Bakteriyel Topluluk Karakterizasyonu Verimli Nükleik Asit Ekstraksiyonu ve 16S rRNA gen Sıralama

Biology
 

Summary

Biz 16S rRNA gen sıralama amplikon kullanarak bakteri topluluklarının karakterizasyonu için sürüntü nükleik asidin çıkarmak için etkili, sağlam ve uygun maliyetli bir yöntem açıklanmaktadır. yöntem birden fazla örnek türleri için ortak bir işleme yaklaşımı sağlar ve alt analitik süreçlerin bir dizi barındırmaktadır.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

insan sağlığı ve hastalığın kritik modülatörleri olarak mikrobiyal toplulukların rolü için büyüyen bir takdir var. Yüksek sekanslama teknolojileri çeşitli kaynaklardan gelen 16S rRNA gen sıralaması kullanılarak bakteriyel toplulukların hızlı ve etkili bir karakterizasyon için izin. 16S rRNA dizi analizi için hazır araçlar standart hesaplama iş akışlarını olmasına rağmen, DNA ekstraksiyonu için örnek işleme çalışmalar arasında değişkenlik sürekli kaynağı olmaya devam etmektedir. Burada bezlerden gelen nükleik asidi çıkarmak için etkili, sağlam ve uygun maliyetli bir yöntem açıklanmaktadır. Ayrıca dizi kütüphanelerin oluşturulmasına veri kalite kontrolü ve dizi analizi de dahil olmak üzere 16S rRNA gen dizileme için alt yöntemleri, önceden tespit edilmelidir. iş akışı dışkı ve anatomik yerleri ve ev sahibi türlerde toplanan bezlerden dahil olmak üzere çoklu numuneler türlerini barındırabilir. Buna ek olarak, DNA, RNA ayrılıp kullanılabilirtüm genom sekanslama ya da RNA-SEQ dahil olmak üzere diğer uygulamalar için. tarif edilen yöntem çoklu numune tipi için ortak bir işleme yaklaşımı sağlar ve genomik metagenomic ve transkripsiyonel bilgilerin alt analiz barındırmaktadır.

Introduction

Insan alt üreme yolu, sindirim sistemi, solunum yolu, deri doku homeostazını sürdürmek ve ev sahibi 1 sağlığını desteklemek için kritik olan karmaşık bakteri toplulukları tarafından kolonize olan. Örneğin, bazı laktobasil, vajinal tonoz asitleştirici antimikrobiyal etkileyiciler üreten ve yerel ana bağışıklığı 2-4 modüle patojenler için bir daralan bir ortam yaratmak. Bakteri mikrobiyomları önemi artan takdir de birçok klinik bağlamda bakteriyel topluluklar karakterize olan ilgiyi artırmıştır. Burada genital sürüntü bakteriyel mikrobiyomları kompozisyonu belirlemek için bir yöntem açıklanmaktadır. protokol kolayca diğer anatomik yerleri ve diğer ev sahibi türlerinden toplanan dışkı örneklerinin ve bezlerden için modifiye edilebilir.

Nedeniyle, belirli bir saplamadan toplandı ve saklanabilir numunelerin sayısının kalıtsal kısıtlamalaraY katılan, bu protokol uyarlanmış fenol-kloroform göre kordon-dövme yöntemi 5,6 kullanarak tek bir çubukla potansiyel DNA, RNA, ve hatta proteini elde etmek için tasarlanmıştır. deterjanlarla Boncuk dayak ve kimyasal bozulma ile bakteriyel hücre duvarlarının fiziksel parçalama kombinasyonu ek enzimatik sindirim adımları olmadan Gram-pozitif, Gram-negatif ve aside-dayanıklı bakteri hızlı lizis sağlar. Yüksek kaliteli RNA elde etmek için, ya da 4 ° altında tutuldu kuru bezlerden kullanılması tavsiye edilir C'yi toplandıktan hemen sonra ve -80 ° C'de laboratuvar (varsa) ulaşım ve depolanmış uzun dönem boyunca.

Belirli bir numune içinde bakteri mikrobiyomları belirlemek için, bu prosedür şu anda kapsamlı bakteriyel sınıflandırmasını atamak ve göreli ölçümünü gerçekleştirmek için en uygun maliyetli yoludur 16S rRNA gen sıralama Amplikon kullanmaktadır. Alternatif yöntemler qPCR 7 hedeflenen içerir, özel microarrays 8 ve tam genom sekanslama 9. 16S rRNA gen dokuz hiperdeğişken bölgeleri içeren ve vajinal mikrobiyomları çalışmaları için sıralamak için en uygun V bölgesini ilişkin görüş birliği yoktur. Burada Caporaso ark. 10-12 tarafından tasarlanan boru hattı üzerinde 515F / 806R primer seti kullanmak ve oluşturmak. Caporaso ve ark. 'S 515F / 806R primer seti nedeniyle Illumina sıralama platformları ile doğrulanmış barkodlu astar ve uyumluluk binlerce kullanılabilirliği tek bir sıralama kaçak örneklerinin yüzlerce çoğullama sağlar. İnsan mikrobiyomu Projesi 27F / 338R astar 13 set aksine, 515F / 806R da etkili Bifidobacteriaceae güçlendirir ve böylece doğru Gardnerella vaginalis, bazı kadınlarda vajinal mikrobiyal topluluğun önemli bir üyesi yakalar. Seçenek olarak ise, bir 338F / 806R primer çifti başarılı vajinal örnekleri 14 ve 515F / 926R primer çifti Rece sahip bir piro kullanılmaktadırntly nesil dizileme 12 için kullanılabilir hale gelir.

Son olarak, bu protokol Mikrobiyal Ekoloji (QIIME) yazılım paketi 15 içine Kantitatif Trendleri'ni kullanarak 16s amplikon analizi gerçekleştirmek için temel yönergeler sağlar. Burada anlatılan QIIME komutları başarılı bir şekilde uygulanması, her numune için bakteri taksonomik zengindi içeren bir tablo verir. QIIME web sitesinde ayrıntılı olarak açıklandığı gibi birçok başka kalite kontrol adımları, taksonomik sınıflandırma yöntemleri ve analiz adımları, analize dahil edilebilir (http://qiime.org/index.html). Analiz Apple bilgisayar üzerinde yapılacak olursa, MacQIIME paketi 16 QIIME ve bağımlılıklarından kolay montaj sağlar. 16S rRNA gen sekans analizi için alternatif yazılım paketleri Mothur 17 ve UPARSE 18 içerir.

Protocol

Çalışma protokolü tarafından onaylanmış ve KwaZulu-Natal Üniversitesi Biyomedikal Araştırma Etik Komitesi (Durban, Güney Afrika) ve Massachusetts General Hospital Kurumsal Değerlendirme Kurulu (2012P001812 / MGH; Boston, MA) yönergeleri takip etti.

Servikovaginal Swablar Toplamı Nükleik Asit 1. Ekstraksiyon

Not: 16 numune veya daha az setlerinde nükleik asit ekstraksiyon gerçekleştirin. Aşağıda yazılı olarak protokol (örneğin katılımcının kimlik numarası, yaş gibi meta verileri ekstraksiyon birden mermi performans, seri çıkarma toplu numara ve her numunenin çıkarma parti numarası yanı sıra diğer örnek bilgileri kayıt yaparsanız numuneler 12. setler halinde işlenir varsayar Tablo 1'de çubukla koleksiyonu, hormonal kontraseptif tipi, cinsel yolla bulaşan enfeksiyon testi sonuçlarına, vb) tarih / zaman.

  1. reaktifler ve davlumbaz hazırlanması
    1. (1: 25: 24), pH 7.9, iki faz, 1 mL fenol Tris alkalin tampon 65 ul ekleyerek 2 dakika karışım çalkalanarak ve izin vererek: kloroform: izoamil alkol (IAA) fenol pH ayarlama doğal ya da oda sıcaklığında 5 dakika boyunca 10,000 x g'de santrifüj ile bölüştürüldü.
      Dikkat: Solunduğunda, yutulduğunda ya da cilde ve göze temas ederse Fenol zehirlidir. Dumanı içinize çekmeyin. koruyucu eldiven, yan siperleri olan güvenlik gözlükleri ve bir laboratuvar ceket giyin.
    2. -Filtre sterilize 0.22 um filtre içinden% 20 sodyum dodesil sülfat (SDS), 25 ml. sterilize SDS 5 ml alikotları yapın.
    3. -20 ° C'de izopropanol 10 ml'lik bir şişe Chill.
    4. Her s için bir boncuk dayak tüp hazırlayınwab kordon mikser için uygun olan bir 2 ml'lik steril bir tüpe cam boncuklar 0.3 g tartılması tarafından işlenecek.
    5. Steril bir emici bez ile ektoservikste örnekleyerek bezlerden elde edin. Toplandıktan hemen sonra, laboratuara nakil esnasında 1 saat ila 4, 4 ° C'de boş ve steril cryovial, deposuna çubukla yerleştirin ve -80 ° C'de birkaç ay depolanabilir. (Bireysel borular içinde yer alan) bezlerden transfer ıslak buz işlenecek.
    6. biyolojik güvenlik kabini (BSC) hazırlayın. Bir "yüksük" uçucu kimyasalların doğru kaldırılmasını sağlamak için bina egzoz bağlı olan bir BSC kullanın.
      1. kaput tüm malzemelerini çıkarın.
      2. yüzeylerden RNases, DNases ve DNA kaldıran bir temizleyici ardından çamaşır suyu ile kaput, tüm yüzeylerini temizleyin. Temiz sonraki tüm öğeleri eldivenler dahil bir nükleik asit temizleyici, ardından çamaşır suyu kullanarak kaputun içine getirdi. p gibi taze RNaz / DNaz ücretsiz reaktifler kullanınipette ipuçları, mümkünse.
      3. kaput arka steril bir kimyasal biyolojik tehlike çanta bantlayın. fenol veya kloroform içeren tüm kuru atıklar uygun bertaraf bu torbaya konulmalıdır.
      4. fenol veya kloroform içeren sıvı atıkları toplamak için kaputun içine steril bir şişe yerleştirin.
  2. Fenol-kloroform ekstraksiyonu.
    1. kaput, her bir tane, dayak tüp, tampon 500 ul,% 20 sodyum dodesil sülfat 210 ul ve fenol 500 ul (aşama 1.1.1): kloroform: IAA (25: 24: 1, pH 7.9 ).
    2. Steril forseps yeni bir çift kullanarak boncuk atan tüpe taşıma flakonundan çubukla aktarın. Iyice en az 30 saniye boyunca boncuk atan tüpün iç duvarlarına karşı sürüntü kafasını ovmak. Yeniden kap örneği yapılır. Birden bezlerden gelen çekimi gerçekleştirerek, her numune arasında eldiven değiştirmek.
    3. En az 10 dakika boyunca buz üzerinde örnek Chill. Bezi çıkarınTemiz bir P200 ucunu kullanarak iç tüp duvara çubukla kafasına basarken steril cımbız ile sürüntü kolunu tutarak tüp yenerek boncuk. Kuru kimyasal atık torbasına bezlerden atın. Not: "silecek" eylem (sürüntü kafasını basarak) emici bez sıvının kurtarmak ve nükleik asit kurtarma artacaktır.
    4. Boncuk çırpıcı boncuk atan tüp yerleştirilir ve 4 ° C'de 2 dakika boyunca homojenize edilmiştir.
    5. Santrifüj 6,000 xg'de 3 dakika 4 ° C kordon dayak borusu yıkıntıları pelet haline ve sulu fenol fazlar ayrıldı.
    6. steril bir 1.5 ml'lik tübe - (600 ul ~ 500) sulu faz transfer. kloroform: fenol eşit miktarda ekleme IAA. inversiyon ve kısa vorteks ile karıştırın.
    7. 16.000 x g'de 5 dakika 4 ° C'de tüp santrifüjleyin.
    8. yeni bir steril 1.5 ml'lik tübe sulu faz transfer. muhafazakar ve interfaz tabakası ya da altta yatan fenol materyal transfer değilfaz. transfer sulu fazın hacmi unutmayın. Gelecekteki protein izolasyonu için fenol aşamasını kaydedin.
    9. izopropanol, 0.8 hacim 3M sodyum asetat (pH 5.5) içinde 0.1 hacim. inversiyon ve kısaca vorteks ile iyice karıştırın.
    10. (O / N'ye kadar) en azından 2 saat boyunca -20 ° C'de tüp soğutma nükleik asit tortusunun.
  3. İzopropanol yağış ve etanol yıkama
    1. yaklaşık 16,000 x g'de ve 4 ° C'de 30 dakika süre ile boru santrifüjleyin. Dikkatle bozulmamış pelet bırakarak süpernatant kaldırmak için bir pipet kullanın.
    2. % 100 etanol 500 ul ekle. pelet dokunmadan nazik bir vorteks veya pipetleme ile pelet çıkarmak. 16.000 x g'de 5 dakika 4 ° C'de santrifüj.
    3. Dikkatle etanol süpernatant atın. Pelet rahatsız etmeden, mümkün olduğu kadar etanolü çıkarmak için P10 pipeti kullanarak.
    4. Hava, 15 dakika boyunca oda sıcaklığında pelet kurutulur.
    5. U 20 ul pelletinilökotrien antagonistlerinin saf 0.1x Tris-EDTA tamponu. tam tabanda sağlamak için numune tekrar tekrar 10 dakika ve pipet buz üzerinde soğuk izin verin. Pelet çözünmez ise, çözülmeye yardımcı olmak için, 10 dakika kadar bir 40 ° C sıcaklıkta bir blok tüp aktarın.
    6. Bir spektrofotometre 19 kullanılarak nükleik asit konsantrasyonu ölçmek.
    7. İstenirse, üreticinin protokolüne 20 aşağıdaki bir sütun temizlik kitini kullanarak RNA ayrı DNA.
    8. -80 ° C nükleik asidin saklayın veya devam edin.

16S rRNA gen V4 hiperdeğişken Bölgesi'nin 2. PCR Amplifikasyon

Not: kirlenme ve insan hatası riskini en aza indirmek için 12 numune veya daha az setler halinde PCR gerçekleştirin. Amplifikasyon birden mermi gerçekleştirmek ise, seri amplifikasyon toplu numara ve Tablo 1'de her numunenin amplifikasyon parti numarası kaydedin.

  1. Preparat Oreaktifler ve PCR kaput f
    1. Dizi analizi aşamasında eşleme dosyası temel teşkil edecektir Tablo 1 PCR amplifikasyon set bilgileri ekleyin.
    2. PCR kaput tüm malzemeleri çıkarın ve RNases, DNases ve DNA kaldıran bir temizleyici ardından çamaşır suyu ile iyice iç yüzeylerini temizlemek. Kaputun koymadan önce her reaktifi ve teçhizatın (örneğin, pipetler) parçası arındırmak emin olun. önce kaputu çalışan bir nükleik asit temizleyici ile temizlenmelidir taze eldiven giyin.
    3. Gerekirse, 50, nükleik asit şablonunun seyreltik - 100 ng / DNA içermeyen ve nükleaz içermeyen su kullanılarak ul.
    4. Temiz PCR kaputun içindeki 5x yüksek sadakat (HF) tampon, dNTP, ve primer Çözülme alikotları. Yavaşça girdap ve çözdürme sonrası tüm çözümler santrifüj. 5x HF tamponu, dNTP, ve astar hacimde hazırlamak, donma-çözülme döngüleri ve stok kontaminasyon riskini en aza indirmek için.
    5. bir yerdemikrosantrifüj tüpler ve kaputun içine bir PCR plaka soğutucu temiz tezgah üzeri soğutucu raf.
  2. PCR reaksiyonu için ultra saf su 15,5 ul 5x HF tamponu 5 ul, dNTP 0.5 ul, 515F ileri primer, 0.5 ul,% 3 DMSO 0.75 ul ve polimeraz 0.25 ul birleştirilerek ana karışımı hazırlanması her reaksiyon. soğutucu tüm reaksiyon bileşenleri bir araya ve son polimeraz ekleyin. Pipetleme ile iyice karıştırın. pipetleme hatası hesaba, ana karışımı hazırlarken reaksiyon sayısı iki ekstra örnekleri ekleyin.
  3. PCR reaksiyonu kurulumu:
    Not: Her numune üç ayrı 25 ul reaksiyonlarda yükseltilir, yani üç nüsha olarak yapılan genişletme gerçekleştirin. Her primer çifti ile no-şablon su kontrolü çalıştırın. Herhangi bir kontaminasyon giriş kaçınarak, hızlı ama dikkatli bir şekilde çalışın.
    1. PCR soğutucu içine bireysel kapaklar ve yeri ile bir 8-iyi şerit etiketleyin.
    2. İlk olarak ana karışımı Pipet 90 uliyi.
    3. Ters primer (İlave Dosyası 1) 2 ul ekleyin. Dikkatle Tablo 1'de her bir örnek ile birlikte kullanıldığında ters primer barkod not ettiğinizden emin olun.
    4. İyice karıştırın ve dördüncü kuyu (no-şablon kontrolü) ana karışımı 23 ul aktarın.
    5. Dördüncü kuyuya su 2 ul ekleyin.
    6. İlk kuyuya uygun numune 6 ul ekleyin. İyice karıştırın ve ikinci kuyunun 25 ul aktarın. Değişim ipuçları ve iyi üçüncü ilk kuyudan başka bir 25 ul aktarın. Sıkıca emin süreçte kuyuların içini veya kapağı dokunmamaya dikkat ederek, her yanı kap.
    7. her numune için tekrarlayın.
  4. PCR büyütmesi gerçekleştirmek
    1. bir PCR için şerit tüpleri aktarın ve aşağıdaki programı çalıştırmak: 57 ° C 'de, 98 ° C'de 30 saniye, 98 ° C'de 30 saniye, 10 saniye 30 döngü, ardından bir ardından 72 ° C'de 12 sn, 10 dakika 72 ° C ve nihai tutma a at tutunT, 4 ° C.
    2. Temiz bir laboratuar tezgah üzerinde aşağıdaki adımları uygulayın. Hızla duvarlardan sıvıyı toplamak için tüpler dönerler. steril etiketli tüpe 75 ul toplam hacimde her bir numuneden, üçlü PCR reaksiyonları birleştirin. Ayrıca ayrı bir steril tüp içine, her hedef içermeyen kontrol 25 ul transfer. Henüz farklı örneklerden amplikonları kombine etmeyin.
  5. jel elektroforezi ile örneklerin başarılı bir PCR amplifikasyonu doğrulanması.
    1. Her bir amplikon, su kontrolü ve merdiven 21 tutmak için yeterli kuyucuklu (1x tamponu TAE, 100 ml 1.5 g agarozun toz), bir% 1.5 agaroz jel hazırlayın.
    2. Jel sertleşir (yaklaşık 30 dakika) birlikte, elektroforez için numune hazırlanması: Yeni etiketli tüpe 6x yükleme boyası 1 ul ekle. bu tüp, amplikonun 5 ul ve pipetleme karıştırın.
    3. Jel belirledi zaman, tarak kaldırmak jel elektroforez haznesine yerleştirin ve 1x TAE tamponu ile deposunu doldurun. İlk kuyuya DNA merdiveninin 5 ul ekleyin.
    4. Yük de başka örnek amplikonunu 5 ul. Yük ayrı kuyucuklarına hedef içermeyen amplikon 5 ul. Her numune için gerektiği şekilde devam ediniz.
    5. Tüm örnekler yüklenmiş edildiğinde, yerinde depo kapağını kaydırın ve 120 güç kaynağı açmak V. jel 30 çalışmasına izin ver - 60 dakika.
    6. UV ışığı altında jel görüntüleyin.
      1. 380 bp etrafında tek bir güçlü bant belirterek her numunenin başarılı amplifikasyon doğrulayın. Bir çift bant varsa, farklı bir ters barkod (Adım 2.3) ile örnek yeniden yükseltmek. hiç grup varsa, aynı ters barkod veya yeni bir ters barkod (Adım 2.3) kullanılarak örnek yeniden yükseltmek. yeniden yükseltme başarısız olursa, PCR inhibitörleri, PCR inhibitörleri kaldırmak için bir kolon bazlı DNA temizleme işlemi, bu durumda numune içinde mevcut olabilir.
        Not: Başarılı amplifikasyon mümkün olmayabilir eğer bakteriyel DNA konsantrasyonu veyaiginal Örnek yetersiz (<5 ng / | il) 'dir.
      2. no-şablon kontrolünde bir bant yokluğu belirterek reaktif kirlenmenin olmaması doğrulayın.
    7. -20 ° C'de amplikon kalan 70 ul saklayın. Bir grup verim vermedi varsayarak, no-şablon kontrolü kalan 20 ul atın.

3. Kütüphane havuzu ve Yüksek Verimli Sıralama

  1. Tek bir steril tüp içine, her amplikon - (5 ul 2) eşit hacmi birleştirerek amplikon havuzu oluşturmak. Bir örnekten grup özellikle zayıf görünüyorsa, numunelerin geri kalan iki kez hacmini ekleyin.
  2. Imalatçının talimatlarına 22 uyarınca bir PCR temizlik seti kullanılarak amplikon havuzundan PCR primerleri çıkarın. Amplikon havuz hacmi 100 ul üzerinde ise birden çok sütun temiz-up gerçekleştirin. Not: Her bir sütun 100 ul kapasitesine sahiptir.
    1. -20 & # De kütüphane Mağaza176 C veya bir sonraki adıma geçin.
  3. Varsa, son kitaplığı oluşturmak için astar gerektirmeyen amplikon havuzları birleştirir. Bir spektrofotometre florometrik bir sistem 23 kullanılarak kütüphanenin DNA konsantrasyonunun belirlenmesi. 1.8 arasında 260/280 oranı - 2.0 olarak saf DNA göstergesidir.
  4. 20 nM kütüphane sulandırmak. Bir elektroforez cihazı kullanılarak 400 bp etrafında tek bir bant görselleştirerek kütüphanenin kalitesini onaylayın. Florometrik sistemi 23 kullanarak kütüphane konsantrasyonunu kontrol edin.
  5. 2 nM için kütüphane seyreltmek için su içinde son bir 1:10 seyreltme gerçekleştirin. Ardından, süresiz 20 ° C'de kütüphane saklayın.
  6. üç gerekli sıralama primerleri ile son kütüphanede bir kısım Gönder (1 Oku 2 okuyun ve İndeks; Malzemeleri / Ekipman Tabloları bakınız) Illumina dizici üzerinde sıralandı edilecek. az 300 numune sıralama için çoğullanır varsa, o bir tek uç 300 bp çalıştırmak kullanmak ve 12 bp indeksi ile okumak5 pM nihai kütüphane konsantrasyon ve% 10 denatüre phix diken-in ile na MiSeq. Ayrıntılı sıralama talimatları için Caporaso ark. ISME J 2012 10 ek malzeme bakın.

4. Sekans Analizi

Not: Burada özetlenen QIIME 1.8.0 yazılım paketi kullanarak dizi analizi için temel bir boru hattıdır. Kolaylık olması açısından, verilen komutlar 12 bp dizin dosyası index.fastq denir ve 300 bp sıralama dosya sequences.fastq denir okundu, eşleme dosyası mapping.txt denir varsayalım. QIIME veya MacQIIME 16 yükleyin ve bu komutları yürütmek için UNIX temelleri ile tanıyın. En QIIME tam kılavuzunu okuyun:

  1. Deneyin (Tablo 1) eşleme dosyası tamamlayın. mümkün olduğunca meta içerir. Toplu etkileri olup olmadığını belirlemek için, numuneler çıkarılan veya aynı parti içinde güçlendirilmiş edildiği unutmayın.
  2. örneğin, mapping.txt olarak eşleme dosyası olarak kaydedin. validate_mapping_file.py -m mapping.txt -o mapping_output: aşağıdaki komutu çalıştırarak eşleme dosyası biçimlendirme doğrulamak
    Not: Bu komut varsa, eşleme dosyası hatalarını gösteren bir .html dosyasını içeren, "mapping_output" adlı yeni bir klasör yapar yerleşik "validate_mapping_file.py" QIIME komut dosyası kullanır.
  3. Böyle FastQC olarak program kontrolü yüksek verimli bir dizi veri kalitesini kullanarak okur (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Şekil 5 baz dizisi başına kalitesini gösteren sıralama kalitesini kontrol edin Bunun iyi bir çalışma beklenebilir.
    Not: sequencer taban yanlışlıkla anılmış olasılığına karşılık her nükleotid baz, bir Phred kalite puanı, atar. 10 Bir Phred kalite puanı, nükleotid atamak yanlış olmuştur% 10 şans olduğunu gösterired, 20 30% 0.1 şans gösterir% 1'lik bir şans gösterir ve 40 (en yüksek skor) 0,01 şansı% 24 olduğunu gösterir.
  4. Split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq: kalite dizi verileri filtrelemek ve 25 Bu komutu yürüterek ( "sl_out" olarak adlandırılan bu durumda,) bir klasöre sonuçları kaydetmek, Demultiplex bir anahtar olarak eşleme dosyasını kullanarak -o sl_out / b index.fastq -m mapping.txt -q 29
    Not: q bayrağı, örneğin maksimum kabul edilemez Phred kalite puanı gösterir, "29 -q" baz aramaların% 99.9 doğruluk sağlanması, 30'un altında Phred puanları ile herhangi bir dizileri filtreler.
  5. Greengenes 16S operasyonel taksonomik birim (OTU) referans veritabanı 26 (http://qiime.org/home_static/dataFiles.html) kullanarak, bu komutu 27 yürüterek açık referans OTU toplama gerçekleştirin: pick_open_reference_otus.py -i sl_out / seqs. fna -r 97_otus.fasta -o ucrss / -s 0.1
    Not: -s bayrak gösterirDe novo kümelenme dahil edilecek referans veritabanına hizalamak için başarısız dizilerin kesir. De novo kümelenme başarısız dizilerin% 10 içeren "0,1 -s". OTU toplama işlemini parallelize ve çoklu çekirdek mevcut olup olmadığını saate gün işlem süresini azaltmak için -a bayrağını kullanın.
  6. Summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / L 7: 28 Bu komutu yürüterek tür düzeyinde Otus birleştirerek kullanıcı dostu bir taksonomik bolluk tablo oluşturun
    Not: Elde edilen tablo kolayca herhangi bir elektronik tablo yazılımı görülebilir. 16S rRNA dizi güvenilir tür düzeyinde çözünürlüğü sağlamaz unutmayın.
  7. QIIME komut alpha_diversity.py birkaç alfa çeşitliliği ölçümlerini hesaplayarak her bir numune içindeki ekolojik çeşitliliği belirleyin. Daha sonra, QIIME komut beta_diversity.py kullanarak numune çiftleri arasında çeşitlilik belirler.
  8. Visİmparator 29 prensibi kullanarak, örneğin verileri ualize arsa veya ısı haritası koordine eder.
  9. QIIME adlı compare_catagories.py komut 30 olan, örneğin haritalama dosya kategorisi, resmi istatistiksel karşılaştırmalar gerçekleştirin.

Representative Results

16S rRNA gen sıralama kullanarak bir çubukla göreceli bakteriyel bolluğu tespitine imkan protokolü genel bakış, 1 hayranlarıyla protokolü insan vajinal bezlerden optimize edilmiştir Şekilde gösterilmiştir, ancak kolayca en mukozal örnekleme siteleri için adapte edilebilir ve diğer ana. Şekil 2, boncuk-dövme protokolü kullanılarak izole edilebilir yüksek kaliteli DNA ve RNA gösterir. 3 örnek, her yükseltme doğru tek bir güçlü bant vermiştir 12 numune üzerinde başarılı bir PCR göstermektedir Şekil büyüklüğü ve bir grup verim vermedi her su kontrolü. Şekil 4 önceki sıralama nihai kütüphane havuzu miktarının göstermektedir. 5 tek uç 300 bp MiSeq çalıştırdıktan sonra tipik bir dizi kalite profilini göstermektedir.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
Şekil 1. Protokol şematik genel bir bakış. İlk olarak, nükleik asit, izoamil alkol, fenol, kloroform, ihtiva eden bir tampon çözelti içinde, boncuk yenerek çubukla elde edilir. 16S rRNA geninin değişken bölgesi 4, sonra PCR kullanılarak elde edilen bir nükleik asit ile amplifiye edilir. Örneklerin yüzlerce kadar PCR amplikonları daha sonra bir araya getirilmiş ve tek bir kaçak dizilir. Elde edilen diziler göreceli bakteri bollukları belirlemek için bir referans veri tabanına uyumludur. Tüm protokol, yaklaşık üç gün içinde yapılabilir. Bu rakamın büyük halini görmek için buraya tıklayınız.

şekil 2
Şekil 2. Yüksek kalitede Nükleik Asit Çıkarılan Fenol kullanma: Kloroform Boncuk M Dayakbu yöntemde. (A), bir DNA kalitesi, bir spektrofotometre kullanılarak değerlendirilen. 1.8 ve 2.0 arasında bir A260 / A280 oranı fenol ya da protein ile kontamine değil saf nükleik asidi gösterir. (B) sütun temiz-up sonra, bu protokol yüksek kaliteli RNA verebilmesidir, güçlü 16S ve 23S rRNA zirveleri ile gösterilir. numune alındıktan sonra (taşıma ve depolama esnasında) soğuk muhafaza değilse (C) RNA bozulması oluşabilir veya RNases işleme sırasında varsa. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
515F ve Barkodlu 806R Astar Seti Kullanımı Başarılı 16S rRNA gen Amplification Şekil 3. Onay. Üst) Jel elektroforezi 380 baz çifti etrafında tek bir bant varlığını doğrulamak için kullanılan in şablonla büyütülmüştür her örnek. bir grup olmaması başarısız amplifikasyon belirtir; Bu insan hatası ve tekrarlanan gerektiğini numuneden PCR reaksiyonu için genellikle. Alt) Hayır şablon (su) kontrol bant hediyem var olmamalıdır aynı primer çifti ile paralel çalışacak. Su kontrolünde bir grubun varlığı kontamine reaktifler belirtir; kirlenmiş olabilir ve reaktifler atmak yeniden yapmak primer çifti için şablon ve su kontrolü hem de PCR büyütmeleri. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4. Niceleme Final Kütüphane Havuz Konsantrasyon ve Doğrulama Kütüphanesi Boyutu. Bireysel örnek amplıkonları birleştirildikten sonra, inciNihai kütüphane havuzu E konsantrasyonu tespit edilmelidir. Kütüphane havuzu daha sonra 2 nM konsantrasyonu elde etmek için seyreltilmiş olması gerekir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 5,
Şekil 5. Temsilcisi Bar oku Her Pozisyonunda Dizi Kalite Puanlarını Arsa. Sekans kalite 200 baz çifti sonra düşmesi normaldir, ancak ortalama kalite skoru 30. üzerinde kalmalıdır büyük halini görmek için tıklayınız bu rakamın.

#SampleID Barkod
LinkerPrimer
Sıra
rcbcPrimer SampleType çıkarma
yığın
Amplifikasyon
plaka
tanım
http://qiime.org/_static/Examples/File_: #An örnek haritalama dosyası bulunabilir
biçimleri /
Example_
Mapping_
dosya.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 boyun
bez
1 bir

Tablo 1. Haritalama Dosya Şablon. Creating doğru ve eksiksiz haritalama dosyası başarıyla protokolü yürütmek için kritik öneme sahiptir. Eşleme dosyası sadece QIIME yürütülmesi için gerekli olan, ama aynı zamanda herhangi bir sistematik önyargıları verileri (örneğin, partiden partiye varyasyon) analiz etmek için, örnek barkod ve meta arasındaki bağlantıyı sağlamak ve belirlemek için araştırmacı sağlar değil meta veri ve bakteriyel popülasyonlar arasında ilginç bir ilişki. Bir çıplak kemikleri eşleme dosyası sağlanır, ancak kullanıcılar mümkün olduğunca meta verileri içeren birçok sütunlar eklemek için teşvik edilir. vajinal sürüntü için ek meta veri örnekleri çubukla koleksiyonu, hormonal kontraseptif tipi (varsa), cinsel yolla bulaşan enfeksiyon testi sonuçları, vb katılımcının yaşı, tarih / saati içerir

suppliment 1
Barkodlu Ters Primer Dizilerin 10 Company Dosya 1. Liste Bu dosyayı indirmek için tıklayınız.

Discussion

Burada bir insan vajinal sürüntü içinde tanımlanması ve nispi bakteri bolluğu karakterizasyonu için bir protokol açıklar. Bu protokol, kolayca diğer Örnekte, dışkı gibi türleri, ve diğer vücut bölgelerindeki bezlerden, ve bir kaynak çeşitli toplanan numuneler için uyarlanabilir. fenol ve kloroform tamponlanmış bir çözelti içinde, boncuk dayak nükleik asit çıkarma, klinik çalışmalardan elde edilen değerli örnekleri çalışırken özellikle önemli olan, her iki DNA ve RNA izolasyonu için izin verir. RNA eşzamanlı toplama RNA seq ile fonksiyonel bakteri üremesini, ev sahibi ve viral katkıları belirlemek için fırsat sağlar iken izole bakteri DNA bakteri taksonomik tanımlama ve genomik montaj için mükemmeldir. Açıklanan protokol başarıyla insan, köpek de dahil olmak üzere örnek türleri, geniş bir yelpazede dağıtıldıktan valide tek adımlı primer seti ve çevre örnekleri 10 kullanır

Bu protokolün bir nükleik asit çıkarma bölümü fenol ve kloroform ile çalışırken gerekli güvenlik önlemleri ve yüksek verimli, 96 gözlü plaka formatında için boru hattı otomatik zorlukları ile sınırlıdır. Ayrıca, dinç boncuk atan yaklaşık 6 kilobaz parçaları mekanik parçalama makasları bakteriyel DNA kullanılır; uzun DNA fragmanları downstream uygulamalar, boncuk atan s süresince gerekiyorsahould kısaltılabilir. Bu protokolün bakteri tanımlama bölümünün sınırlamaları 16S rRNA gen dizilimi dayanan herhangi bir yönteme doğasında vardır. 16S rRNA dizi cins ve hatta tür düzeyinde bakteri tanımlama için idealdir, ama nadiren gerilme düzeyi kimlik sağlar. 16S rRNA geninin V4 değişken bölge en bakteri türlerinin 11 arasında sağlam bir ayrım sağlarken, örneğin Oligotyping 31 gibi ek hesaplama yöntemleri tam olarak Lactobacillus crispatus, belirli türlere tanımlamak için kullanılabilir gerekebilir. Bu protokol, bu amaca yönelik kullanılan tüm genom DNA ve RNA'nın ekstraksiyonu sağlar ancak son olarak, özel bir numune içinde hassas bakteriyel fonksiyonel özellikleri ile ilgili bilgi, tek başına 16S rRNA dizilemesi ile tespit edilemez.

Bu protokol ile başarılı olması için en önemli adım bulaşma dur önlemek için büyük özen alıyoring numune alma, nükleik asit ekstraksiyonu ve PCR amplifikasyonu. temiz eldiven giyen ve steril bezlerden, tüpler ve makas kullanılarak numune toplama sırasında kısırlık sağlamak. toplama malzemelerinin kirlenme değerlendirmek için, örnekleme zamanında ulaştırma tüpleri içine direkt olarak ek kullanılmayan bezlerden koyarak negatif kontrol bezlerden toplamak. Laboratuvarda, sadece dekontamine malzemeleri içeren ve sadece moleküler notu, DNA içermeyen reaktifler kullanılarak steril kaputun içindeki tüm ön amplifikasyon adımları uygulayın. nükleik asit ekstraksiyon sırasında, kullanılan sürece kapalı tüm tüpler her bir örnek ile yeni steril forseps ve taze eldiven kullanarak ve tutarak çapraz bulaşmayı önlemek. paralel olarak kullanılmayan bezlerden işlenmesi numune toplama ve nükleik asit ekstraksiyon hem steril sağlar; Kullanılmayan bezlerden izopropanol yağış ve etanol yıkandıktan sonra bir pelet verim olmamalıdır. Bir topak görünmüyor ise, olası bir kaynağını belirlemek için 16S rRNA gen amplifikasyonu gerçekleştirmekkirlenme (örneğin, Streptococcus veya Staphylococcus varlığı cilt kirlenmesini işaret eder). Ayrıca, PCR reaktifler ve reaksiyonları kontamine olmadığından emin olmak için paralel hiçbir şablon kontrol reaksiyonları ile PCR büyütmeleri gerçekleştirin. Bir grup bir hayır şablon denetiminde görünüyorsa, reaktifler atmak ve taze reaktifler ile amplifikasyon tekrarlayın. Bu önlemler alarak ilgi bakteri başarılı sıralama sağlayacaktır.

PCR adımı en giderme gerektiren eğilimindedir. on iki numune setleri kuvvetlendirme verimlilik ve tutarlılık arasında bir denge sağlar. Belirli bir amplifikasyon kümesindeki tüm örneklerin genelinde bantların tam olmaması, örneğin bir reaktif eklemek için unutulması veya yanlış PCR programlama, sistematik bir başarısızlık olduğunu gösterir. Birkaç örneklerden bir bant yokluğu insan hatası genellikle nedeniyle ve amplifikasyonu yeniden r olmalıdırörnek ve ters astar aynı eşleştirme ile un. Bir bandın sürekli olmaması halinde, numune bir farklı barkod olan bir ters primer kullanılarak yeniden amplifiye edilebilir. Birden ters primerler ile tekrar yükseltme hataları numunede bulunan bir inhibitör gösterebilir. Bu durumda, bir kolon ile DNA temizlenmesi genellikle anlamlı bir şekilde bakteriyel zengindi değiştirmeden inhibitörleri kaldırır. Birden bantlar amplifikasyon sonra neden, farklı bir ters primer barkod ile örnek yeniden yükseltmek.

kütüphane havuzu hazırlarken çevre kirlenmesini önlemek ve tek özel ürünün çoğaltımı sağlamanın yanı sıra, başarılı dizi bakım dayanır. hedefi, yaklaşık sıralama aynı sayıda örnek başına okuma sağlamak için her numunenin amplikonların eşmolar miktarlarda birleştirilmesidir. önce amplifikasyon nükleik asit konsantrasyonları karşılaştırılabilir, sadece her sa eşit hacimlerde ekleyerekkütüphane havuzu oluştururken mple en amplikonlar yeterlidir. nükleik asit konsantrasyonları çok farklı ve eşit hacimde ilave Ancak, eğer düşük nükleik asit konsantrasyonu ile örnek kötü okur düşük sayı ile temsil edilecek. Bu durumda, jel bandın nispi yoğunluğu dayalı düşük yoğunluklu numunelerin amplıkonları daha yüksek bir ses eklemek mümkündür. Alternatif olarak, daha titiz bir şekilde her bir numunenin eşit molar miktarlarda bireysel amplikonların primerler kaldırma florometrik dsDNA miktar kiti kullanılarak tek tek numune amplikon konsantrasyonunu ölçmek ve tam olarak birleştirmek mümkündür.

iyi dengelenmiş bir amplikon havuz oluşturulur sonra, dikkatli bir şekilde havuzun konsantrasyonunu ölçmek için kritik hale gelir. Phix ile müteakip dikkatli seyreltme ve başak-in okuma karmaşıklığı optimum sıralama sonuçları elde etmek için önemlidir artırmak için. sequen kullanımı yüksek verimli sıralayıcılarsentez yoluyla dans ediyorum akış hücresi küme yoğunluğu çok duyarlıdır. Çok düşük kalite puanları düşük veri çıkışı ve yanlış demultiplexing 32 ile, overclustering neden olur konsantre bir kütüphane havuzu yükleniyor. Çok da düşük veri çıkışı neden olur sulandırmak bir kütüphane havuzu yükleniyor. Dikkatle önce sıralama kütüphane havuzu miktarının optimum sonuçlar sağlayacaktır.

16S rRNA gen sıralama belirli bir örnek içinde mevcut olan bakterilerin kapsamlı bir değerlendirme sağlar ve hipotez nesil bir kesinlikle kritik bir ilk adımdır. ayrıca meta veri zengin bir dizi varlığı, özellikle bakteri türlerinin ve önemli biyolojik faktörler arasındaki ilişkileri test etmek için araştırmacı sağlar. Ayrıca, aynı 16S bilgiler, PICRUSt 33 gibi araçlar ile kullanılarak bakteriyel işlevleri belirlemek için de kullanılabilir. Nihai hedef yeni dernekler olabilir tanımlamak için 16S karakterizasyonu kullanmaktırayrıca test edilmiş ve insan sağlığı ve hastalıkları bakteri mikrobiyomları etkisi giderek büyüyen bir anlayış ekleyerek, model sistemler valide.

Acknowledgements

Biz protokole kritik geribildirim Elizabeth Byrne, David Gootenberg ve Christina Gosmann teşekkür etmek istiyorum; örnek hazırlama rehberlik ve gösteriler için Megan Baldridge Scott Handley, Cindy Monako, ve Jason Norman; protokol tavsiye ve verimli tartışmalar için Wendy Garrett, Curtis Huttenhower, Atla Bakire ve Bruce Walker; ve dizi destek Jessica Hoisington-Lopez. Bu çalışma Bill ve Melinda Gates Vakfı ve NIAID (1R01AI111918) tarafından desteklenmiştir. DSK Burroughs Wellcome Fonu ek destek aldı. MNA ödül sayısı NIGMS gelen T32GM007753 ve Paul ve Daisy Soros Bursu ile desteklenmiştir. Içeriği sadece yazarların sorumluluğundadır ve mutlaka NIGMS veya NIH resmi görüşlerini temsil etmemektedir.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics