:. 100 mcM bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 21
Şekil 21. CFU Deneyi. Toluidin mavisi ile boyandı OSA-CSC hatlarının CFU tahlili. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 22 /> Şekil 22. ALDH Aktivite Deneyi. ALDH kolorimetrik deney tespit sonlu farklılaşmış hücre çizgisi bu etkinliği yokluğunun tespit deneyi ise, iki OS CSC hatları OSA5-CSCS ve OSA6-CSCS bölgesindeki ALDH aktivitesinin yüksek seviyeleri fibroblastlar, FIB. Hata çubukları: SD. **: FIB vs p <0.001; *:. FIB vs p <0.01 Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

2 "> CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT
Gen oligonükleotidler Dizisi (5¹-3¹) Amplikon boyutu (bp) Tₐ (° C)
nanog İleri primer Ters astar 87 60
Ekim 3/2 İleri primer Ters astar GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT 77 60
Sox2 İleri primer Ters astar TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC 125 55
CD133 İleri primer Ters astar CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC 127 56
bp amplikon büyüklüğü baz çifti; Tₐ, tavlamasıcaklık

Amplikon boyutu ve Tavlama Sıcaklığı Nanog, Ekim 3/4, Sox2 ve CD133 için Primer Dizilerin Tablo 1. Detaylı Liste

Discussion

CSCS tümör toplu olarak bu özel hücre alt kümesi tanımlanmasına izin birçok özelliklere sahip. Bu ekspresyon için, ATP-bağlayıcı kaset çoklu ilaç akış taşıyıcıları 28, 32, 33, ya da ALDH 32 arındırma enzimlerin ekspresyonunun yukarı doğru düzenleme için aşırı ekspresyonu için kemoterapi maddeleri sitotoksik kazanılmış direnç gibi, bu özelliklere dayanarak CSCS izole etmek için örneğin CD133, CD44, CD34, CD90, ve diğerleri, 30, 34, 35, 41, çeşitli yöntemler gibi belirli bir yüzey işaretleyici, bir 42-44 geliştirilmiştir. Bu tekniklerden biri, yapışmayan koşullarda büyümeye CSCS kapasitesine dayanan küre formasyonu tahlilidir.

Küreler oluşturmak için doku kök hücreleri ve CSCS kabiliyeti ilk Reynolds ve arkadaşları. 37 nöral kök hücrelerin tanımlanmasına çalışmalarında tanımlanmıştır. Daha sonra, Gibbs ve diğ. 38 biziBu çalışmalar, Ed kemik sarkomları arasında, özellikle, bir katı tümörlerden CSCS izole başlayacak. Biz Gibbs ve arkadaşları tarafından gösterilen küre oluşumu tahlil yöntemi kullanmak. Geleneksel OS biyopsi alınan OSA hücre hatları CSCS izole etmek için karar verdik. Orijinal yöntemi Bu tahlilin sonuçları geliştirmek ve diğer kanser hücre çizgileri için yeniden üretimi kolaylaştırmak için adapte edilmiştir. Küre oluşum analizinde kurulması değini ile, 40.000 hücre kaplama / kuyucuk başına izole hücreleri korumak için iyi bir uygulama olduğu belirlenmiş. Bu hile küresel koloniler hücresel toplama gelen ve yapışmayan koşullar altında büyümek ve küresel koloni oluşturmak için tek bir CSC özel ve seçkin kapasite kaynaklanan olasılığını önlemek için çok önemlidir. Bu özellik, bu tahlilde özellikle kritik bir noktadır.

Biz de küre oluşumu iyi bir oran elde etmek için bu sertifikalı, Orijinal bir yöntem de tarif edildiği gibi, her gün büyüme faktörlerinin tam bölünen miktarları, her 3 D olup yenilemek için yeterlidir. Bu çalışmada, aynı zamanda kurulmuş ve geniş bir yapışmayan koşullar altında kültüre edildiği zaman meydana küresel koloniler izole edilmesi için iyi bir yöntem tarif. de zarar vermeden her birinde oluşan olası küre kadar saptayabilmek için çok önemli olduğundan, bu adım, bu deneyde çok önemlidir. Sadece küreler olup deneyi süresince süspansiyon kalabileceklerini tek hücre izole etmek de önemlidir. Bu kritik noktalar aşmak için, yukarıda gösterildiği gibi, CSC izolasyonu için iyi sonuçlar vermiştir, belirli bir izolasyon yöntemi geliştirdik. Açıkçası, orada oluşan tüm küreler elde edilebilir değil olasılık, ama kayıp yüzdesi çok düşüktür. Nitekim, biz de onlar (form büyük olduktan sonra küreler izole etmek için 40 mikron gözeneklere sahip bir filtre kullanmak olanağına sahiped yaklaşık 100-200 hücreleri).

Bu izolasyon küre oluşumunu durdurur ancak tek hücre, metilselüloz artığının bir kısmı ve en küçük küreler süzüldü sağlar. protokolde tarif edildiği gibi ortadan kaldırılması ayrıntılı süzme ile gerçekleştirilir.

Ayrıca, küçük küresel kolonilerin sonucu kaybı ile 40 mikron örgü ile büyük küresel kolonilerin seçimi bir küresel koloniler oluşturmak için yüksek kapasiteli ve daha stemness ile CSCS seçmenize olanak sağlar. Bu modifikasyonların tümü deney geliştirmek ve anlamak ve küre oluşum analizinde orijinal yöntemin en önemli adımı üretmek için CSCS çalışan araştırmacılar yardımcı yapıldı.

Izole CSCS için in vitro yöntemleri ile ilgili olarak çalışmalar arasında bu çalışma gelen CSCS izole etmek için bu uyarlanmış küre oluşumu tahlil iyi bir yöntem olabilir anlatmayı amaçlamaktadırOUA'nın hücre çizgileri. Orijinal yöntem ve detaylı izolasyon tekniği uyarlamalar etkinliğini artırmak nitelendirdi. Kısa bir süre içinde, CSCS iyi sayısı elde edilebilir ve çeşitli deneylerde kullanılır. Nedenle, hızlı bir şekilde OS CSCS karakterize çift mil benzeri fenotip çalışma, özellikle, kök benzeri fenotipleri onaylamak mümkündür. Bu nedenle, bu değiştirilmiş deney CSCS izole edilmesi ve bunların biyoloji çalışmaları için iyi bir teknik olabilir. Gelecekte, bu yöntem, ilave uyarlamalarla, nadirdir katı tümörlerin biyopsi ile elde edilen başka bir sonlu kanser hücre hatları CSCS izole etmek için kullanılabilir.

Bu işletim sistemi gibi nadir katı tümörler, gelen CSCS ayırma olasılığı, sadece bu özel kanser ile ilgili çalışmaların gelişme sağlar ama aynı zamanda izolasyon için daha iyi yöntemleri geliştirmek için farklı kanser tiplerinin çalışmalara ve biyoloji gelecek çalışmalara uzanır Bu önemli hücresel alt kümesi. Bu nedenle, biz olarakBu çalışmada yapmış, muhtemelen sorumlu olan bu özel hücre alt kümesi yönelik çok özel bir antikanser terapisi, moleküler hedeflerin bulma ve geliştirme nihai amacı ile, CSC biyoloji çalışma ile CSC izolasyon yöntemleri geliştirmek için önemlidir primer tümör bakım, bunun tekrar gelişimi, ve çeşitli organlarda metastaz kökeni. CSC biyoloji çalışma aynı zamanda neoadjuvan tedavi sonrası hayatta kalma oranı çok kötü kaldığı için böyle OS kanser, tedavisindeki isabetli olabilir tedaviler bulmak için çok önemlidir.

Materials

Name Company Catalog Number Comments
Dulbecco's Phosphate Buffered Saline with Ca2+ and Mg2+ (DPBS) LONZA BE17-513F _
Dulbecco's Phosphate Buffered Saline  without Ca2+ and Mg2+ (DPBS) LONZA BE17-512F _
Porcine Trypsin 1:250 BD Difco 215310 Solvent: DPBS. Stock concentration: Powder
Ethylenediamine tetraacetic acid disodium salt dihydrate(EDTA) Sigma-Aldrich E4884 Solvent: DPBS. Stock concentration: Powder
Collagenase from Clostridium histolyticum Sigma-Aldrich C0130 Solvent: Buffer Solution, pH 7.4. Stock concentration: Powder
Dimethyl sulphoxide (DMSO) BDH Chemicals-VWR 10323 _
Nutrient Mixture F-12 Ham Sigma-Aldrich F6636 Solvent: Ultrapure dH2O. Stock concentration: Powder
2-Phospho-L-ascorbic acid trisodium salt Sigma-Aldrich 49752 Solvent: DPBS. Stock concentration: 5 mg/mL
β-Glycerol phosphate disodium salt pentahydrate Sigma-Aldrich 50020 Solvent: DPBS. Stock concentration: 1 M
Insulin. Human Recombinant Sigma-Aldrich 91077 Solvent: NaOH 0.1 M. Stock concentration: 10 mM
3-Isobutyl-1-methylxanthine Sigma-Aldrich I5879 Solvent: DMSO. Stock concentration: 500 mM
Indomethacin Sigma-Aldrich I7378 Solvent: DMSO. Stock concentration: 200 mM
Dexamethasone Sigma-Aldrich D4902 Solvent: DMSO. Stock concentration:  1 mM / 100 µM. Store in liquid nitrogen to maintain the biological activity
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 _
Fetal Bovine Serum South America  EUROCLONE ECS0180L _
Penicillin-Streptomycin (PEN-STREP) 10,000 U/mL LONZA DE17-602E _
Methyl cellulose Sigma-Aldrich 274429 Solvent: Ultrapure dH2O. Stock concentration: 2%
Putresceine dihydrochloride Sigma-Aldrich P5780 Solvent: Ultrapure dH2O. Stock concentration: Powder
apo-Transferrin  Sigma-Aldrich T-1147 Solvent: DPBS. Stock concentration: 25 mg/mL
Human Epidermal Growth Factor (EFGF) Sigma-Aldrich E5036 Solvent: DPBS pH 7.4. Stock concentration: 10 µg/mL
Fibroblast Growth Factor-Basic Human Sigma-Aldrich F0291 Solvent: DPBS + 0.2% BSA. Stock concentration: 25 µg/mL
Selenous Acid Sigma-Aldrich 211176 Solvent: DPBS. Stock concentration: 30 mM
Progesterone Sigma-Aldrich P8783 Solvent: ETOH. Stock concentration: 10 mM
Toluidine Blue O Sigma-Aldrich 198161 Solvent: Ultrapure dH2O. Stock concentration: Powder
Oil Red O ICN Biochemicals 155984 Solvent: 2-Propanol. Stock concentration: Powder
Naphtol AS-MX Phosphate Disodium Salt Sigma-Aldrich N5000 Solvent: DMSO. Stock concentration: Powder
Fast Blue BB Salt Sigma-Aldrich F3378 Solvent: Tris HCL, pH 9.0. Stock concentration: Powder
Fast Red Violet LB Salt Sigma-Aldrich F3381 Solvent: Tris HCL, pH 9.1. Stock concentration: Powder
Bovine Serum Albumin, Fraction V (BSA) Sigma-Aldrich A-4503 Solvent: DPBS. Stock concentration: 2%
Alizarin Red S ICN Biochemicals 100375 Solvent: Ultrapure dH2O. Stock concentration: Powder
Formaldehyde solution Sigma-Aldrich 533998 4%
Triton-100X MERCK 11869 Solvent: DPBS. Stock concentration: 0.2%. Danger - Use only under chemical hood
Calcein MERCK 2315 Solvent: DPBS . Stock concentration: 200 µg/mL
2-Propanol MERCK 109634 Danger - Use only under chemical hood
Ab-CD105                                                    (Mouse monoclonal [SN6] to CD105 (FITC) Abcam ab11415 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD44                                       (Mouse monoclonal             [F10-44-2] to CD44 (PE/Cy7®) ) Abcam ab46793 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD45                                              (Mouse monoclonal             [MEM-28] to CD45 (PerCP))  Abcam ab65952 Liquid. Application:               Flow Cytometry (Flow Cyt)
Ab-CD105                                                    (Human CD105 Purified Antibody)  Invitrogen MHCD10500 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-CD44                                       (Anti-CD44 Antibody)  Abcam EPR1013Y(ab51037) Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
Ab-Stro-1                                   (Mouse anti-STRO-1)  Invitrogen 398401 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 488             (Anti-Rabbit IgG (Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)) Invitrogen A-21206 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
FITC Anti-Mouse IG (FITC-Rabbit Anti Mouse IgG (H+L)) Invitrogen 61-6511 Solvent: DPBS. Stock concentration: Lyophilized. Application:               Flow Cytometry (Flow Cyt)       Immunofluorescence staining (IF)
Alexa Fluor 635 Phalloidin  Invitrogen A34054 Solvent: DPBS. Stock concentration: Lyophilized. Application: Immunofluorescence staining (IF)
AutoMACS™Running Buffer MACS Separation Buffer Miltenyi 130,091,221 Liquid. Store at 4 °C
QIAzol®Lysis Reagent QIAGEN 79306 Danger - Use only under chemical hood
QUANTITECT®                             Reverse Transcription Kit QIAGEN 205314
Chlorophorm Sigma-Aldrich C2432 Liquid. Danger - Use only under chemical hood
Laminar flow hood GELAIRE BSB6A
Chemical hood ARREDI TECNICI                             Villa Modello                                                      DYNAMICA
Centrifuge EPPENDORF 5415R
Laser Scanning Confocal Microscopy LSM 5109 Meta  ZEISS
iCycler PCR Thermalcycler  BIORAD
CyFlow®SPACE  (PARTEC)
Inverted Micrposcope Axiovert 200M  ZEISS
Freezing container , Nalgene
Original Pipet-Aid pbiBrand
Micropipettes EPPENDORF
Glass Pasteur Pipette SIGMA
VICTOR3™                       PERKIN ELMER
Conical tubes                         (15 and 50 mL)                             BD FALCON 352096 (for 15 mL)          352070 (for 50 mL)
24-Well Clear Flat Bottom TC-Treated Multiwell-Cell-Culture-Plate BD FALCON 353047
6-Well Clear Flat Bottom Ultra Low Attachment Multiple-Well-Plates CORNING 3471
Serological pipettes                    (5 and 10 mL)                                           BD FALCON 357543 (for 5 mL)              357551 (for 10mL)
Syringe (5mL)                              B|BRAUN 4617053V
Petri dish 100X20 mm              BD FALCON 353003
Röhren Tubes                     (3.5 mL, 55x12mm, PS)                SARSTEDT 55,484
Petri dish 60X15 mm                 BD FALCON 353004
Cryovials 1.5 mL             NALGENE 5000-1020
Cell-Culture Flasks 25 cm²       BD FALCON 353014
Nylon Net Filter, Hydrophilic MERCK NY4104700
Swinnex Filter Holder MERCK SX0002500
Perry tweezer 
Lancet
Dounce _ _ _

DOWNLOAD MATERIALS LIST

References

  1. Reddick, R. L., Michelitch, H. J., Levine, A. M., Triche, T. J. Osteogenic sarcoma: a study of the ultrastructure. Cancer. 45, (1), 64-71 (1980).
  2. Gatta, G., et al. Childhood cancer survival trends in Europe: a EUROCARE Working Group study. J. Clin. Oncol. 23, (16), 3742-3751 (2005).
  3. Olstad, O. K., et al. Molecular heterogeneity in human osteosarcoma demonstrated by enriched mRNAs isolated by directional tag PCR subtraction cloning. Anticancer. Res. 23, (3B), 2201-2216 (2003).
  4. Geller, D. S., Gorlick, R. Osteosarcoma: a review of diagnosis, management, and treatment strategies. Clin Adv Hematol Oncol. 8, (10), 705-718 (2010).
  5. Tang, N., Song, W. X., Luo, J., Haydon, R. C., He, T. C. Osteosarcoma development and stem cell differentiation. Clin. Orthop. Relat. Res. 466, (9), 2114-2130 (2008).
  6. Kempf-Bielack, B., et al. Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 23, (3), 559-568 (2005).
  7. Meyers, P. A., et al. Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J. Clin. Oncol. 23, (9), 2004-2011 (2005).
  8. Gorlick, R., et al. Biology of childhood osteogenic sarcoma and potential targets for therapeutic development: meeting summary. Clin. Cancer Res. 9, (15), 5442-5453 (2003).
  9. Hayden, J. B., Hoang, B. H. Osteosarcoma: basic science and clinical implications. Orthop. Clin. North Am. 37, (1), 1-7 (2006).
  10. Thomas, D., Kansara, M. Epigenetic modifications in osteogenic differentiation and transformation. J. Cell. Biochem. 98, (4), 757-769 (2006).
  11. Araki, N., et al. Involvement of the retinoblastoma gene in primary osteosarcomas and other bone and soft-tissue tumors. Clin. Orthop. Relat. Res. 270, (270), 271-277 (1991).
  12. Chou, A. J., Gorlick, R. Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert. Rev. Anticancer Ther. 6, (7), 1075-1085 (2006).
  13. Arndt, C. A. S., Crist, W. M. Common musculoskeletal tumorsof childhood and adolescence. N. Engl. J. Med. 341, (5), 342-352 (1999).
  14. Longhi, A., Errani, C., De Paolis, M., Mercuri, M., Bacci, G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer. Treat. Rev. 32, (6), 423-436 (2006).
  15. Bacci, G., et al. Long-term outcome for patients with nonmetastatic osteosarcoma of the extremity treated at the istituto ortopedico rizzoli according to the istituto ortopedico rizzoli/osteosarcoma-2 protocol: an updated report. J. Clin. Oncol. 18, (24), 4016-4027 (2000).
  16. Clarke, M. F., et al. Cancer stem cells-perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer. Res. 66, (19), 9339-9344 (2006).
  17. Lapidot, T., et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367, (6464), 645-648 (1994).
  18. Bonnet, D., Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 3, (7), 730-737 (1997).
  19. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumors: accumulating evidence and unresolved questions. Nat. Rev. Cancer. 8, (10), 755-768 (2008).
  20. Bapat, S. A. Evolution of cancer stem cells. Semin. Cancer Biol. 17, (3), 204-213 (2007).
  21. Rubio, D., et al. Spontaneous human adult stem cell transformation. Cancer. Res. 65, (8), 3035-3039 (2005).
  22. Burns, J. S., et al. Tumorigenic heterogeneity in cancer stem cells evolved from long-term cultures of telomerase-immortalized human mesenchymal stem cells. Cancer. Res. 65, (8), 3126-3135 (2005).
  23. Zhang, M., Rosen, J. M. Stem cells in the etiology and treatment of cancer. Curr. Opin. Genet. Dev. 16, (1), 60-64 (2006).
  24. Li, Y., et al. Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc. Natl Acad. Sci. USA. 100, (26), 15853-15858 (2003).
  25. Sell, S. Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect. 101, (Suppl 5), 15-26 (1993).
  26. Wernig, M., et al. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature. 448, (7151), 318-324 (2007).
  27. Niwa, H., Miyazaki, J., Smith, A. G. Quantitative expression of oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, (4), 372-376 (2000).
  28. Hochedlinger, K., Jaenisch, R. Nuclear reprogramming and pluripotency. Nature. 441, (7097), 1061-1067 (2006).
  29. Dean, M., Fojo, T., Bates, S. Tumor stem cells and drug resistance. Nat. Rev. Cancer. 5, (4), 275-284 (2005).
  30. Ma, S., Lee, T. K., Zheng, B. J., Chan, K. W., Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene. 27, (12), 1749-1758 (2008).
  31. Wu, C., et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer. Res. 67, (17), 8216-8222 (2007).
  32. Ma, I., Allan, A. L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem. Cell. Rev. 7, (2), 292-306 (2011).
  33. Awad, O., et al. High ALDH activity identifies chemotherapy-resistant Ewing's sarcoma stem cells that retain sensitivity to EWS-FLI1 inhibition. PLoS One. 5, (11), e13943 (2010).
  34. Fujii, H., et al. Sphere-forming stem-like cell populations with drug resistance in human sarcoma cell lines. Int. J. Oncol. 34, (5), 1381-1386 (2009).
  35. Di Fiore, R., et al. Genetic and molecular characterization of the human osteosarcoma 3AB-OS cancer stem cell line: a possible model for studying osteosarcoma origin and stemness. J. Cell. Physiol. 228, (6), 1189-1201 (2013).
  36. Reynolds, B. A., Tetzlaff, W., Weiss, S. A multipotent EGF-responsive striatal embryonicprogenitor cell produces neurons and astrocytes. J. Neurosci. 12, (11), 4565-4574 (1992).
  37. Reynolds, B. A., Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 255, (5052), 1707-1710 (1992).
  38. Gibbs, C. P., et al. Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7, (11), 967-976 (2005).
  39. Beccari, N., Mazzi, V. Manuale di tecnica microscopic. Casa Editrice Dr. Francesco Vallardi Società Editrice Libraria. 99-100 (1966).
  40. Majumdar, M. K., Thiede, M. A., Mosca, J. D., Moorman, M., Gerson, S. L. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell. Physiol. 176, (1), 57-66 (1998).
  41. Tirino, V., et al. Human primary bone sarcomas contain CD133+ cancer stem cells displaying high tumorigenicity in vivo. FASEB J. 25, (6), 2022-2030 (2011).
  42. Tirino, V., et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 27, (1), 13-24 (2013).
  43. Martins-Neves, S. R., et al. Therapeutic implications of an enriched cancer stem-like cell population in a human osteosarcoma cell line. BMC Cancer. 12, (1), 139 (2012).
  44. Tang, Q. L., et al. Enrichment of osteosarcoma stem cells by chemotherapy. Chin. J. Cancer. 30, (6), 426-432 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics