Effektiv Nucleic Acid Extraction och 16S rRNA gensekvenser för bakteriell Community karakterisering

1Ragon Institute of MGH, MIT, and Harvard, Massachusetts General Hospital
Biology
 

Summary

Vi beskriver ett effektivt, robust och kostnadseffektiv metod för att extrahera nukleinsyra från bomullstoppar för karakterisering av bakteriesamhällen med hjälp av 16S rRNA-genen amplikon sekvensering. Metoden gör det möjligt för en gemensam strategi för flera provtyper bearbetning och rymmer ett antal efterföljande analytiska processer.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Det finns ett växande intresse för rollen av mikrobiella samhällen som kritiska modulatorer av människors hälsa och sjukdom. Hög kapacitet sekvenseringsteknologier har gjort det möjligt för en snabb och effektiv karakterisering av bakteriesamhällen med hjälp av 16S rRNA gensekvenser från en rad olika källor. Även lättillgängliga verktyg för 16S rRNA-sekvensanalys har standardiserade beräkningsarbetsflöden, urval bearbetning för DNA-extraktion förblir en fortsatt källa till variationen mellan studierna. Här beskriver vi en effektiv, robust och kostnadseffektiv metod för att extrahera nukleinsyra från bomullstoppar. Vi avgränsa också metoder nedströms för 16S rRNA gensekvenser, inklusive generering av sekvense bibliotek, kvalitetskontroll, och sekvensanalys. Arbetsflödet kan rymma flera prover slag, inklusive avföring och bomullstoppar som samlats in från en mängd olika anatomiska platser och värdarter. Dessutom utvanns DNA och RNA kan separeras och användasför andra tillämpningar, inklusive hela genom sekvensering eller RNA-punkter. Den beskrivna metoden gör det möjligt för en gemensam strategi för flera provtyper bearbetning och rymmer nedströms analys av genomiskt, metagenomic och transkriptions information.

Introduction

Den mänskliga lägre reproduktionsorganen, mag-tarmsystemet, andningsorgan och hud koloniseras av komplexa bakteriesamhällen som är kritiska för att upprätthålla vävnadshomeostas och stödja hälsan hos värd en. Till exempel, vissa laktobaciller skapa en ogästvänlig miljö för patogener genom surgöring av vaginalvalvet, som producerar antimikrobiella effektenheter och modulera lokala värden immunitet 2-4. Ett växande intresse för den bakteriella microbiome betydelse har också ökat intresset för att karakterisera bakteriesamhällen i många kliniska sammanhang. Här beskriver vi en metod för att bestämma sammansättningen av den bakteriella microbiome från genitala sekretprov. Protokollet kan lätt modifieras för avföringsprov och bomullstoppar som samlats in från andra anatomiska platser och andra värdarter.

På grund av de inneboende begränsningar i antalet prover som kan samlas in och lagras av en given tappy deltagare, var detta protokoll för att extrahera DNA, RNA, och potentiellt ännu protein från en enda pinnprovet med en anpassad fenol-kloroform baserad bead-stryk-metoden 5,6. Kombinationen av fysiska avbrott i bakteriecellväggar med pärla-stryk och kemiska störningar med tvättmedel möjliggör snabb lys av grampositiva, gramnegativa, och syrafasta bakterier utan ytterligare enzymatisk spjälkning steg. För att få hög kvalitet RNA, är det rekommenderat att använda torra kompresser som hölls vid eller under 4 ° C omedelbart efter provtagningen och under transporten till laboratoriet (i förekommande fall), och lagras långsiktigt vid -80 ° C.

För att bestämma den bakteriella microbiome inom ett givet prov, utnyttjar denna procedur 16S rRNA-genen amplikon sekvensering, som är för närvarande den mest kostnadseffektiva sättet att på ett heltäckande tilldela bakteriell taxonomi och utföra relativ kvantifiering. Alternativa metoder innefattar riktade qPCR 7, anpassad microarrays 8, och hel-genomet sekvense 9. 16S rRNA-genen innehåller nio hypervariabla regioner, och det finns ingen enighet om den optimala V-regionen för att sekvensera för vaginala microbiome studier. Här använder vi 515F / 806R primer set och bygga på rörledningen designad av Caporaso et al. 10-12. Caporaso et al. 'S 515F / 806R primer uppsättning möjliggör multiplexering av hundratals prover på en enda sekvenseringskörning beror på tillgången av tusentals validerade streckkodade primers och kompatibilitet med Illumina sekvense plattformar. Till skillnad från Human Microbiome Projects 27F / 338R primer set 13, 515F / 806R också effektivt förstärker Bifidobacteriaceae och därmed exakt fångar Gardnerella vaginalis, en viktig medlem av den vaginala mikrobiella i vissa kvinnor. Alternativt har en 338F / 806R primerpar framgångsrikt använts för Pyrosequencing av vaginala prover 14 och en 515F / 926R primerparet har recently blir tillgängliga för nästa generations sekvensering 12.

Slutligen ger detta protokoll grundläggande instruktioner för att utföra 16S amplikon analys med hjälp av kvantitativa Insikter i Microbial Ecology (QIIME) programpaketet 15. Ett framgångsrikt genomförande av QIIME kommandon som beskrivs här ger en tabell som innehåller bakterie taxonomiska förekomster för varje prov. Många ytterligare kvalitetskontrollsteg, taxonomiska klassificeringsmetoder och analyssteg kan införlivas i analysen som beskrivs i detalj på QIIME webbplats (http://qiime.org/index.html). Om analysen kommer att utföras på en Apple-dator, den MacQIIME paketet 16 ger enkel installation av QIIME och dess beroenden. Alternativa mjukvarupaket för 16S rRNA-genen sekvensanalys inkluderar Mothur 17 och UPARSE 18.

Protocol

Studieprotokollet godkändes av och följt riktlinjerna i Biomedical Research etiska kommittén vid University of KwaZulu-Natal (Durban, Sydafrika) och Massachusetts General Hospital Institutional Review Board (2012P001812 / MGH, Boston, MA).

1. Utvinning av Total nukleinsyra från livmoderhals och svabbar

Obs: Utför nukleinsyra extraktioner i uppsättningar av 16 prover eller färre. Protokollet som skrivet nedan förutsätter prover behandlas i uppsättningar av 12. Om du utför flera omgångar extraktioner serie numrera utvinning partier och registrera varje prov utsugs batchnummer samt andra prov information (inkludera metadata som deltagarens ID-nummer, ålder , datum / tid för pinnen samling, hormonella preventivmedel typ, sexuellt överförbara infektioner testresultat, etc.) i tabell 1.

  1. Framställning av reagens och dragskåp
    1. Justera pH för den fenol: kloroform: isoamylalkohol (IAA) (25: 24: 1) till pH 7,9 genom tillsats av 65 | il Tris alkalisk buffert per 1 ml fenol, skakning av blandningen under 2 min, och låta de två faserna till separat antingen naturligt eller genom centrifugering vid 10.000 xg under 5 min vid RT.
      Varning: Fenol är giftigt vid förtäring, vid inandning, eller i kontakt med hud och ögon. Undvik inandning av rök. Bär ogenomträngliga handskar, skyddsglasögon med sidoskydd och en laboratorierock.
    2. Filtrera-sterilisera 25 ml av 20% natriumdodecylsulfat (SDS) genom ett 0,22 pm filter. Gör 5 ml alikvoter av de steriliserade SDS.
    3. Kyla en 10 ml alikvot av isopropanol vid -20 ° C.
    4. Förbered en pärla slå rör för varje sWAB som skall bearbetas genom att väga upp 0,3 g glaspärlor i en steril 2 ml rör som är lämplig för vulsten beater.
    5. Skaffa svabbar genom provtagning livmodertappen med en steril absorberande svabb. Omedelbart efter insamling placerar pinnen i en tom och steril cryovial, förvara vid 4 ° C under 1 till 4 h under transporten till labbet, och lagra i flera månader vid -80 ° C. Överför kloak (som ingår i enskilda rör) som skall bearbetas till våt is.
    6. Förbered biologisk säkerhet skåp (BSC). Använd en BSC med en "fingerborg" ansluten till byggnaden avgas att säkerställa korrekt avlägsnande av flyktiga kemikalier.
      1. Ta bort allt material från huven.
      2. Rengör alla ytor på huven med blekmedel, följt av en saneringsmedel som tar bort RNaser, DNaser, och DNA från ytor. Rena alla följande objekt som förs in i köksfläkten med blekmedel, följt av en nukleinsyra saneringsmedel, inklusive handskar. Använda färska RNas / DNas-fria reagens, såsom pipette tips, när det är möjligt.
      3. Tejpa en steriliserad kemisk biologiskt påse på baksidan av huven. Allt torrt avfall som innehåller fenol eller kloroform bör placeras i denna påse för korrekt avfallshantering.
      4. Placera en steril flaska i huven för att samla flytande avfall innehållande fenol eller kloroform.
  2. Fenol-kloroform-extraktion.
    1. I huven, till varje pärla slå rör, tillsätt 500 | il buffert (från steg 1.1.1), 210 | il 20% natriumdodecylsulfat, och 500 | il fenol: kloroform: IAA (25: 24: 1, pH 7,9 ).
    2. Överföra provpinnen från flaskan transport in vulsten beating röret med användning av ett nytt par av steril pincett. Grundligt gnida pinnen huvudet mot de inre väggarna hos vulsten beating röret under minst 30 sek. Re-cap provet när du är klar. Om du utför extraktioner från flera kompresser, byta handskar mellan varje prov.
    3. Kyla provet på is i minst 10 min. Ta bort pinnen frånpärla slå rör genom att hålla pinnen handtaget med sterila pincett samtidigt som du trycker pinnen huvudet mot den inre rörväggen med en ren P200 spets. Kassera kompresser i torrt kemiskt avfall väska. Obs! "Skrapan" åtgärd (trycker pinnen huvudet) kommer att frigöra vätska från den absorberande stuss och öka nukleinsyra återhämtning.
    4. Placera vulsten beating röret in i vulsten beater och homogenisera under 2 minuter vid 4 ° C.
    5. Centrifugera vulsten beating rör under 3 min vid 6000 xg och 4 ° C för att pelletera debris och separera de vattenhaltiga och fenolfaserna.
    6. Överför vattenfasen (~ 500-600 l) till en steril 1,5 ml rör. Tillsätt en lika stor volym av fenol: kloroform: IAA. Blanda genom inversion och kort vortex.
    7. Centrifugera röret under 5 minuter vid 16.000 xg och 4 ° C.
    8. Överför vattenfasen till ett nytt sterilt 1,5 ml rör. Var försiktig och inte överföra material från interskiktet eller den underliggande fenolfas. Anteckna volymen av den överförda vattenfasen. Spara fenolfasen för framtida proteinisolering.
    9. Lägg 0,8 volym isopropanol och 0,1 volym av 3 M natriumacetat (pH 5,5). Blanda noggrant genom inversion och kort virvling.
    10. Utfälla nukleinsyran genom kylning av röret vid -20 ° C under minst 2 h (upp till O / N).
  3. Isopropanol utfällning och etanoltvätt
    1. Centrifugera röret i 30 min vid cirka 16000 xg och 4 ° C. använder noga en pipett för att ta bort supernatanten, lämnar pellets intakt.
    2. Tillsätt 500 pl av 100% etanol. Rubba pelleten med försiktig vortex eller pipettering utan att röra pelleten. Centrifugera i 5 minuter vid 16.000 xg och 4 ° C.
    3. Noggrant kassera etanolvätskan. Använd en P10 pipett för att ta bort så mycket etanol som möjligt utan att störa pelleten.
    4. Lufttorka pelleten vid RT under 15 min.
    5. Resuspendera pelleten i 20 pl uLTRA-ren 0,1 x Tris-EDTA-buffert. Låt provet att kyla på is under 10 min och pipetten flera gånger för att säkerställa fullständig återsuspension. Om pelleten inte upplöses, överföra röret till en 40 ° C värmeblock under upp till 10 min för att underlätta upplösning.
    6. Mäta nukleinsyran koncentration med användning av en spektrofotometer 19.
    7. Om så önskas, separat DNA från RNA med användning av en kolonn sanering kit, enligt tillverkarens protokoll 20.
    8. Lagra nukleinsyran vid -80 ° C eller fortsätta.

2. PCR-amplifiering av 16S rRNA Gene V4 hypervariabel region

Obs: Utför PCR-amplifiering i satser om 12 prover eller färre för att minimera risken för kontaminering och mänskliga fel. Om du utför flera omgångar av förstärkning, seriellt nummer förstärknings partier och registrera varje provs förstärkning batchnummer i tabell 1.

  1. Framställning of reagens och PCR huva
    1. Lägg PCR förstärkning inställd information till tabell 1, som kommer att ligga till grund för kartläggningen filen vid sekvensanalys scenen.
    2. Ta bort allt material från en PCR huva och rengör de inre ytorna noggrant med blekmedel, följt av en sanerings som tar bort RNaser, DNaser och DNA. Var noga med att sanera varje reagens och utrustning (t.ex. pipetter) innan du placerar dem i huven. Bär färska handskar rengörs med en nukleinsyra sanerings innan arbeta i huven.
    3. Om så är nödvändigt, späd nukleinsyramallen till 50-100 ng / ul med hjälp av DNA-fria och nukleasfritt vatten.
    4. Tina alikvoter av 5x high-fidelity (HF) buffert, dNTP och primers i ren PCR huva. Vortexa försiktigt och centrifugera alla lösningar efter upptining. För att minimera frysnings-upptiningscykler och risken för lager kontamination, förbereda alikvoter av 5x HF buffert, dNTP: er, och primrar.
    5. Placera enren bänk svalare rack för mikrocentrifugrör och en PCR-plattkylare i huven.
  2. För PCR-reaktion, förbereda Master Mix genom att kombinera 15,5 | il av ultra-rent vatten, 5 pl av 5x HF-buffert, 0,5 pl av dNTP, 0,5 | il av 515F framåtriktad primer, 0,75 | il 3% DMSO, och 0,25 pl av polymeras för varje reaktion. Montera alla reaktionskomponenter i kylaren och tillsätt polymeras sist. Blanda noggrant genom pipettering. Lägg till två extra prover till reaktions räkna vid beredning av Master Mix, att redogöra för pipettering fel.
  3. PCR-reaktion inställning:
    Obs: Utför förstärkningar i tre exemplar, vilket innebär att varje prov förstärks i tre separata 25 il reaktioner. Kör en no-mall vatten kontroll med varje primerpar. Arbeta snabbt men försiktigt, undvika införandet av eventuella föroreningar.
    1. Märk en åtta brunnar remsa med individuella lock och plats i en PCR-kylare.
    2. Pipettera 90 pl masterblandning i den förstaväl.
    3. Tillsätt 2 | j, l av den omvända primern (Supplemental fil 1). Var noga med att notera den omvända primern streckkod som används med varje prov i tabell 1.
    4. Blanda väl och överför 23 | il huvudblandning till fjärde brunn (no-mall kontroll).
    5. Tillsätt 2 pl av vatten till den fjärde brunn.
    6. Tillsätt 6 | il av lämpligt prov till den första brunnen. Blanda väl och överför 25 ^ till den andra brunnen. Ändra tips och överföra ytterligare 25 ^ från den första brunnen till den tredje också. Fast locket varje brunn, se till att inte röra vid insidan av brunnarna eller mössa i processen.
    7. Upprepa för varje prov.
  4. Utföra PCR-amplifiering
    1. Överföra remsan rören till en termocykler och kör följande program: 30 sek vid 98 ° C, följt av 30 cykler av 10 sek vid 98 ° C, 30 sekunder vid 57 ° C, och 12 sek vid 72 ° C, följt av en 10 min håll vid 72 ° C och slut hålla ent 4 ° C.
    2. Utför följande steg på en ren laboratoriebänk. Snabbt snurra rören för att samla vätska från väggarna. Kombinera trefaldiga PCR-reaktioner från varje prov, med en total volym på 75 ul, i en steril märkt rör. överför också 25 | il av varje icke-mall kontroll i en separat sterilt rör. Blanda inte amplikoner från olika prover ännu.
  5. Validering av framgångsrik PCR-amplifiering av proverna genom gelelektrofores.
    1. Bered en 1,5% agarosgel (1,5 g agaros pulver i 100 ml 1x TAE buffert) med tillräckligt brunnar för att hålla varje amplikon, vatten kontroll, och stege 21.
    2. Medan gelén hårdnar (ca 30 min), förbereda provet för elektrofores: Tillsätt 1 pl av 6x laddningsfärg i ett annat, märkt rör. Till detta rör, tillsätt 5 ul av amplikon och blanda genom pipettering.
    3. När gelén har satt, ta bort kammar, placera gelén i elektroforestanken och fylla tanken med 1x TAE buffert. Till den första brunnen, tillsätt 5 pl av DNA-stege.
    4. Belastning 5 pl av provet amplikon till en annan också. Belastning 5 pl av no-mall amplikon till en separat brunn. Fortsätt som behövs för varje prov.
    5. När alla prover har laddats skjuter tanklocket på plats och slå på strömkällan till 120 V. Låt gelen köra för 30-60 min.
    6. Visa gelen under UV-ljus.
      1. Kontrollera framgångsrik förstärkning av varje prov genom att notera en enda stark band runt 380 bp. Om det finns en dubbel band, åter förstärka provet med en annan omvänd streckkod (steg 2,3). Om det inte finns något band alls, re-amplifiera provet med användning av antingen samma omvända streckkod eller en ny omvänd streckkod (steg 2,3). Om re-förstärkning misslyckas kan PCR-inhibitorer vara närvarande i provet, i vilket fall, utför en kolumnbaserad DNA rensning för att avlägsna PCR-inhibitorer.
        Notera: Framgångsrik amplifiering kanske inte vara möjligt om det bakteriella DNA-koncentrationen i elleriginal prov är otillräcklig (<5 ng / | j, l).
      2. Verifiera brist på reagens förorening genom att notera frånvaron av ett band på no-templat-kontroll.
    7. Lagra de återstående 70 ^ il amplikon vid -20 ° C. Kasta de återstående 20 pl no-mall kontroll, under förutsättning att det inte gav ett band.

3. Bibliotek Pooling och hög genomströmning sekvensering

  1. Skapa amplicon poolen genom att kombinera en lika stor volym (2-5 l) av varje amplikon i ett enda sterilt rör. Om bandet från ett prov såg särskilt svag, tillsätt två gånger volymen i förhållande till resten av proverna.
  2. Avlägsna de PCR-primers från amplikon poolen med användning av en PCR Clean-up kit, enligt tillverkarens instruktioner 22. Utför saneringen med flera kolumner om amplicon poolvolymen är över 100 l. Obs: Varje kolumn har en 100 l kapacitet.
    1. Förvara biblioteket vid -20 & #176; C eller gå vidare till nästa steg.
  3. I förekommande fall, kombinera primer fria amplikon pooler för att skapa den slutliga biblioteket. Bestäm DNA-koncentration av biblioteket med en spektrofotometer eller en fluorometrisk systemet 23. En 260/280 förhållandet mellan 1,8-2,0 är ett tecken på rent DNA.
  4. Späd biblioteket till 20 nM. Bekräfta kvaliteten på biblioteket genom att visualisera ett enda band runt 400 bp med användning av en elektroforesinstrument. Bekräfta koncentrationen av bibliotek med användning av en fluorometrisk systemet 23.
  5. Utföra en slutlig 1:10 utspädning i vatten för att späda biblioteket till 2 nM. Sedan lagrar biblioteket vid 20 ° C på obestämd tid.
  6. Skicka en delmängd av den slutliga biblioteket med tre obligatoriska sekvenseringsprimrar (Läs 1 Läs 2, och index, se tabellerna i Material / utrustning) som skall sekvenseras på en Illumina sequencer. Om färre än 300 prover har multiplexeras för sekvensering, använda en enda slut 300 bp springa och med en 12 bp index läsa ona MiSeq, med en slutlig bibliotek koncentration av 5 pM och en 10% denaturerad PhiX spike-in. Se de kompletterande material Caporaso et al. ISME J 2012 10 för detaljerade sekvense instruktioner.

4. Sekvensanalys

Obs: Beskrivs här är en grundläggande pipeline för sekvensanalys med hjälp av QIIME 1.8.0 programpaketet. För enkelhetens skull, de som kommandon antar att mappningsfil kallas mapping.txt, index 12 bp läsa filen heter index.fastq och 300 bp sekvense läsa filen heter sequences.fastq. Installera QIIME eller MacQIIME 16 och bekanta dig med grunderna i UNIX för att utföra dessa kommandon. Läs hela guiden till QIIME på:

  1. Slutföra mappningsfil för experimentet (tabell 1). Inkludera så mycket metadata som möjligt. Notera vilka prover har tagits ut eller förstärks i samma parti, för att avgöra om det finns sats effekter.
  2. t.ex. mapping.txt. Bekräfta formateringen av kartläggningen filen genom att köra följande kommando: validate_mapping_file.py -m mapping.txt -o mapping_output
    Obs: Detta kommando använder den inbyggda "validate_mapping_file.py" QIIME skript som gör en ny mapp som heter "mapping_output", som innehåller en html-fil som anger mappningsfil fel de, om något.
  3. Kontrollera kvaliteten på sekvenser läser med hjälp av en hög genomströmning sekvensdatakvalitet kontrollprogrammet, såsom FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Figur 5 visar per bassekvensen kvalitet som kan förväntas från en lyckad körning.
    Obs! Sequencer delar varje nukleotidbas en Phred kvalitetsresultat, vilket motsvarar sannolikheten att basen har felaktigt kallas. En Phred kvalitetsresultat på 10 indikerar att det finns en 10% chans att nukleotid har varit felaktigt tilldelaed, 20 indikerar en chans 1%, 30 indikerar en chans 0,1%, och 40 (högsta möjliga poäng) indikerar en chans 0,01% 24.
  4. Använda mappningsfil som en nyckel, demultiplexera, kvalitet filtrera sekvenseringsdata, och spara resultatet till en mapp (i det här fallet, som kallas "sl_out") genom att köra detta kommando 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    Obs! Q flagga anger den maximala oacceptabelt Phred kvalitetsresultat, t.ex. "-q 29" filtrerar bort eventuella sekvenser med Phred poäng under 30, vilket garanterar 99,9% noggrannhet bas samtal.
  5. Använda Greengenes 16S operativa taxonomiska enhet (OTU) referensdatabasen 26 (http://qiime.org/home_static/dataFiles.html), utföra öppen referens OTU plocka genom att köra detta kommando 27: pick_open_reference_otus.py -i sl_out / seqs. fna -r 97_otus.fasta -o ucrss / -s 0,1
    Obs! -s Flaggan indikerarden fraktion av sekvenser som misslyckats att anpassa till referensdatabas som kommer att ingå i den de novo klustring. "-s 0.1" omfattar 10% av de misslyckade sekvenser i de novo klustring. Använd -a flaggan för att parallellisera OTU plockprocessen och minska handläggningstiden från dagar till timmar om flera kärnor finns.
  6. Skapa ett användarvänligt taxonomisk överflöd bord genom en sammanslagning Otus på artnivå genom att köra detta kommando 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / L 7
    Obs: Den resulterande tabellen kan lätt ses i något kalkylprogram. Notera att 16S rRNA-sekvensering inte på ett tillförlitligt ger artnivå upplösning.
  7. Bestäm den ekologiska mångfalden inom varje prov genom att beräkna flera alfa mångfald mätvärden med QIIME script alpha_diversity.py. Sedan bestämma mångfalden mellan par av prover med den QIIME script beta_diversity.py.
  8. visualize data, t.ex., genom användning av en kejsare 29 huvudkoordinater tomt eller heatmap.
  9. Utför formella statistiska jämförelser av kartläggning filkategorier, t.ex. med QIIME s compare_catagories.py manus 30.

Representative Results

Den allmänna översikt av protokollet, som möjliggör bestämningen av relativa bakterie förekomster från en tuss med hjälp av 16S rRNA gensekvenser, visas i figur 1 .Det protokoll har optimerats för mänskliga vaginala kompresser, men kan lätt anpassas till de flesta mucosal provtagningsplatser och andra värdar. Figur 2 visar den högkvalitativa DNA och RNA som kan isoleras med användning av vulsten-stryk-protokollet. Figur 3 illustrerar ett lyckat PCR-amplifiering av 12 sampel, där varje amplifiering med ett prov gav ett enda starkt band av korrekt storlek och varje vattenkontroll inte gav ett band. Figur 4 illustrerar kvantifieringen av det slutliga biblioteket poolen före sekvensering. Figur 5 visar en typisk sekvens kvalitetsprofil efter en enda utgång 300 bp MiSeq springa.

"Src =" / filer / ftp_upload / 53939 / 53939fig1.jpg "/>
Figur 1. Schematisk översikt av protokollet. För det första är nukleinsyra extraheras från en bomullstopp genom bead-stryk i en buffrad lösning innehållande fenol, kloroform och isoamylalkohol. Variabel region 4 i 16S rRNA-genen amplifieras sedan från den resulterande nukleinsyran med användning av PCR. PCR-amplikoner från upp till hundratals prover kombineras sedan och sekvenserades på en enda körning. De resulterande sekvenserna matchas till en referensdatabas för att bestämma relativa bakterie bestånd. Hela protokollet kan utföras i cirka tre dagar. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Hög kvalitet nukleinsyra extraherats med fenol: kloroform Bead Seger Metod. (A) DNA-kvalitet, som bedöms med hjälp av en spektrofotometer. En A260 / A280 förhållande mellan 1,8 och 2,0 indikerar ren nukleinsyra som inte är förorenad med fenol eller protein. (B) Efter en kolonn sanering, kan detta protokoll ge hög kvalitet RNA, som indikeras av starka 16S och 23S rRNA toppar. (C) RNA nedbrytning kan uppstå om provet inte förvaras kallt efter provtagning (under transport och lagring) eller om RNaser är närvarande under bearbetningen. klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. Bekräftelse av Framgångsrik 16S rRNA Gene Amplification Använda 515F och Barcoded 806R Primer Set. Topp) Gelelektrofores används för att bekräfta närvaron av ett enda band runt 380 baspar in varje prov som förstärktes med mall. Frånvaron av ett band indikerar misslyckad förstärkning; Detta beror vanligtvis på att den mänskliga faktorn och PCR-reaktionen från det provet bör upprepas. Botten) nr mall (vatten) kontroller körs parallellt med samma primerpar bör inte ha ett band närvarande. Närvaron av ett band i vattenkontrollen indikerar kontaminerade reagens; kassera reagens som kan vara kontaminerade och åter göra PCR-amplifieringar av både mallen och vatten kontroll för att primerparet. klicka god här för att se en större version av denna siffra.

figur 4
Figur 4. Kvantifiering av Final Library Pool Koncentration och validering av bibliotekets storlek. Efter sammanslagning de enskilda prov amplikoner, the koncentration av det slutliga biblioteket poolen måste bestämmas. Biblioteket pool måste sedan spädas ytterligare för att uppnå en 2 nM koncentration. Klicka här för att se en större version av denna siffra.

figur 5
Figur 5. Representativa Bar Plot av sekvensen kvalitetsresultat vid varje position i Läs. Det är normalt för sekvensen kvalitet att släppa efter 200 baspar, men den genomsnittliga kvaliteten poäng bör ligga över 30. Klicka här för att se en större version av denna siffra.

#SampleID Streckkod
LinkerPrimer
Sekvens
rcbcPrimer SampleType Extraktion
Sats
Förstärkning
Tallrik
Beskrivning
#An Exempel mappningsfil kan hittas på: http://qiime.org/_static/Examples/File_
format /
Exempel_
Mapping_
fil.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 Cervical
Svabb
1 en

Tabell 1. Kartläggning File mall. Creating en korrekt och noggrann kartläggning fil är avgörande för framgångsrikt genomföra protokollet. Kartläggningen filen inte bara krävs för att utföra QIIME, men det gör det också möjligt forskaren att upprätthålla kopplingen mellan prov streckkod och metadata, för att analysera data för några systematiska fel (t.ex. sats till sats variation), och för att bestämma intressanta korrelationer mellan metadata och bakteriepopulationer. En hake mappningsfil tillhandahålls, men användarna uppmanas att lägga till så många kolumner som innehåller metadata som möjligt. Exempel på ytterligare metadata för en vaginal bomullstopp innehåller deltagarens ålder, datum / tid för pinnen samling, hormonella preventivmedel typ (i förekommande fall), sexuellt överförbara infektioner testresultat, etc.

suppliment 1
Kompletterande fil 1. Förteckning över Streckkods Omvänd primersekvenser 10 Klicka här för att ladda ner filen.

Discussion

Här beskriver vi ett protokoll för identifiering och karakterisering av relativa bakterie förekomster inom en mänsklig vaginala pinn. Detta protokoll kan enkelt anpassas för andra provtyper, såsom avföring och svabbar av andra kroppsställen, och prover som tagits från en mängd olika källor. Extraktionen av nukleinsyra genom bead-stryk i en buffrad lösning av fenol och kloroform tillåter isolering av både DNA och RNA, vilket är särskilt viktigt när man arbetar med dyrbara prover som samlats genom kliniska studier. Det isolerade bakterie-DNA är utmärkt för bakteriell taxonomisk identifiering och genom montering, medan samtidig insamling av RNA ger möjlighet att bestämma funktionell bakteriell, värd och virala bidrag genom RNA-punkter. Den beskrivna protokollet använder en validerad ett steg primer uppsättning som har framgångsrikt använts på ett brett spektrum av provtyper, inklusive människa, hund, och miljöprover 10

Nukleinsyra utvinning del av detta protokoll begränsas av de säkerhetsåtgärder som krävs när man arbetar med fenol och kloroform, och de utmaningar som att automatisera rörledning till en hög genomströmning, 96-brunnar format. Dessutom kraftig pärla slå används för mekaniska lys sax i bakterie-DNA till cirka 6 kilo fragment; om längre DNA-fragment krävs för tillämpningar efter, hur länge pärla slå should förkortas. Begränsningarna i bakterieidentifieringsdelen av detta protokoll är inneboende någon metod som bygger på 16S rRNA-genen sekvensering. 16S rRNA-sekvensering är idealisk för bakterie identifiering släktet och även artnivå, men sällan ger identifikationsstamnivå. Medan V4 variabla regionen av 16S rRNA-genen ger en robust diskriminering bland de flesta bakteriearter 11, kan ytterligare beräkningsmetoder som Oligotyping 31 måste användas för att exakt identifiera vissa arter, såsom Lactobacillus crispatus. Slutligen kan information om de exakta bakteriella funktionella kompetens inom ett visst prov inte bestämmas av 16S rRNA gensekvenser ensam, men detta protokoll möjliggör extraktion av hela genomet DNA och RNA som kan användas mot detta ändamål.

Den mest kritiska steget för att säkerställa framgång med detta protokoll tar stor omsorg för att förhindra kontaminering during provtagning, nukleinsyra extraktion och PCR-förstärkning. Säkerställa sterilitet vid tidpunkten för provtagning genom att bära rena handskar och med sterila kompresser, rör och saxar. För att bedöma för förorening av uppsamlingsmaterial, samla negativa kontrollpinnar genom att placera ytterligare oanvända kompresser direkt i transportrören vid tidpunkten för provtagningen. I labbet, utföra alla pre-förstärkningssteg i en steriliserad huva som endast innehåller sanerade leveranser och använder endast molekylärbiologisk kvalitet, DNA-fria reagens. Under nukleinsyra utvinning, förhindra korskontaminering med hjälp av nya steril pincett och fräscha handskar med varje prov, och hålla alla rör stängda inte i bruk. Bearbetning oanvända kompresser parallellt säkerställer sterilitet både provtagning och nukleinsyra extraktion; de oanvända kompresser bör inte ge en pellet efter isopropanolutfällning och etanol tvätt. Om en pellet visas gör 16S rRNA genamplifiering att bestämma en möjlig källa tillföroreningen (t.ex. skulle närvaron av Streptococcus eller Staphylococcus indikera hudkontamination). Dessutom utför PCR-amplifieringar utan templat kontrollreaktioner parallellt för att säkerställa att PCR-reagens och reaktioner inte har förorenats. Om ett band visas i en kontroll utan templat, kassera reagensen och upprepa förstärkning med färska reagens. Tar dessa försiktighetsåtgärder kommer att säkerställa framgångsrik sekvensering av bakterier av intresse.

PCR-amplifieringssteg tenderar att kräva mest felsökning. Förstärkning i uppsättningar av tolv prover ger en balans mellan effektivitet och konsekvens. Den fullständiga frånvaron av band i alla prover i en given förstärkning uppsättning indikerar en systematisk underlåtenhet, t.ex. glömmer att lägga till ett reagens eller felaktigt programmering av termo. Frånvaron av ett band från några prover är oftast på grund av den mänskliga faktorn, och förstärkningar bör åter run med samma hopkoppling av prov och omvänd primer. I fallet med långvarig frånvaro av ett band, kan provet åter amplifieras med användning av en omvänd primer med en annan streckkod. Upprepade förstärknings misslyckanden med flera omvända primers kan tyda på en inhibitor närvarande i provet. I så fall kommer rengöring av DNA med en kolonn ofta avlägsna inhibitorer utan någon väsentlig ändring relativa bakteriella abundances. Om flera band resultera efter amplifiering, re-amplifiera provet med en annan omvänd primer streckkod.

Förutom att förebygga miljöförorening och säkerställa förstärkning av en enda specifik produkt, förlitar sig framgångsrik sekvensevård vid beredning av biblioteket poolen. Målet är att kombinera ekvimolära mängder av varje prov: s amplikoner för att säkerställa ungefär samma antal sekvensavläsningar per prov. Om nukleinsyran koncentrationer före amplifiering är jämförbara, att helt enkelt lägga lika stora volymer av varje sample s amplikoner är tillräcklig när du skapar bibliotekspoolen. Om emellertid de nukleinsyra-koncentrationerna är väldigt olika och sattes i lika stor volym, provet med den låga nukleinsyrakoncentrationen kommer att dåligt representerade med ett lågt antal läsningar. I detta fall är det möjligt att lägga till en högre volym av amplikoner från provet låg koncentration baserad på den relativa intensiteten av gelén bandet. Alternativt är det möjligt att mer noggrant avlägsna primers från de enskilda amplikoner, kvantifiera enskilda provets amplikon koncentration med hjälp av en fluorometrisk dsDNA kvantifiering kit, och exakt kombinera ekvimolära mängder av varje prov.

När en välbalanserad amplicon pool genereras, blir det viktigt att noggrant mäta poolen koncentration. Efterföljande försiktig utspädning och spike-in med PhiX att öka läs- komplexitet är avgörande för att uppnå optimal sekvense resultat. Hög genomströmning sequencers som använder sequencing genom syntes är mycket känsliga för klustret tätheten på flödescellen. Laddar ett bibliotek pool som är alltför koncentrerad kommer att resultera i overclustering, med lägre kvalitetsresultat, lägre datautgång och felaktig demultiplexering 32. Laddning av en bibliotekspool som är för utspädd kommer också att resultera i låg datautgång. Noggrant kvantifiera biblioteket poolen före sekvensering kommer att säkerställa optimala resultat.

16S rRNA gensekvenser ger en övergripande bedömning av de bakterier som finns i ett givet prov och är en absolut avgörande första steg i hypotes generation. Närvaron av en rik uppsättning av metadata ytterligare gör det möjligt för forskare att testa associationer mellan speciella bakteriearter och viktiga biologiska faktorer. Dessutom kan samma 16S informationen användas för att sluta sig till bakteriella funktioner med hjälp med verktyg som PICRUSt 33. Det slutliga målet är att använda 16S karakterisering att identifiera nya föreningar som kan varavidare testats och godkänts i modellsystem, lägga till vår växande förståelse av effekterna av den bakteriella microbiome på människors hälsa och sjukdom.

Acknowledgements

Vi vill tacka Elizabeth Byrne, David Gootenberg och Christina Gosmann för kritisk feedback på protokollet; Megan Baldridge, Scott Handley, Cindy Monaco, och Jason Norman för provberedning vägledning och demonstrationer; Wendy Garrett, Curtis Huttenhower, Skip Virgin, och Bruce Walker för protokoll råd och givande diskussioner; och Jessica Hoisington-Lopez för sekvense stöd. Detta arbete stöddes av Bill och Melinda Gates Foundation och NIAID (1R01AI111918). DSK fick ytterligare stöd från Burroughs Wellcome Fund. MNA stöddes av tilldelning nummer T32GM007753 från NIGMS, och Paul och Daisy Soros gemenskap. Innehållet är ensamt ansvarig för författare och inte nödvändigtvis representerar officiella ståndpunkter NIGMS eller NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics