कुशल न्यूक्लिक एसिड निकासी और -16 rRNA जीन अनुक्रमण जीवाणु समुदाय विशेषता के लिए

Biology
 

Summary

हम -16 rRNA जीन amplicon अनुक्रमण का उपयोग बैक्टीरियल समुदायों के लक्षण वर्णन के लिए swabs से न्यूक्लिक एसिड निकालने के लिए एक कुशल, मजबूत, और लागत प्रभावी विधि का वर्णन है। विधि कई प्रकार नमूना के लिए एक आम प्रसंस्करण दृष्टिकोण के लिए अनुमति देता है और नीचे की ओर विश्लेषणात्मक प्रक्रियाओं के एक नंबर रह सकते हैं।

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

वहाँ मानव स्वास्थ्य और रोग के महत्वपूर्ण modulators के रूप में माइक्रोबियल समुदायों की भूमिका के लिए एक से बढ़ सराहना की है। उच्च throughput अनुक्रमण प्रौद्योगिकियों स्रोतों की विविधता से -16 rRNA जीन अनुक्रमण का उपयोग बैक्टीरियल समुदायों के तेजी से और कुशल लक्षण वर्णन के लिए की अनुमति दी है। हालांकि -16 rRNA अनुक्रम विश्लेषण के लिए आसानी से उपलब्ध उपकरण मानकीकृत वर्कफ़्लोज़ कम्प्यूटेशनल है, डीएनए निष्कर्षण के लिए नमूना प्रसंस्करण अध्ययनों में परिवर्तनशीलता का एक निरंतर स्रोत बनी हुई है। यहाँ हम swabs से न्यूक्लिक एसिड को निकालने के लिए एक कुशल, मजबूत, और लागत प्रभावी विधि का वर्णन है। हम यह भी -16 rRNA जीन अनुक्रमण के लिए नीचे की ओर तरीकों, अनुक्रमण पुस्तकालयों की पीढ़ी, डेटा की गुणवत्ता नियंत्रण, और अनुक्रम विश्लेषण सहित चित्रित करना। कार्यप्रवाह मल और शारीरिक स्थानों और मेजबान प्रजाति की एक किस्म से एकत्र swabs सहित कई नमूने प्रकार, समायोजित कर सकते हैं। इसके अतिरिक्त, डीएनए और आरएनए बरामद अलग कर दिया और इस्तेमाल किया जा सकतापूरे जीनोम अनुक्रमण या शाही सेना seq सहित अन्य अनुप्रयोगों के लिए। विधि वर्णित कई प्रकार नमूना के लिए एक आम प्रसंस्करण दृष्टिकोण लिए अनुमति देता है और, जीनोमिक metagenomic और जानकारी ट्रांसक्रिप्शनल के बहाव के विश्लेषण रह सकते हैं।

Introduction

मानव कम प्रजनन पथ, गैस्ट्रोइंटेस्टाइनल प्रणाली, श्वसन तंत्र, त्वचा और जटिल बैक्टीरियल समुदायों कि ऊतक homeostasis को बनाए रखने और मेजबान 1 के स्वास्थ्य के समर्थन के लिए महत्वपूर्ण हैं द्वारा उपनिवेश रहे हैं। उदाहरण के लिए, कुछ lactobacilli योनि तिजोरी को अम्लीय, रोगाणुरोधी प्रभावोत्पादक उत्पादक और स्थानीय मेजबान प्रतिरक्षा को 2-4 नियमन से रोगजनकों के लिए एक दुर्गम वातावरण बना सकते हैं। बैक्टीरियल Microbiome के महत्व के लिए बढ़ती सराहना भी कई नैदानिक ​​संदर्भों में बैक्टीरियल समुदायों निस्र्पक में दिलचस्पी बढ़ गई है। यहाँ हम जननांग के फाहे से बैक्टीरियल Microbiome की संरचना का निर्धारण करने के लिए एक विधि का वर्णन। प्रोटोकॉल आसानी से मल के नमूने और swabs अन्य संरचनात्मक स्थानों और अन्य मेजबान प्रजातियों से एकत्र करने के लिए संशोधित किया जा सकता है।

नमूनों की संख्या में निहित सीमाओं एकत्र किया जा सकता है कि और संग्रहीत एक दिया संवर्धन से के कारणY भागीदार, इस प्रोटोकॉल एक अनुकूलित फिनोल के क्लोरोफॉर्म आधारित मनका पिटाई विधि 5,6 उपयोग कर एक ही झाड़ू से डीएनए, आरएनए और संभवतः भी प्रोटीन निकालने के लिए डिजाइन किया गया था। मनका पिटाई और डिटर्जेंट के साथ रासायनिक विघटन के साथ बैक्टीरिया कोशिका दीवारों के भौतिक व्यवधान के संयोजन अतिरिक्त enzymatic पाचन कदम के बिना, ग्राम पॉजिटिव ग्राम नकारात्मक, और एसिड फास्ट बैक्टीरिया के तेजी से सेल की अनुमति देता है। उच्च गुणवत्ता शाही सेना को प्राप्त करने के लिए, यह सूखा swabs कि कम या 4 डिग्री से नीचे रखा गया था इस्तेमाल की सिफारिश की है सी तुरंत संग्रह के बाद और -80 डिग्री सेल्सियस पर प्रयोगशाला (यदि लागू हो) के लिए परिवहन, और संग्रहीत लंबी अवधि के दौरान।

किसी नमूने के भीतर बैक्टीरियल Microbiome निर्धारित करने के लिए, इस प्रक्रिया -16 rRNA जीन amplicon अनुक्रमण, जो वर्तमान में सबसे अधिक लागत प्रभावी साधन व्यापक बैक्टीरियल वर्गीकरण आवंटित करने और रिश्तेदार मात्रा का ठहराव प्रदर्शन करना है इस्तेमाल करता है। वैकल्पिक तरीकों qPCR 7 लक्षित शामिल हैं, कस्टम microarrays 8, और पूरे जीनोम अनुक्रमण 9। -16 RRNA जीन नौ hypervariable क्षेत्रों में शामिल है, और वहाँ कोई इष्टतम वी क्षेत्र के बारे में योनि Microbiome अध्ययन के लिए अनुक्रम करने के लिए आम सहमति है। यहाँ हम 515F / 806R प्राइमर सेट का उपयोग करें और Càpòràsò एट अल। 10-12 द्वारा डिजाइन पाइप लाइन पर निर्माण। Càpòràsò एट अल। 'S 515F / 806R प्राइमर सेट मान्य बारकोड वाले प्राइमरों और Illumina अनुक्रमण प्लेटफार्म के साथ संगतता के हजारों की उपलब्धता के कारण एक भी अनुक्रमण रन पर नमूने के सैकड़ों बहुसंकेतन सक्षम बनाता है। विपरीत मानव Microbiome परियोजना के 27F / 338R प्राइमर 13 सेट, 515F / 806R भी प्रभावी ढंग से Bifidobacteriaceae amplifies और इस तरह सही गर्द्नेरेल्ला वेजिनेलिस, कुछ महिलाओं में योनि माइक्रोबियल समुदाय का एक महत्वपूर्ण सदस्य कब्जा। वैकल्पिक रूप से, एक 338F / 806R प्राइमर जोड़ी सफलतापूर्वक योनि नमूनों 14 और 515F / 926R प्राइमर जोड़ी rece है की pyrosequencing के लिए इस्तेमाल किया गया हैntly अगली पीढ़ी के अनुक्रमण 12 के लिए उपलब्ध हो गया है।

अंतत: इस प्रोटोकॉल माइक्रोबियल पारिस्थितिकीय (QIIME) सॉफ्टवेयर पैकेज 15 में मात्रात्मक amplicon इनसाइट्स का उपयोग कर -16 विश्लेषण करने के लिए बुनियादी निर्देश प्रदान करता है। यहाँ वर्णित QIIME आदेशों के सफल क्रियान्वयन के लिए प्रत्येक नमूना बैक्टीरियल वर्गीकरण प्रचुरता से युक्त एक मेज पैदावार। QIIME वेबसाइट पर विस्तार से वर्णित के रूप में कई अतिरिक्त गुणवत्ता नियंत्रण कदम, वर्गीकरण विधियों, और विश्लेषण कदम, विश्लेषण में शामिल किया जा सकता है (http://qiime.org/index.html)। विश्लेषण एक एप्पल कंप्यूटर पर प्रदर्शन किया जाएगा, तो MacQIIME पैकेज 16 QIIME और इसकी निर्भरता की आसान स्थापना प्रदान करता है। -16 RRNA जीन अनुक्रम विश्लेषण के लिए वैकल्पिक सॉफ्टवेयर संकुल Mothur 17 और 18 UPARSE शामिल हैं।

Protocol

अध्ययन प्रोटोकॉल ने मंजूरी दे दी है और क्वाजुलु नटाल विश्वविद्यालय के बायोमेडिकल रिसर्च आचार समिति (डरबन, दक्षिण अफ्रीका) और मैसाचुसेट्स जनरल अस्पताल संस्थागत समीक्षा बोर्ड (2012P001812 / MGH, बोस्टन, एमए) के दिशा-निर्देशों का पालन किया गया था।

Cervicovaginal Swabs से कुल न्यूक्लिक एसिड की 1. निष्कर्षण

नोट: 16 नमूने या कम के सेट में न्यूक्लिक एसिड एक्सट्रेक्शन प्रदर्शन करना। प्रोटोकॉल के रूप में नीचे लिखा मानता नमूने 12 के सेट में कार्रवाई कर रहे हैं एक्सट्रेक्शन के कई दौर प्रदर्शन, क्रमानुसार निकासी बैचों संख्या और प्रत्येक का नमूना की निकासी के बैच नंबर के साथ ही अन्य नमूना जानकारी रिकॉर्ड हैं (जैसे प्रतिभागी की आईडी नंबर, उम्र के रूप में मेटाडाटा को शामिल , 1 टेबल में झाड़ू संग्रह, हार्मोनल गर्भनिरोधक के प्रकार, यौन संचारित संक्रमण परीक्षण के परिणाम, आदि) की तारीख / समय।

  1. अभिकर्मकों और धूआं हुड की तैयारी
    1. 1 मिलीलीटर फिनोल प्रति Tris क्षारीय बफर के 65 μl, दो चरणों में जोड़ने से 2 मिनट के लिए मिश्रण मिलाते हुए, और अनुमति देकर पीएच 7.9 से (1 25: 24): क्लोरोफॉर्म: isoamyl शराब (आईएए) फिनोल के पीएच को समायोजित या तो स्वाभाविक रूप से या आरटी पर 5 मिनट के लिए 10,000 XG पर centrifugation द्वारा अलग।
      सावधानी: फिनोल विषैले, अगर निगल अगर साँस, या त्वचा और आंखों के साथ संपर्क में है। धुएं में सांस लेने मत करो। अभेद्य दस्ताने, पक्ष-ढाल के साथ सुरक्षा चश्मा, और एक प्रयोगशाला कोट पहनें।
    2. फिल्टर बाँझ 0.22 माइक्रोन फिल्टर के माध्यम से 20% सोडियम dodecyl सल्फेट (एसडीएस) के 25 मिलीलीटर। निष्फल एसडीएस के 5 मिलीलीटर aliquots बनाओ।
    3. -20 डिग्री सेल्सियस पर isopropanol की एक 10 मिलीलीटर विभाज्य टेंशन मत लो।
    4. एक मनका पिटाई ट्यूब तैयार प्रत्येक S के लिएWAB एक बाँझ 2 मिलीलीटर ट्यूब मनका डिब्बा लिए उपयुक्त है कि में कांच के मोती के 0.3 ग्राम वजन द्वारा कार्रवाई की जा सके।
    5. एक बाँझ शोषक झाड़ू के साथ बहिर्जरायुग्रीवा नमूने द्वारा swabs प्राप्त करते हैं। तुरंत संग्रह के बाद, झाड़ू एक खाली और बाँझ cryovial, दुकान में 4 डिग्री सेल्सियस पर 1 से 4 घंटा के लिए प्रयोगशाला में परिवहन के दौरान जगह है, और -80 डिग्री सेल्सियस पर कई महीनों के लिए दुकान। swabs (व्यक्तिगत नलियों के भीतर निहित) स्थानांतरण गीला बर्फ के लिए कार्रवाई की जा सके।
    6. जैविक सुरक्षा कैबिनेट (बीएससी) तैयार करें। एक "नोक" इमारत निकास से जुड़े वाष्पशील रसायनों का उचित हटाने सुनिश्चित करने के साथ एक बीएससी का प्रयोग करें।
      1. हुड से सभी सामग्री निकालें।
      2. ब्लीच के साथ डाकू, एक decontaminant कि सतहों से RNases, DNases, और डीएनए को हटा द्वारा पीछा किया की सभी सतहों को साफ करें। स्वच्छ बाद के सभी आइटम हुड दस्ताने सहित एक न्यूक्लिक एसिड decontaminant, द्वारा पीछा ब्लीच का उपयोग में लाया जाता है। ऐसे पी के रूप में ताजा RNase / DNase मुक्त अभिकर्मकों, का प्रयोग करेंipette टिप्स, जब भी संभव है।
      3. हुड के पीछे करने के लिए एक निष्फल रासायनिक Biohazard बैग टेप। फिनोल या क्लोरोफॉर्म युक्त सभी सूखे कचरे उचित निपटान के लिए इस बैग में रखा जाना चाहिए।
      4. तरल फिनोल या क्लोरोफॉर्म युक्त कचरे को इकट्ठा करने के लिए हुड में एक बाँझ बोतल रखें।
  2. फिनोल के क्लोरोफॉर्म निष्कर्षण।
    1. हुड में, प्रत्येक मनका पिटाई ट्यूब के लिए, बफर के 500 μl जोड़ने, 20% सोडियम dodecyl सल्फेट के 210 μl, और फिनोल के 500 μl (कदम 1.1.1 से): क्लोरोफॉर्म: आई ए ए (25: 24: 1, पीएच 7.9 )।
    2. बाँझ संदंश की एक नई जोड़ी का उपयोग मनका पिटाई ट्यूब में परिवहन शीशी से झाड़ू स्थानांतरण। अच्छी तरह से कम से कम 30 सेकंड के लिए मनका पिटाई ट्यूब की आंतरिक दीवारों के खिलाफ झाड़ू सिर रगड़ें। री-कैप नमूना जब किया। यदि एक से अधिक के फाहे से एक्सट्रेक्शन प्रदर्शन, प्रत्येक नमूने के बीच दस्ताने बदल जाते हैं।
    3. कम से कम 10 मिनट के लिए बर्फ पर नमूना टेंशन मत लो। से झाड़ू हटायेबाँझ चिमटी के साथ झाड़ू संभाल धारण करते हुए एक स्वच्छ P200 टिप का उपयोग आंतरिक ट्यूब दीवार खिलाफ झाड़ू सिर दबाकर ट्यूब की धड़कन मनका। सूखी रासायनिक अपशिष्ट बैग में swabs त्यागें। नोट: "squeegee" कार्रवाई (झाड़ू सिर दबाने) शोषक झाड़ू से तरल आजाद कराने और न्यूक्लिक एसिड वसूली में वृद्धि होगी।
    4. मनका पिटाई ट्यूब मनका डिब्बा में रखें और 4 डिग्री सेल्सियस पर 2 मिनट का homogenize।
    5. अपकेंद्रित्र 6000 XG पर 3 मिनट और 4 डिग्री सेल्सियस के लिए मनका पिटाई ट्यूब मलबे गोली और अलग जलीय और फिनोल चरणों के लिए।
    6. एक बाँझ 1.5 मिलीलीटर ट्यूब के लिए - (600 μl ~ 500) जलीय चरण हस्तांतरण। क्लोरोफॉर्म: की फिनोल एक बराबर मात्रा मे आई ए ए। उलटा और संक्षिप्त vortexing द्वारा मिक्स।
    7. 16,000 XG पर 5 मिनट और 4 डिग्री सेल्सियस के लिए ट्यूब अपकेंद्रित्र।
    8. एक नया बाँझ 15 मिलीलीटर ट्यूब जलीय चरण हस्तांतरण। रूढ़िवादी हो सकता है और अंतरावस्था परत या अंतर्निहित फिनोल से सामग्री का हस्तांतरण नहीं हैअवस्था। स्थानांतरित कर जलीय चरण की मात्रा पर ध्यान दें। भविष्य प्रोटीन अलगाव के लिए फिनोल चरण बचाओ।
    9. isopropanol के 0.8 मात्रा और 3M सोडियम एसीटेट (5.5 पीएच) के 0.1 मात्रा में जोड़ें। उलटा और संक्षेप vortexing द्वारा अच्छी तरह मिक्स।
    10. ट्यूब (हे / एन तक) के कम से कम 2 घंटे के लिए -20 डिग्री सेल्सियस पर Chilling द्वारा न्यूक्लिक एसिड वेग।
  3. Isopropanol वर्षा और इथेनॉल धोने
    1. लगभग 16,000 XG और से 4 डिग्री सेल्सियस 30 मिनट के लिए ट्यूब अपकेंद्रित्र। ध्यान से सतह पर तैरनेवाला को दूर करने, गोली बरकरार जा एक पिपेट का उपयोग करें।
    2. 100% इथेनॉल के 500 μl जोड़ें। गोली छूने के बिना कोमल vortexing या pipetting के साथ गोली बेदखल। 16,000 XG पर 5 मिनट और 4 डिग्री सेल्सियस के लिए अपकेंद्रित्र।
    3. ध्यान से इथेनॉल सतह पर तैरनेवाला त्यागें। गोली परेशान बिना संभव के रूप में के रूप में ज्यादा इथेनॉल निकालने के लिए एक P10 pipet का प्रयोग करें।
    4. एयर 15 मिनट के लिए आरटी पर गोली सूखी।
    5. यू के 20 μl में गोली Resuspendltra शुद्ध 0.1x Tris-EDTA बफर। नमूना बार बार 10 मिनट के लिए और पिपेट के लिए बर्फ पर ठंडा करने के लिए अनुमति दें पूर्ण मेजबान सुनिश्चित करने के लिए। अगर गोली भंग नहीं होता है, को 10 मिनट के लिए सहायता करने के विघटन के लिए एक 40 डिग्री सेल्सियस गर्मी ब्लॉक करने ट्यूब हस्तांतरण।
    6. एक स्पेक्ट्रोफोटोमीटर 19 का उपयोग कर न्यूक्लिक एसिड एकाग्रता उपाय।
    7. अगर वांछित, शाही सेना से अलग डीएनए एक स्तंभ साफ-अप किट का उपयोग कर, निर्माता प्रोटोकॉल 20 निम्नलिखित।
    8. -80 डिग्री सेल्सियस पर न्यूक्लिक एसिड या स्टोर जारी है।

2. -16 rRNA जीन V4 Hypervariable क्षेत्र की पीसीआर प्रवर्धन

ध्यान दें: प्रदूषण और मानव त्रुटि के जोखिम को कम करने के लिए 12 नमूने या कम के सेट में पीसीआर प्रवर्धन प्रदर्शन करते हैं। तो प्रवर्धन के कई दौर प्रदर्शन, क्रमानुसार प्रवर्धन बैचों नंबर और तालिका 1 में प्रत्येक नमूना के प्रवर्धन बैच संख्या रिकॉर्ड है।

  1. तैयारी ओअभिकर्मकों और पीसीआर हुड च
    1. तालिका 1 के लिए पीसीआर प्रवर्धन सेट जानकारी है, जो अनुक्रम विश्लेषण चरण में मैपिंग फ़ाइल के आधार के रूप में काम करेगा जोड़ें।
    2. एक पीसीआर हुड से सभी सामग्री निकालें और एक decontaminant कि RNases, DNases, और डीएनए को हटा द्वारा पीछा किया ब्लीच के साथ अच्छी तरह से आंतरिक सतहों को साफ। उन्हें हुड में रखने से पहले हर अभिकर्मक और उपकरणों (जैसे, pipettes) का टुकड़ा शुद्ध करना सुनिश्चित करें। ताजा दस्ताने हुड में काम करने से पहले एक न्यूक्लिक एसिड decontaminant से साफ पहनें।
    3. यदि आवश्यक हो, से 50 न्यूक्लिक एसिड टेम्पलेट पतला - एनजी 100 / डीएनए से मुक्त और nuclease मुफ्त पानी का उपयोग μl।
    4. 5x उच्च निष्ठा (एचएफ) बफर, dNTPs, और स्वच्छ पीसीआर हुड में प्राइमरों का पिघलना aliquots। धीरे भंवर और विगलन के बाद सभी समाधान सेंट्रीफ्यूज। फ्रीज पिघलना चक्र और शेयर संदूषण के जोखिम को कम करने के लिए, 5x एचएफ बफर, dNTPs, और प्राइमरों की aliquots तैयार करते हैं।
    5. एक रखेंmicrocentrifuge ट्यूब और हुड में एक पीसीआर प्लेट कूलर के लिए स्वच्छ benchtop कूलर रैक।
  2. पीसीआर प्रतिक्रिया लिए, अति शुद्ध पानी का 15.5 μl, 5x एचएफ बफर के 5 μl, dNTPs के 0.5 μl, 515F आगे प्राइमर के 0.5 μl, 3% DMSO के 0.75 μl, और के लिए पोलीमरेज़ के 0.25 μl के संयोजन से मास्टर मिश्रण तैयार प्रत्येक प्रतिक्रिया। कूलर में सभी प्रतिक्रिया घटकों को इकट्ठा और पोलीमर्स पिछले जोड़ें। pipetting द्वारा अच्छी तरह मिक्स। जब मास्टर मिश्रण तैयार करने, pipetting त्रुटि के लिए खाते में प्रतिक्रिया गिनती के लिए दो अतिरिक्त नमूने जोड़ें।
  3. पीसीआर प्रतिक्रिया स्थापना:
    नोट: तीन प्रतियों में amplifications प्रदर्शन करना है, जिसका अर्थ प्रत्येक नमूना तीन अलग-अलग 25 μl प्रतिक्रियाओं में परिलक्षित होता है। प्रत्येक प्राइमर जोड़ी के साथ एक नहीं, टेम्पलेट पानी नियंत्रण चलाएँ। जल्दी लेकिन ध्यान से काम करते हैं, किसी भी संक्रमण की शुरूआत से परहेज।
    1. एक पीसीआर कूलर में अलग-अलग कैप और जगह के साथ एक 8 अच्छी तरह से पट्टी लेबल।
    2. पिपेट 90 प्रथम में मास्टर मिश्रण के μlकुंआ।
    3. रिवर्स प्राइमर (पूरक फ़ाइल 1) के 2 μl जोड़ें। ध्यान से नोट करने के लिए 1 टेबल में प्रत्येक नमूने के साथ इस्तेमाल किया रिवर्स प्राइमर बारकोड सुनिश्चित करें।
    4. अच्छी तरह मिक्स और चौथे में अच्छी तरह से (कोई टेम्पलेट नियंत्रण) करने के लिए मास्टर मिश्रण के 23 μl हस्तांतरण।
    5. चौथे अच्छी तरह से करने के लिए पानी के 2 μl जोड़ें।
    6. पहले अच्छी तरह से करने के लिए उचित नमूना के 6 μl जोड़े। अच्छी तरह मिक्स और दूसरे को अच्छी तरह से करने के लिए 25 μl हस्तांतरण। सुझाव और अच्छी तरह से तीसरे करने के पहले अच्छी तरह से एक और 25 μl हस्तांतरण बदलें। मजबूती से हर अच्छी तरह से टोपी, यकीन है कि इस प्रक्रिया में कुओं के अंदर या टोपी को छूने के लिए नहीं कर रही है।
    7. प्रत्येक नमूना के लिए दोहराएँ।
  4. पीसीआर प्रवर्धन प्रदर्शन करना
    1. एक thermocycler करने के लिए पट्टी ट्यूबों स्थानांतरण और निम्नलिखित प्रोग्राम चलाने: 98 डिग्री सेल्सियस पर 30 सेकंड, 10 सेकंड के 30 चक्रों के बाद 98 डिग्री सेल्सियस पर 57 डिग्री सेल्सियस पर 30 सेकंड, और 72 डिग्री सेल्सियस पर 12 सेकंड, एक के द्वारा पीछा 10 मिनट 72 डिग्री सेल्सियस और अंतिम पकड़ एक पर पकड़टी 4 डिग्री सेल्सियस।
    2. एक साफ प्रयोगशाला बेंच पर निम्न चरणों का प्रदर्शन। जल्दी नलियों की दीवारों स्पिन से तरल इकट्ठा करने के लिए। प्रत्येक नमूने से तीन प्रतियों पीसीआर प्रतिक्रियाओं का मिश्रण है, 75 μl की कुल मात्रा के साथ, एक बाँझ लेबल ट्यूब में। इसके अलावा एक अलग बाँझ ट्यूब में प्रत्येक कोई टेम्पलेट नियंत्रण के 25 μl हस्तांतरण। अभी तक विभिन्न नमूनों से amplicons गठबंधन नहीं है।
  5. जेल वैद्युतकणसंचलन द्वारा नमूनों की सफल पीसीआर प्रवर्धन के मान्यकरण।
    1. प्रत्येक amplicon, पानी नियंत्रण, और सीढ़ी 21 पकड़ लिए पर्याप्त कुओं के साथ (1x TAE के बफर के 100 मिलीलीटर के 1.5 ग्राम agarose पाउडर) 1.5% agarose जेल तैयार करें।
    2. जबकि जेल मज़बूत बनाता है (लगभग 30 मिनट), वैद्युतकणसंचलन के लिए नमूना तैयार: एक नए, लेबल ट्यूब के लिए 6x लोडिंग डाई का 1 μl जोड़े। कि ट्यूब करने के लिए, amplicon के 5 μl जोड़ें और pipetting द्वारा मिश्रण।
    3. जब जेल का गठन किया है, कंघी हटाने वैद्युतकणसंचलन टैंक में जेल जगह है, और 1x TAE बफर के साथ टैंक को भरने। पहले अच्छी तरह से करने के लिए, डीएनए सीढ़ी के 5 μl जोड़ें।
    4. लोड अच्छी तरह से एक और नमूना amplicon के 5 μl। लोड एक अलग अच्छी तरह से करने के लिए कोई टेम्पलेट amplicon के 5 μl। जारी के रूप में प्रत्येक के नमूने के लिए की जरूरत है।
    5. जब सभी नमूनों लोड किया गया है, जगह में टैंक के ढक्कन स्लाइड और 120 शक्ति के स्रोत पर बारी वी जेल 30 के लिए चलाने की अनुमति दें - 60 मिनट।
    6. पराबैंगनी प्रकाश के तहत जेल देखें।
      1. 380 बीपी के आसपास एक भी मजबूत बैंड टिप्पण द्वारा एक नमूना के सफल प्रवर्धन की जाँच करें। अगर वहाँ एक डबल बैंड है, एक अलग रिवर्स बारकोड (2.3 कदम) के साथ नमूना फिर से बढ़ाना। अगर वहाँ कोई बैंड है सब पर है, का उपयोग कर सकते हैं या तो एक ही रिवर्स बारकोड या एक नया रिवर्स बारकोड (2.3 कदम) नमूना फिर से बढ़ाना। तो फिर से प्रवर्धन असफल है, पीसीआर अवरोधकों नमूना है, जो मामले में, पीसीआर अवरोधकों को हटाने के लिए एक स्तंभ आधारित डीएनए सफाई प्रदर्शन में मौजूद हो सकता है।
        नोट: सफल प्रवर्धन संभव नहीं हो सकता है, अगर में जीवाणु के डीएनए एकाग्रता याiginal नमूना अपर्याप्त (<एनजी 5 / μl) है।
      2. कोई टेम्पलेट नियंत्रण में एक बैंड के अभाव टिप्पण द्वारा अभिकर्मक संदूषण की कमी की जाँच करें।
    7. -20 डिग्री सेल्सियस पर amplicon के शेष 70 μl स्टोर। कोई टेम्पलेट नियंत्रण के शेष 20 μl त्यागें, यह सोचते हैं कि यह एक बैंड उपज नहीं था।

3. लाइब्रेरी और उच्च throughput अनुक्रमण पूलिंग

  1. एक भी बाँझ ट्यूब में प्रत्येक amplicon की - (5 μl 2) एक समान मात्रा के संयोजन से amplicon पूल बनाएँ। तो एक नमूना से बैंड विशेष रूप से कमजोर लग रहा था, नमूने के आराम करने के लिए दो बार मात्रा रिश्तेदार जोड़ें।
  2. Amplicon पूल एक पीसीआर क्लीन अप किट का उपयोग करने से पीसीआर प्राइमरों निकालें, निर्माता के निर्देशों 22 के बाद। एकाधिक स्तंभों के साथ साफ-अप करते हैं amplicon पूल मात्रा 100 μl खत्म हो गया है। नोट: प्रत्येक स्तंभ एक 100 μl क्षमता है।
    1. -20 & # पर पुस्तकालय की दुकान176; सी या अगले चरण पर जाएँ।
  3. यदि लागू हो, अंतिम पुस्तकालय बनाने के लिए प्राइमर-amplicon मुक्त पूल गठबंधन। पुस्तकालय एक स्पेक्ट्रोफोटोमीटर या fluorometric प्रणाली का उपयोग करते हुए 23 के डीएनए एकाग्रता का निर्धारण। 1.8 के बीच एक अनुपात 260/280 - 2.0 शुद्ध डीएनए का संकेत है।
  4. 20 एनएम पुस्तकालय पतला। एक वैद्युतकणसंचलन साधन का उपयोग कर 400 बीपी के चारों ओर एक एक बैंड visualizing द्वारा पुस्तकालय की गुणवत्ता की पुष्टि करें। पुस्तकालय एक fluorometric प्रणाली का उपयोग कर 23 की एकाग्रता की पुष्टि करें।
  5. 2 एनएम पुस्तकालय कमजोर करने के लिए पानी में एक अंतिम 1:10 कमजोर पड़ने प्रदर्शन करना। फिर, अनिश्चित काल के लिए 20 ° सी में पुस्तकालय की दुकान।
  6. तीन आवश्यक अनुक्रमण प्राइमरों के साथ अंतिम पुस्तकालय के एक विभाज्य भेजें (पढ़ें 1, पढ़ें 2, और सूचकांक; सामग्री / उपकरण की टेबल्स देखें) एक Illumina sequencer पर अनुक्रमित किया। कम से कम 300 नमूने अनुक्रमण के लिए मल्टिप्लेक्स किया गया है, एक एकल अंत 300 रन बीपी का उपयोग करें और एक 12 बीपी सूचकांक के साथ पढ़ा हेna MiSeq, 5 बजे के एक अंतिम एकाग्रता पुस्तकालय और एक 10% विकृत PhiX कील-इन के साथ। विस्तृत अनुक्रमण निर्देश के लिए Càpòràsò एट अल। ISME जम्मू, 2012 10 के पूरक सामग्री देखें।

4. अनुक्रम विश्लेषण

नोट: यहाँ रेखांकित QIIME 1.8.0 सॉफ्टवेयर पैकेज का उपयोग कर अनुक्रम विश्लेषण के लिए एक बुनियादी पाइपलाइन है। सादगी के लिए, बशर्ते आदेशों को लगता है कि मैपिंग फ़ाइल mapping.txt कहा जाता है, 12 बीपी इंडेक्स पढ़ने के लिए फ़ाइल index.fastq कहा जाता है, और 300 बी पी अनुक्रमण पढ़ने के लिए फ़ाइल sequences.fastq कहा जाता है। QIIME या MacQIIME 16 स्थापित करें और यूनिक्स के मूल के साथ खुद को परिचित इन आदेशों पर अमल करने की। पढ़ें QIIME करने के लिए पूरा गाइड:

  1. प्रयोग (1 टेबल) के लिए मैपिंग फ़ाइल को पूरा करें। जितना संभव हो उतना मेटाडाटा को शामिल करें। नोट जो नमूने निकाला गया है या एक ही बैच में परिलक्षित, निर्धारित करने के लिए बैच प्रभाव देखते हैं कि क्या।
  2. जैसे, mapping.txt के रूप में मानचित्रण फ़ाइल सहेजें। validate_mapping_file.py -m mapping.txt -o mapping_output: निम्न आदेश को क्रियान्वित करने से मैपिंग फ़ाइल के स्वरूपण मान्य
    नोट: यह आदेश निर्मित "validate_mapping_file.py" QIIME स्क्रिप्ट है कि एक नया फ़ोल्डर, "mapping_output" कहा जाता है बनाता है, एक .html मैपिंग फ़ाइल त्रुटियों का संकेत फ़ाइल युक्त अगर किसी भी उपयोग करता है।
  3. गुणवत्ता की जांच के लिए एक उच्च throughput अनुक्रमण के अनुक्रम डेटा की गुणवत्ता, ऐसे FastQC के रूप में कार्यक्रम की जाँच का उपयोग कर पढ़ता (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/)। 5 चित्रा आधार अनुक्रम प्रति गुणवत्ता को दर्शाता कि एक सफल रन से उम्मीद की जा सकती है।
    नोट: sequencer प्रत्येक न्यूक्लियोटाइड आधार एक फ़्रेड गुणवत्ता स्कोर, जो संभावना है कि आधार ग़लती से बुलाया गया है से मेल खाती है प्रदान करती है। 10 का एक फ़्रेड गुणवत्ता स्कोर को इंगित करता है वहाँ एक 10% मौका है कि न्यूक्लियोटाइड गलत तरीके से आवंटित किया गया है है किएड, 20 एक 1% मौका इंगित करता है, 30 एक 0.1% मौका इंगित करता है, और 40 (सबसे अधिक संभव अंक) एक 0.01% मौका 24 इंगित करता है।
  4. के रूप में एक महत्वपूर्ण मैपिंग फ़ाइल का उपयोग करना, demultiplex, गुणवत्ता फिल्टर अनुक्रमण डेटा, और 25 इस आदेश को क्रियान्वित करने से एक फ़ोल्डर (इस मामले में, "sl_out" कहा जाता है) के परिणामों को बचाने: split_libraries_fastq.py --rev_comp_mapping_barcodes -मैं sequences.fastq -o sl_out / बी index.fastq -m mapping.txt -q 29
    नोट: क्यू झंडा अधिकतम अस्वीकार्य फ़्रेड गुणवत्ता स्कोर को दर्शाता है, जैसे, "-q 29" 30 के नीचे फ़्रेड स्कोर के साथ किसी भी दृश्यों से बाहर फिल्टर, बेस कॉल की 99.9% सटीकता सुनिश्चित करने।
  5. Greengenes -16 परिचालन वर्गीकरण इकाई (OTU) संदर्भ डेटाबेस 26 (http://qiime.org/home_static/dataFiles.html) का उपयोग करना, खुले संदर्भ OTU उठा लिए प्रदर्शन इस आदेश को क्रियान्वित करने से 27: pick_open_reference_otus.py -मैं sl_out / seqs। Fna -r 97_otus.fasta -o ucrss / एस 0.1
    नोट: -s ध्वज इंगित करता हैदृश्यों का अंश है कि संदर्भ डेटाबेस है कि नए सिरे से क्लस्टरिंग में शामिल किया जाएगा करने के लिए पंक्ति में विफल रहा है। "-s 0.1 'डी नोवो क्लस्टरिंग में असफल दृश्यों का 10% शामिल हैं। OTU उठा प्रक्रिया parallelize और घंटे दिनों से प्रसंस्करण का समय कम है, तो कई कोर उपलब्ध हैं -एक ध्वज का प्रयोग करें।
  6. Summarize_taxa.py -मैं ucress / otu_table_mc2.biom -o summarized_otuSpecies / एल 7: 28 इस आदेश को क्रियान्वित करने से प्रजातियों के स्तर पर otus के विलय से एक उपयोगकर्ता के अनुकूल वर्गीकरण बहुतायत तालिका बनाएँ
    नोट: जिसके परिणामस्वरूप तालिका आसानी से किसी भी स्प्रेडशीट सॉफ्टवेयर में देखी जा सकती है। ध्यान दें कि -16 rRNA अनुक्रमण मज़बूती प्रजातियों के स्तर का संकल्प प्रदान नहीं करता है।
  7. QIIME स्क्रिप्ट alpha_diversity.py के साथ कई अल्फा विविधता मेट्रिक्स कंप्यूटिंग द्वारा प्रत्येक नमूना भीतर पारिस्थितिक विविधता का निर्धारण करते हैं। फिर, QIIME स्क्रिप्ट beta_diversity.py का उपयोग कर नमूने के जोड़े के बीच विविधता का निर्धारण।
  8. विज़डेटा, जैसे ualize, एक सम्राट 29 प्रिंसिपल का उपयोग करके साजिश या हीटमैप का समन्वय करता है।
  9. QIIME के compare_catagories.py स्क्रिप्ट के साथ 30, मानचित्रण फ़ाइल श्रेणियों, जैसे की औपचारिक सांख्यिकीय तुलना प्रदर्शन करना।

Representative Results

प्रोटोकॉल है, जो एक झाड़ू -16 rRNA जीन अनुक्रमण का उपयोग करने से रिश्तेदार बैक्टीरियल प्रचुरता के निर्धारण के लिए सक्षम बनाता है की सामान्य अवलोकन, चित्रा में दिखाया गया है 1 व्याप्ति प्रोटोकॉल मानव योनि swabs के लिए अनुकूलित किया गया है, लेकिन आसानी से सबसे श्लैष्मिक नमूना साइटों के लिए अनुकूलित किया जा सकता और अन्य मेजबान। चित्रा 2 उच्च गुणवत्ता वाले डीएनए और आरएनए कि मनका पिटाई प्रोटोकॉल का उपयोग कर अलग किया जा सकता दर्शाता है। चित्रा 3 से 12 नमूनों में से एक सफल पीसीआर प्रवर्धन, जहां एक नमूने के साथ प्रत्येक प्रवर्धन सही का एक भी मजबूत बैंड झुकेंगे दिखाता है आकार और प्रत्येक पानी नियंत्रण एक बैंड उपज नहीं था। चित्रा 4 अनुक्रमण करने से पहले अंतिम पुस्तकालय पूल की मात्रा का ठहराव को दिखाता है। चित्रा 5 एक एकल अंत में 300 बीपी MiSeq चलाने के बाद एक विशिष्ट अनुक्रम गुणवत्ता प्रोफ़ाइल से पता चलता है।

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
चित्रा 1. प्रोटोकॉल के योजनाबद्ध अवलोकन। सबसे पहले, न्यूक्लिक एसिड एक बफर समाधान फिनोल, क्लोरोफॉर्म, और isoamyl शराब युक्त मनका पिटाई करके एक झाड़ू से निकाला जाता है। -16 RRNA जीन का अस्थिर क्षेत्र 4 तब पीसीआर का उपयोग जिसके परिणामस्वरूप न्यूक्लिक एसिड से परिलक्षित होता है। नमूनों की सैकड़ों करने के लिए ऊपर से पीसीआर amplicons तो संयुक्त और एक भी रन पर अनुक्रम कर रहे हैं। जिसके परिणामस्वरूप दृश्यों एक संदर्भ डेटाबेस रिश्तेदार बैक्टीरियल प्रचुरता का निर्धारण करने के लिए मिलान कर रहे हैं। पूरे प्रोटोकॉल लगभग तीन दिनों में किया जा सकता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2 उच्च गुणवत्ता न्यूक्लिक एसिड निकाले फिनोल का प्रयोग: क्लोरोफॉर्म मनका बैरंग एमethod। (ए) डीएनए गुणवत्ता, के रूप में एक स्पेक्ट्रोफोटोमीटर का उपयोग का आकलन किया। 1.8 और 2.0 के बीच एक A260 / A280 अनुपात शुद्ध न्यूक्लिक एसिड कि फिनोल या प्रोटीन के साथ दूषित नहीं है इंगित करता है। (बी) के एक स्तंभ साफ-अप के बाद, इस प्रोटोकॉल उच्च गुणवत्ता शाही सेना उपज कर सकते हैं, मजबूत -16 और 23S rRNA चोटियों से संकेत दिया। (सी) आरएनए गिरावट हो सकता है यदि नमूना संग्रह के बाद (परिवहन और भंडारण के दौरान) ठंड नहीं रखा है या यदि RNases प्रसंस्करण के दौरान मौजूद हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. सफल -16 rRNA जीन प्रवर्धन की पुष्टि 515F और बारकोड वाले 806R प्राइमर सेट का उपयोग करना। शीर्ष) जेल वैद्युतकणसंचलन 380 आधार जोड़े के चारों ओर एक एकल बैंड की मौजूदगी की पुष्टि करने के लिए प्रयोग किया जाता है in हर नमूना है कि टेम्पलेट के साथ परिलक्षित किया गया था। एक बैंड के अभाव असफल प्रवर्धन इंगित करता है; यह आम तौर पर मानव त्रुटि और कहा कि नमूना दोहराया जाना चाहिए से पीसीआर प्रतिक्रिया के कारण है। नीचे) कोई टेम्पलेट (पानी) के नियंत्रण में ही प्राइमर जोड़ी के साथ समानांतर में चलाए जा रहे एक बैंड वर्तमान नहीं होना चाहिए। पानी के नियंत्रण में बैंड के उपस्थिति दूषित अभिकर्मकों इंगित करता है; अभिकर्मकों कि दूषित किया जा सकता त्यागने फिर से करना है कि प्राइमर जोड़ी के लिए दोनों टेम्पलेट और पानी के नियंत्रण से पीसीआर amplifications। यह आंकड़ा एक बड़ा संस्करण देखने के करने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. अंतिम लाइब्रेरी पूल एकाग्रता की मात्रा और आकार के पुस्तकालय। अलग-अलग नमूना amplicons पूलिंग के बाद मान्यकरण, धअंतिम पुस्तकालय पूल के ई एकाग्रता निर्धारित किया जाना चाहिए। पुस्तकालय पूल तो आगे एक 2 एनएम एकाग्रता को प्राप्त करने के लिए पतला होना चाहिए। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5. प्रतिनिधि बार पढ़ें की प्रत्येक स्थिति में अनुक्रम गुणवत्ता स्कोर की साजिश है। यह क्रम गुणवत्ता के लिए 200 आधार जोड़े के बाद ड्रॉप करने के लिए सामान्य है, लेकिन औसत गुणवत्ता स्कोर 30 से ऊपर रहना चाहिए एक बड़ा संस्करण देखने के लिए यहां क्लिक करें यह आंकड़ा की।

#SampleID बारकोड
LinkerPrimer
अनुक्रम
rcbcPrimer नमूना प्रकार निष्कर्षण
जत्था
विस्तारण
प्लेट
विवरण
http://qiime.org/_static/Examples/File_: #An उदाहरण मैपिंग फ़ाइल में पाया जा सकता है
प्रारूप /
उदाहरण_
Mapping_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 सरवाइकल
झाड़ू
1

तालिका 1 मैपिंग फ़ाइल टेम्पलेट। Creaटिंग एक सटीक और पूरी तरह से मैपिंग फ़ाइल सफलतापूर्वक प्रोटोकॉल को क्रियान्वित करने के लिए महत्वपूर्ण है। मैपिंग फ़ाइल केवल QIIME को क्रियान्वित करने के लिए आवश्यक नहीं है, लेकिन यह भी नमूना बारकोड और मेटाडाटा के बीच की कड़ी को बनाए रखने के लिए, किसी भी व्यवस्थित पूर्वाग्रहों के लिए डेटा (जैसे, बैच को बैच विभिन्नता) का विश्लेषण करने के लिए, और यह निर्धारित करने के लिए सक्षम बनाता है शोधकर्ता मेटाडाटा और बैक्टीरियल आबादी के बीच दिलचस्प सहसंबंध। एक नंगे हड्डियों मैपिंग फ़ाइल प्रदान की जाती है, लेकिन उपयोगकर्ताओं के रूप में कई कॉलम संभव के रूप में मेटाडाटा युक्त जोड़ने के लिए प्रोत्साहित किया जाता है। एक योनि झाड़ू के लिए अतिरिक्त मेटाडाटा के उदाहरण प्रतिभागी की उम्र, तिथि / झाड़ू संग्रह, हार्मोनल गर्भनिरोधक प्रकार (यदि लागू हो), यौन संचारित संक्रमण परीक्षण के परिणाम, आदि के समय भी शामिल है

suppliment 1
पूरक फ़ाइल 1. बारकोड वाले रिवर्स प्राइमर दृश्यों 10 की सूची इस फ़ाइल को डाउनलोड करने के लिए यहां क्लिक करें।

Discussion

यहाँ हम एक मानव योनि झाड़ू के भीतर पहचान और रिश्तेदार बैक्टीरियल प्रचुरता के लक्षण वर्णन के लिए एक प्रोटोकॉल का वर्णन है। इस प्रोटोकॉल आसानी से इस तरह मल के रूप में अन्य प्रकार नमूना, और शरीर के अन्य साइटों के फाहे, के लिए और सूत्रों की एक विस्तृत विविधता से एकत्र नमूनों लिए अनुकूलित किया जा सकता है। मनका पिटाई से न्यूक्लिक एसिड की निकासी फिनोल और क्लोरोफॉर्म की एक बफर समाधान में दोनों डीएनए और आरएनए, जो विशेष रूप से महत्वपूर्ण है, जब नैदानिक ​​अध्ययन के माध्यम से एकत्र कीमती नमूनों के साथ काम करने का अलगाव के लिए अनुमति देता है। पृथक जीवाणु के डीएनए, जीवाणु वर्गीकरण पहचान और जीनोमिक विधानसभा के लिए उत्कृष्ट है, जबकि शाही सेना के एक साथ शाही सेना संग्रह seq के माध्यम से कार्यात्मक बैक्टीरियल, मेजबान, और वायरल योगदान निर्धारित करने का अवसर प्रदान करता है। वर्णित प्रोटोकॉल एक से मान्य एक कदम प्राइमर का गठन किया है कि सफलतापूर्वक मानवीय, कुत्ते सहित नमूना प्रकार की एक विस्तृत श्रृंखला पर तैनात किया गया है, और पर्यावरण के नमूने 10 का उपयोग करता है

इस प्रोटोकॉल के न्यूक्लिक एसिड निकासी हिस्से जब फिनोल और क्लोरोफॉर्म के साथ काम करने के लिए आवश्यक सुरक्षा सावधानियों, और एक उच्च throughput, 96 अच्छी तरह से थाली प्रारूप करने के लिए पाइप लाइन को स्वचालित करने की चुनौतियों से सीमित है। इसके अतिरिक्त, जोरदार पिटाई मनका लगभग 6 kilobase टुकड़े करने के लिए यांत्रिक सेल कैंची के लिए इस्तेमाल किया जीवाणु के डीएनए; अब डीएनए टुकड़े बहाव के अनुप्रयोगों, मनका पिटाई एस के अवधि के लिए आवश्यक हैंHould छोटा हो। इस प्रोटोकॉल के जीवाणु पहचान हिस्से की सीमाओं के किसी भी विधि है कि -16 rRNA जीन अनुक्रमण पर निर्भर करता है के लिए निहित हैं। -16 RRNA अनुक्रमण जीनस और यहां तक ​​कि प्रजातियों के स्तर को जीवाणु पहचान लिए आदर्श है, लेकिन शायद ही कभी तनाव के स्तर की पहचान प्रदान करता है। -16 RRNA जीन की V4 चर क्षेत्र सबसे बैक्टीरियल प्रजातियों 11 के बीच मजबूत भेदभाव प्रदान करता है, इस तरह के Oligotyping 31 के रूप में अतिरिक्त कम्प्यूटेशनल विधियों ठीक ऐसी लैक्टोबैसिलस crispatus के रूप में कुछ प्रजातियों की पहचान करने के लिए इस्तेमाल किया जा करना पड़ सकता है। अंत में, एक विशेष नमूना भीतर सटीक बैक्टीरियल कार्य क्षमताओं के बारे में जानकारी -16 rRNA जीन अनुक्रमण द्वारा अकेले निर्धारित नहीं किया जा सकता है, हालांकि इस प्रोटोकॉल के पूरे जीनोम डीएनए और आरएनए कि इस उद्देश्य की दिशा में इस्तेमाल किया जा सकता की निकासी के लिए सक्षम बनाता है।

इस प्रोटोकॉल के साथ सफलता सुनिश्चित करने के लिए सबसे महत्वपूर्ण कदम बड़ी सावधानी संदूषण dur को रोकने के लिए ले जा रहा हैआईएनजी नमूना संग्रह, न्यूक्लिक एसिड निकासी, और पीसीआर प्रवर्धन। स्वच्छ दस्ताने पहने और बाँझ swabs, ट्यूब, और कैंची का उपयोग करके नमूना संग्रह के बार में बाँझपन सुनिश्चित करें। संग्रह सामग्री के प्रदूषण के लिए आकलन करने के लिए, नमूने के समय परिवहन ट्यूबों में सीधे अतिरिक्त अप्रयुक्त swabs रखकर नकारात्मक नियंत्रण के फाहे इकट्ठा। प्रयोगशाला में, केवल decontaminated आपूर्ति युक्त और केवल आणविक ग्रेड, डीएनए से मुक्त अभिकर्मकों का उपयोग कर एक निष्फल हुड में सभी पूर्व प्रवर्धन चरणों का प्रदर्शन। न्यूक्लिक एसिड निकासी के दौरान, सभी ट्यूबों जब तक उपयोग में बंद कर प्रत्येक नमूने के साथ नया बाँझ संदंश और ताजा दस्ताने का उपयोग कर, और रखकर पार प्रदूषण को रोकने के। समानांतर में अप्रयुक्त swabs प्रसंस्करण दोनों नमूना संग्रह और न्यूक्लिक एसिड निकासी के बाँझपन सुनिश्चित करता है; अप्रयुक्त swabs isopropanol वर्षा और इथेनॉल धोने के बाद एक गोली उपज नहीं करना चाहिए। एक गोली दिखाई देता है, का एक संभावित स्रोत का निर्धारण करने के लिए प्रदर्शन -16 rRNA जीन प्रवर्धनसंदूषण (जैसे, स्ट्रेप्टोकोकस या Staphylococcus की उपस्थिति त्वचा संदूषण का संकेत होता)। इसके अतिरिक्त, यह सुनिश्चित करें कि पीसीआर अभिकर्मकों और प्रतिक्रियाओं दूषित नहीं किया गया है समानांतर में कोई टेम्पलेट नियंत्रण प्रतिक्रियाओं के साथ पीसीआर amplifications प्रदर्शन करते हैं। एक बैंड एक नहीं टेम्पलेट नियंत्रण में प्रकट होता है, अभिकर्मकों त्यागने और ताजा अभिकर्मकों के साथ प्रवर्धन दोहराएँ। इन सावधानियों ले रहा है हित के बैक्टीरिया के सफल अनुक्रमण सुनिश्चित करेगा।

पीसीआर प्रवर्धन कदम सबसे समस्या निवारण की आवश्यकता के लिए जाता है। बारह नमूने के सेट में amplifying दक्षता और स्थिरता के बीच एक संतुलन प्रदान करता है। एक दिया प्रवर्धन सेट में सभी नमूने भर में बैंड का पूर्ण अभाव एक व्यवस्थित विफलता को इंगित करता है, उदाहरण के लिए, एक अभिकर्मक जोड़ने की भूल या गलत तरीके से thermocycler प्रोग्रामिंग। कुछ नमूनों से एक बैंड के अभाव में आम तौर पर मानव त्रुटि के कारण है, और amplifications फिर से आर किया जाना चाहिएनमूना और रिवर्स प्राइमर का एक ही बाँधना के साथ संयुक्त राष्ट्र। एक बैंड के निरंतर अभाव के मामले में, नमूना एक अलग बारकोड के साथ एक रिवर्स प्राइमर का उपयोग फिर से परिलक्षित किया जा सकता है। कई रिवर्स प्राइमरों के साथ दोहराया प्रवर्धन विफलताओं एक अवरोध नमूने में मौजूद संकेत हो सकता है। उस मामले में, किसी स्तंभ के साथ डीएनए सफाई अक्सर काफी रिश्तेदार बैक्टीरियल प्रचुरता बदलने के बिना अवरोधकों को हटा देगा। कई बैंड प्रवर्धन के बाद परिणाम हैं, तो एक अलग रिवर्स प्राइमर बारकोड के साथ नमूना फिर से बढ़ाना।

पर्यावरण प्रदूषण को रोकने और एक भी विशिष्ट उत्पाद के प्रवर्धन सुनिश्चित करने के लिए इसके अलावा, सफल अनुक्रमण जब पुस्तकालय पूल तैयारी देखभाल पर निर्भर करता है। लक्ष्य यह सुनिश्चित करने के लिए लगभग अनुक्रमण के एक ही नंबर का नमूना प्रति पढ़ता है प्रत्येक नमूना के amplicons की मात्रा में गठबंधन करने के लिए equimolar है। प्रायर प्रवर्धन के लिए न्यूक्लिक एसिड सांद्रता तुलना कर रहे हैं, बस प्रत्येक SA के बराबर मात्रा जोड़नेmple के amplicons पर्याप्त पुस्तकालय पूल बनाते समय है। हालांकि, अगर न्यूक्लिक एसिड सांद्रता बेहद अलग और बराबर मात्रा में जोड़ रहे हैं, कम न्यूक्लिक एसिड एकाग्रता के साथ नमूना खराब कम संख्या के साथ पढ़ता प्रतिनिधित्व किया जाएगा। इस मामले में, यह जेल बैंड के रिश्तेदार तीव्रता के आधार पर कम एकाग्रता नमूना से amplicons के एक उच्च मात्रा जोड़ने के लिए संभव है। वैकल्पिक रूप से, यह अधिक कड़ाई से, अलग-अलग amplicons से प्राइमरों दूर करने के लिए एक fluorometric dsDNA मात्रा का ठहराव किट का उपयोग कर व्यक्ति नमूना है amplicon एकाग्रता यों, और ठीक गठबंधन प्रत्येक नमूने की equimolar मात्रा संभव है।

एक बार एक अच्छी तरह से संतुलित amplicon पूल उत्पन्न होता है, इसे ध्यान से पूल की एकाग्रता को मापने के लिए महत्वपूर्ण हो जाता है। इसके बाद सावधान कमजोर पड़ने और कील में PhiX के साथ बढ़ाने के लिए पढ़ें जटिलता इष्टतम अनुक्रमण परिणाम प्राप्त करने के लिए महत्वपूर्ण है। उच्च throughput sequencers कि sequen का उपयोगसंश्लेषण द्वारा cing प्रवाह सेल पर क्लस्टर घनत्व बहुत संवेदनशील होते हैं। वह भी ध्यान केंद्रित किया गया है कम गुणवत्ता स्कोर, कम डेटा उत्पादन, और गलत demultiplexing 32 से overclustering में परिणाम है, एक पुस्तकालय पूल लदान। है कि बहुत पतला भी कम डेटा उत्पादन का परिणाम देगा एक पुस्तकालय पूल लोड हो रहा है। ध्यान से पुस्तकालय पूल बढ़ाता अनुक्रमण करने से पहले इष्टतम परिणाम सुनिश्चित करेगा।

-16 RRNA जीन अनुक्रमण किसी नमूने के भीतर मौजूद बैक्टीरिया की एक व्यापक मूल्यांकन प्रदान करता है और परिकल्पना की पीढ़ी में एक बिल्कुल महत्वपूर्ण पहला कदम है। मेटाडाटा आगे के एक अमीर सेट की उपस्थिति शोधकर्ता विशेष प्रजातियों के जीवाणु और महत्वपूर्ण जैविक कारकों के बीच संघों परीक्षण करने के लिए सक्षम बनाता है। इसके अलावा, एक ही -16 जानकारी जैसे PICRUSt 33 के रूप में उपकरण का उपयोग कर के साथ बैक्टीरियल कार्यों अनुमान किया जा सकता है। अंतिम लक्ष्य -16 लक्षण वर्णन का उपयोग करने के उपन्यास संघों है कि हो सकता है की पहचान हैआगे का परीक्षण और मॉडल प्रणाली में मान्य, मानव स्वास्थ्य और रोग पर बैक्टीरियल Microbiome के प्रभाव के बारे में हमारी बढ़ती समझ को जोड़ने।

Acknowledgements

हम प्रोटोकॉल पर गंभीर प्रतिक्रिया के लिए एलिजाबेथ बर्न, डेविड Gootenberg, और क्रिस्टीना Gosmann का शुक्रिया अदा करना चाहते हैं; मेगन Baldridge, स्कॉट Handley, सिंडी मोनाको, और जेसन नॉर्मन नमूना तैयार करने के लिए मार्गदर्शन और प्रदर्शनों के लिए; वेन्डी गैरेट, कर्टिस Huttenhower, छोड़ें वर्जिन, और ब्रूस वाकर प्रोटोकॉल सलाह और उपयोगी विचार विमर्श के लिए; और अनुक्रमण समर्थन के लिए जेसिका Hoisington-लोपेज। इस काम के बिल और मेलिंडा गेट्स फाउंडेशन और NIAID (1R01AI111918) द्वारा समर्थित किया गया। DSK बरोज़ वेलकम कोष से अतिरिक्त सहायता प्राप्त किया। MNA NIGMS से पुरस्कार नंबर T32GM007753, और पॉल और डेजी सोरोस फैलोशिप द्वारा समर्थित किया गया। सामग्री केवल लेखकों की जिम्मेदारी है और जरूरी NIGMS या एनआईएच की आधिकारिक विचारों का प्रतिनिधित्व नहीं करता है।

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics