Effektiv Nucleic Acid Udvinding og 16S rRNA Gene sekventering for bakteriel Community karakterisering

Biology
 

Summary

Vi beskriver en effektiv, robust og omkostningseffektiv metode til ekstraktion af nukleinsyre fra svaberprøver til karakterisering af bakterielle samfund ved hjælp 16S rRNA-genet amplicon sekventering. Metoden giver mulighed for en fælles behandling tilgang til flere prøvetyper og rummer en række downstream analytiske processer.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Der er en voksende forståelse for den rolle, mikrobielle samfund som kritiske modulatorer af menneskers sundhed og sygdom. High throughput sekventering teknologier har tilladt for en hurtig og effektiv karakterisering af bakterielle samfund ved hjælp 16S rRNA-genet sekventering fra en række forskellige kilder. Selv let tilgængelige værktøjer til 16S rRNA sekvensanalyse har standardiserede beregningsmæssige arbejdsgange, prøve behandling for DNA-ekstraktion er stadig en fortsat kilde til variation på tværs af studierne. Her beskriver vi en effektiv, robust og omkostningseffektiv metode til ekstraktion af nukleinsyre fra podninger. Vi afgrænse også downstream fremgangsmåder til 16S rRNA-genet sekventering, herunder generering af sekventering biblioteker, kvalitetskontrol, og sekvensanalyse. Arbejdsgangen kan rumme flere prøver typer, herunder afføring og podninger opsamlet fra en række forskellige anatomiske steder og vært arter. Derudover udvundne DNA og RNA kan adskilles og anvendestil andre anvendelser, herunder hele genomet sekventering eller RNA-seq. Den beskrevne fremgangsmåde giver mulighed for en fælles behandling tilgang til flere prøvetyper og plads nedstrøms analyse af genomisk, metagenomisk og transkriptionel information.

Introduction

Den menneskelige lavere reproduktive tarmkanalen, gastrointestinale system, luftveje og hud er koloniseret af komplekse bakterielle samfund, der er kritiske for opretholdelse vævshomeostase og støtte sundheden for værten en. For eksempel visse mælkesyrebakterier skabe et ugæstfrit miljø for patogener ved syrning af vaginal hvælving, der producerer antimikrobielle effektorer og modulerende lokale vært immunitet 2-4. Den voksende påskønnelse for den bakterielle microbiome betydning har også øget interesse i at karakterisere bakterielle samfund i mange kliniske sammenhænge. Her beskriver vi en metode til at bestemme sammensætningen af ​​den bakterielle microbiome fra genitalsvaberprøver. Protokollen kan let modificeres til afføringsprøver og podninger opsamlet fra andre anatomiske steder og andre værtsarter.

På grund af de iboende begrænsninger i antallet af prøver, der kan indsamles og lagres fra en given study deltager, var dette protokol designet til at udtrække DNA, RNA, og potentielt endnu protein fra en enkelt vatpind ved anvendelse af en tilpasset phenol-chloroform baseret perle-bankende metode 5,6. Kombinationen af ​​fysisk afbrydelse af bakterielle cellevægge med perle-slå og kemisk forstyrrelse med detergenter muliggør hurtig lyse af grampositive, gramnegative og syrefaste bakterier uden yderligere enzymatisk fordøjelse trin. For at opnå kvalitet RNA højt, anbefales det at bruge tørre vatpinde, der blev holdt ved eller under 4 ° C umiddelbart efter indsamlingen og under transporten til laboratoriet (hvis relevant), og lagret på lang sigt ved -80 ° C.

For at bestemme den bakterielle microbiome inden for en given prøve, denne procedure anvender 16S rRNA-genet amplicon sekventering, som i øjeblikket er den mest omkostningseffektive middel til omfattende tildele bakteriel taksonomi og udføre relative kvantificering. Alternative metoder omfatter målrettet qPCR 7, custom microarrays 8, og hel-genom sekventering 9. 16S rRNA-genet indeholder ni hypervariable regioner, og der er ikke enighed om den optimale V-regionen at sekventere for vaginal microbiome studier. Her bruger vi 515F / 806R primer sæt og bygge på rørledningen designet af Caporaso et al. 10-12. Caporaso et al. 'S 515F / 806R primer sæt muliggør multiplexing af hundredvis af prøver på en enkelt sekventering køre på grund af tilgængeligheden af tusindvis af validerede stregkodede primere og kompatibilitet med Illumina sekventering platforme. I modsætning til den menneskelige microbiome Projects 27F / 338R primer sæt 13, 515F / 806R også effektivt forstærker Bifidobacteriaceae og dermed præcist indfanger Gardnerella vaginalis, et vigtigt medlem af den vaginale mikrobielle samfund i nogle kvinder. Alternativt har en 338F / 806R primerpar succes blevet anvendt til pyrosekventering af vaginale prøver 14 og en 515F / 926R primerparret har recently bliver tilgængelige for næste generation sekventering 12.

Endelig er denne protokol giver grundlæggende instruktioner til at udføre 16S amplicon analyse ved hjælp af kvantitative Indblik i mikrobiel økologi (QIIME) softwarepakke 15. En vellykket gennemførelse af de QIIME kommandoer beskrevet her giver en tabel med bakterielle taksonomiske forekomster for hver prøve. Mange trin yderligere kvalitetskontrol, taksonomiske klassifikation metoder og trin analyse kan indarbejdes i analysen, som beskrevet i detaljer på QIIME hjemmeside (http://qiime.org/index.html). Hvis vil blive udført analysen på en Apple computer, MacQIIME pakken 16 giver nem installation af QIIME og dens afhængigheder. Alternative softwarepakker til 16S rRNA-genet sekvensanalyse omfatter Mothur 17 og UPARSE 18.

Protocol

Undersøgelsen protokol blev godkendt af og fulgte retningslinjerne i Biomedical Research etiske komité fra University of KwaZulu-Natal (Durban, Sydafrika) og Massachusetts General Board Hospital Institutional Review (2012P001812 / MGH, Boston, MA).

1. Udvinding af Total Nucleic Acid fra Cervicovaginal Vatpinde

Bemærk: Udfør nukleinsyre ekstraktioner i sæt af 16 prøver eller færre. Protokollen som skrevet nedenfor antager prøver behandles i sæt af 12. Hvis der udføres flere runder af ekstraktioner, serielt nummerere udvinding partier og registrere hver prøves udvinding batchnummer samt andre prøve oplysninger (omfatter metadata såsom deltagerens ID-nummer, alder , dato / tid for svaber indsamling, hormonel prævention type, seksuelt overførte infektioner testresultater, etc.) i tabel 1.

  1. Fremstilling af reagenser og stinkskabet
    1. Indstil pH af phenol: chloroform: isoamylalkohol (IAA) (25: 24: 1) til pH 7,9 ved tilsætning af 65 pi Tris alkalisk puffer hvert 1. ml phenol ryste blandingen i 2 minutter, og tillade de to faser til separat enten naturligt eller ved hjælp af centrifugering ved 10.000 x g i 5 minutter ved stuetemperatur.
      Advarsel: Phenol er giftigt ved indtagelse, ved indånding, eller i kontakt med hud og øjne. Undgå indånding af røg. Bær uigennemtrængelige handsker, sikkerhedsbriller med sideskærme og en kittel.
    2. Filter-sterilisere 25 ml 20% natriumdodecylsulfat (SDS) gennem et 0,22 um filter. Lav 5 ml portioner af de steriliserede SDS.
    3. Chill en 10 ml prøve af isopropanol ved -20 ° C.
    4. Forbered en perle bankende rør til hver swab skal forarbejdes ved at afveje 0,3 g glasperler i et sterilt 2 ml rør, der er egnet til perlen beater.
    5. Opnå podninger ved prøveudtagning ectocervix med en steril absorberende serviet. Umiddelbart efter indsamling, placere vatpinden i en tom og steril kryoglas, opbevares ved 4 ° C i 1 til 4 timer under transport til laboratoriet, og gemme i flere måneder ved -80 ° C. Overfør podninger (indeholdt i individuelle rør), der skal forarbejdes til våd is.
    6. Forbered den biologiske sikkerhed fryser (BSC). Brug en BSC med en "fingerbøl" forbundet til bygningen udstødning for at sikre korrekt fjernelse af flygtige kemikalier.
      1. Fjern alle materialer fra hætten.
      2. Rengør alle overflader på hætte med blegemiddel, efterfulgt af en dekontaminerende der fjerner RNaser, DNaser og DNA fra overflader. Rengør alle efterfølgende genstande bringes ind i hætten ved hjælp af blegemiddel efterfulgt af en nukleinsyre dekontaminerende, herunder handsker. Bruge friske RNase / DNase-fri reagenser, såsom pipette tips, når det er muligt.
      3. Tape en steriliseret kemisk biohazard pose til bagsiden af ​​hætten. Alle tørre affald, der indeholder fenol eller chloroform bør placeres i denne taske for korrekt bortskaffelse.
      4. Placer en steril flaske ind i hætten til at indsamle flydende affald indeholdende phenol eller chloroform.
  2. Phenol-chloroform-ekstraktion.
    1. I hætten, til hver perle bankende rør tilsættes 500 pi puffer (fra trin 1.1.1), 210 pi 20% natriumdodecylsulfat, og 500 pi phenol: chloroform: IAA (25: 24: 1, pH 7,9 ).
    2. Overfør podepinden fra transporten hætteglasset ind i perlen bankende rør under anvendelse et nyt par steril pincet. Grundigt gnide podepinden hoved mod de indvendige vægge af perlen bankende rør i mindst 30 sek. Re-cap prøven når du er færdig. Hvis der udføres ekstraktioner fra flere podninger, skifte handsker mellem hver prøve.
    3. Chill prøven på is i mindst 10 min. Fjern podepinden fraperle slå rør ved at holde vatpinden håndtag med sterile pincetter mens du trykker på vatpinden hovedet mod den interne rørvæg med en ren P200 tip. Kassér podninger i tørt kemisk affald taske. Bemærk: "sugefod" handling (trykke vatpinden hoved) vil befri væske fra absorberende vatpind og øge nukleinsyre opsving.
    4. Anbring bead beating røret i perlen beater og homogeniseres i 2 min ved 4 ° C.
    5. Centrifuger bead beating rør i 3 minutter ved 6.000 xg og 4 ° C for at pelletere snavs og adskille de vandige og phenol faser.
    6. Overfør den vandige fase (-500 - 600 pi) til et sterilt 1,5 ml rør. Tilsættes et lige så stort volumen phenol: chloroform: IAA. Bland ved at vende og kort vortexing.
    7. Centrifugeres i 5 minutter ved 16.000 xg og 4 ° C.
    8. Overfør den vandige fase til en ny steril 1,5 ml rør. Vær konservativ og ikke overføre materiale fra interfasen lag eller den underliggende phenolfase. Bemærk volumenet af den overførte vandige fase. Gem phenol fase for fremtidig protein isolation.
    9. Tilføj 0,8 volumen isopropanol og 0,1 rumfang 3 M natriumacetat (pH 5,5). Bland grundigt ved inversion og kortvarigt hvirvelbehandling.
    10. Udfælde nukleinsyre ved nedkøling røret ved -20 ° C i mindst 2 timer (op til O / N).
  3. Isopropanolfældning og ethanolvask
    1. Centrifugeres i 30 minutter ved ca. 16.000 x g og 4 ° C. Brug forsigtigt en pipette til at fjerne supernatanten, forlader pellet intakt.
    2. Tilføj 500 pi 100% ethanol. Løsne pelleten med forsigtig vortexbehandling eller pipettering uden at røre pelleten. Centrifuger i 5 minutter ved 16.000 xg og 4 ° C.
    3. kassere forsigtigt ethanol supernatanten. Brug en P10 pipette at fjerne så meget ethanol som muligt uden at forstyrre pelleten.
    4. Lufttørre pelleten ved stuetemperatur i 15 min.
    5. Pellet resuspenderes i 20 ul uLTRA-rent 0,1 x Tris-EDTA-buffer. Lad prøven nedkøling på is i 10 minutter og pipette flere gange for at sikre fuldstændig resuspension. Hvis pelleten ikke opløses, overfører røret til en 40 ° C varmeblok i op til 10 min for at hjælpe til opløsning.
    6. Mål nukleinsyrekoncentration anvendelse af et spektrofotometer 19.
    7. Om ønsket separat DNA fra RNA ved anvendelse af en søjle oprydning kit, efter fabrikantens protokol 20.
    8. Opbevar nukleinsyren ved -80 ° C eller fortsætte.

2. PCR-amplifikation af 16S rRNA-genet V4 hypervariable region

Bemærk: Udfør PCR-amplifikation i sæt af 12 prøver eller færre for at minimere risikoen for kontaminering og menneskelige fejl. Hvis der udføres flere runder af forstærkning, serielt nummerere forstærkning partier og registrere hver prøve forstærkning batchnummer i tabel 1.

  1. Forberedelse of reagenserne og PCR hætte
    1. Tilsæt PCR-amplifikation indstillet oplysninger til tabel 1, som vil danne grundlag for kortlægning fil ved sekvensanalyse scenen.
    2. Fjern alle materialer fra en PCR hætte og rengør de indvendige overflader grundigt med blegemiddel efterfulgt af en dekontaminerende der fjerner RNaser, DNaser og DNA. Vær sikker på at rense hver reagens og stykke udstyr (f.eks pipetter) før du placerer dem i hætten. Bær friske handsker rengøres med en nukleinsyre dekontaminant før arbejde i hætten.
    3. Om nødvendigt fortyndes nukleinsyre-templaten til 50 - 100 ng / pl anvendelse af DNA-fri og nuclease-frit vand.
    4. Optø alikvoter af 5x high-fidelity (HF) puffer, dNTP'er og primere i ren PCR hætte. Forsigtigt vortex og centrifuger alle løsninger efter optøning. For at minimere fryse-tø cykler og risikoen for lager kontaminering forberedes portioner af 5x HF-buffer, dNTP'er og primere.
    5. Placer enren stationære køligere rack til mikrocentrifugerør og en PCR-plade køler ind i hætten.
  2. Til PCR reaktion, forberede master mix ved at kombinere 15,5 pi ultrarent vand, 5 pi 5x HF puffer, 0,5 pi dNTP, 0,5 pi 515F fremadrettet primer, 0,75 pi 3% DMSO og 0,25 pi Polymerase for hver reaktion. Saml alle reaktionskomponenter i køleren og tilsæt polymerase sidste. Bland grundigt ved pipettering. Tilføj to ekstra prøver til reaktionen count ved udarbejdelsen master mix, at tage højde for pipetteringsfejl.
  3. PCR-reaktion opsætning:
    Bemærk: Udfør amplifikationer i tre eksemplarer, hvilket betyder hver prøve amplificeres i tre separate 25 pi reaktioner. Kør en uden template vandkontrol med hvert primerpar. Arbejde hurtigt, men omhyggeligt, undgå indførelsen af ​​en eventuel forurening.
    1. Mærk en 8-brønd stribe med individuelle hætter og sted i en PCR-køler.
    2. Pipette 90 pi mester mix i det førstegodt.
    3. Tilsæt 2 pi af den reverse primer (Supplemental File 1). Vær sikker på at omhyggeligt notere reverse primer stregkode anvendes med hver prøve i tabel 1.
    4. Bland godt og overføre 23 pi store blanding til den fjerde brønd (den kontrol uden template).
    5. Tilsæt 2 pi vand til den fjerde brønd.
    6. Tilføj 6 ul af passende prøve til den første brønd. Bland godt og overføre 25 pi til den anden brønd. Skift tips og overføre yderligere 25 pi fra den første brønd til den tredje godt. Fast cap hver godt, og sørg for ikke at røre ved indersiden af ​​brøndene eller cap i processen.
    7. Gentag for hver prøve.
  4. Udføre PCR-amplifikation
    1. Overfør striben rør til en thermocycler og kør følgende program: 30 sekunder ved 98 ° C efterfulgt af 30 cykler af 10 sekunder ved 98 ° C, 30 sekunder ved 57 ° C, og 12 sekunder ved 72 ° C, efterfulgt af en 10 min hold ved 72 ° C og sidste hold ent 4 ° C.
    2. Udfør følgende trin på en ren lab bænk. Hurtigt dreje rørene til at indsamle væske fra væggene. Kombiner tredobbelte PCR-reaktioner fra hver prøve, med et samlet volumen på 75 pi, i et sterilt mærket rør. Også overføre 25 pi af hver kontrol uden template i en separat steril rør. Bland ikke amplikoner fra forskellige prøver endnu.
  5. Validering af vellykket PCR-amplifikation af prøver ved hjælp af gelelektroforese.
    1. Der fremstilles en 1,5% agarosegel (1,5 g agarose pulver i 100 ml 1x TAE-buffer) med nok brønde for at holde hver amplikon, vandkontrol, og stigen 21.
    2. Mens gel hærder (ca. 30 min), forberede prøven til elektroforese: Tilsæt 1 pi 6x lastning farvestof til en ny, mærket rør. Til dette rør, tilsættes 5 pi af amplikonet og blandes ved pipettering.
    3. Når gelen har sat, fjerne kamme, placere gelen i elektroforese tank, og fyld tanken med 1x TAE buffer. Til den første brønd, tilsættes 5 pi DNA-stige.
    4. Belastning 5 pi af prøven amplicon til et andet godt. Belastning 5 pi af no-template amplikon til en separat brønd. Fortsæt efter behov for hver prøve.
    5. Når alle prøver er blevet indlæst, skal du skubbe låget tanken på plads og tænde for strømmen kilde til 120 V. Lad gelen køre i 30 - 60 min.
    6. Se gelen under UV-lys.
      1. Bekræft vellykket forstærkning af hver prøve ved at bemærke en enkelt stærk bånd omkring 380 bp. Hvis der er en dobbelt bånd, re-amplificere prøven med en anden reverse stregkode (trin 2.3). Hvis der ikke er band overhovedet, re-amplificere prøven under anvendelse af enten den samme reverse stregkode eller en ny omvendt stregkode (trin 2.3). Hvis re-forstærkning er mislykket, kan PCR-inhibitorer være til stede i prøven, i hvilket tilfælde, udføre en kolonne-baserede DNA oprydning for at fjerne PCR-hæmmere.
        Bemærk: Vellykket forstærkning kan ikke være muligt, hvis DNA-koncentrationen den bakterielle i elleriginal prøve er utilstrækkelig (<5 ng / pl).
      2. Verificere manglende reagens kontaminering ved at bemærke fraværet af et bånd i kontrol uden template.
    7. Opbevar de resterende 70 pi amplikon ved -20 ° C. Kassér de resterende 20 pi af kontrol uden template, forudsat det gav ikke et band.

3. Bibliotek Pooling og High-Throughput Sequencing

  1. Opret amplikonet pool ved at kombinere et tilsvarende volumen (2 - 5 eliter) af hvert amplikon i en enkelt steril rør. Hvis båndet fra en prøve så særdeles svag, tilsættes dobbelte volumen i forhold til resten af ​​prøverne.
  2. Fjern PCR primerne fra amplicon pool anvendelse af en PCR Clean-up kit, ifølge producentens anvisninger 22. Udfør oprydningen med flere kolonner, hvis amplikon pool volumen er over 100 pi. Bemærk: Hver kolonne har en 100 pi kapacitet.
    1. Opbevar biblioteket på -20 & #176, C eller gå videre til næste trin.
  3. Hvis det er relevant, kombinere primer-fri amplicon puljer til at skabe den endelige bibliotek. Bestem DNA-koncentration på biblioteket under anvendelse af et spektrofotometer eller et fluorometrisk systemet 23. Et forhold 260/280 mellem 1,8 - 2,0 er indikativ for rent DNA.
  4. Fortynd biblioteket til 20 nM. Bekræfte kvaliteten af ​​biblioteket ved at visualisere et enkelt bånd omkring 400 bp under anvendelse af en elektroforese instrument. Bekræft koncentrationen af biblioteket under anvendelse af et fluorometrisk ordning 23.
  5. Udfør en endelig 1:10 fortynding i vand for at fortynde biblioteket til 2 nM. Derefter opbevares biblioteket ved 20 ° C på ubestemt tid.
  6. Send en portion af den endelige bibliotek med de tre krævede sekventeringsprimere (Læs 1, Læs 2, og indeks, se Tabeller af Materialer / udstyr), der skal sekventeret på Illumina sequencer. Hvis færre end 300 prøver er blevet multiplex til sekventering, bruge en enkelt-end 300 bp køre og med en 12 bp indeks læse ona MiSeq, med en endelig bibliotek koncentration på 5 pM, og en 10% denatureret PhiX spike-in. Se supplerende materialer Caporaso et al. ISME J 2012 10 for detaljerede sekventering instruktioner.

4. Sekvensanalyse

Bemærk: Skitseret her er en grundlæggende rørledning til sekvensanalyse ved hjælp af QIIME 1.8.0 softwarepakke. For enkelhed, de leverede kommandoer antage, at kortlægning fil kaldes mapping.txt, den 12 bp indekset læse fil kaldes index.fastq, og 300 bp sekventering læse fil kaldes sequences.fastq. Installer QIIME eller MacQIIME 16 og gøre dig bekendt med det grundlæggende i UNIX til at udføre disse kommandoer. Læs den komplette guide til QIIME på:

  1. Gennemfør kortlægning filen for forsøget (tabel 1). Medtag så meget metadata som muligt. Bemærk hvilke prøver er blevet udvundet eller forstærket i samme parti, for at afgøre, om der er batch effekter.
  2. f.eks mapping.txt. Godkend formateringen af ​​kortlægning fil ved at udføre følgende kommando: validate_mapping_file.py -m mapping.txt -o mapping_output
    Bemærk: Denne kommando bruger den indbyggede "validate_mapping_file.py" QIIME script, der gør en ny mappe, der hedder "mapping_output", der indeholder en .html fil angiver kortlægning fil fejl de, hvis nogen.
  3. Kontroller kvaliteten af sekventering læser ved hjælp af en high-throughput sekvens datakvalitet kontrolprogrammet, såsom FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Figur 5 viser pr basesekvensen kvalitet der kan forventes fra en vellykket løb.
    Bemærk: sequencer tildeler hver nukleotid udgangspunkt i et Phred kvalitet score, hvilket svarer til sandsynligheden for, at basen er blevet fejlagtigt kaldt. En Phred kvalitet score på 10 angiver, at der er en 10% chance for, at nukleotid har været forkert tildeleed, 20 angiver en 1% chance 30 angiver en 0,1% chance og 40 (den højeste score muligt) angiver en 0,01% chance 24.
  4. Brug af kortlægning filen som en nøgle, demultiplex, kvalitet filtrere sekventering data, og gemme resultatet i en mappe (i dette tilfælde, kaldet "sl_out") ved at udføre denne kommando 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    Bemærk: q flag angiver den maksimale score uacceptable Phred kvalitet, fx "-q 29" bortfiltrerer eventuelle sekvenser med Phred score under 30, hvilket sikrer 99,9% nøjagtighed basen opkald.
  5. Brug af Greengenes 16S operationelle taksonomiske enhed (OTU) referencedatabase 26 (http://qiime.org/home_static/dataFiles.html), udføre åben henvisning OTU plukning ved at udføre denne kommando 27: pick_open_reference_otus.py -i sl_out / seqs. fna -r 97_otus.fasta -o ucrss / -s 0,1
    Bemærk: Den -s angiverden del af sekvenser, blev ikke justeret til referencedatabasen, der vil indgå i de novo klyngedannelse. "-s 0.1" omfatter 10% af de mislykkede sekvenser i de novo klyngedannelse. Brug -a flag for at parallelize den OTU plukke processen og reducere behandlingstiden fra dage til timer, hvis flere kerner er tilgængelige.
  6. Opret en brugervenlig taksonomisk overflod bord ved at sammenlægge Otus på artsniveau ved at udføre denne kommando 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    Bemærk: Den resulterende tabel kan nemt ses i et regneark-software. Bemærk, at 16S rRNA sekventering ikke pålideligt give artsniveau opløsning.
  7. Bestem økologiske mangfoldighed inden for hver prøve ved at beregne flere alfa mangfoldighed målinger med QIIME script alpha_diversity.py. Derefter bestemmer mangfoldigheden mellem par af prøver ved hjælp af QIIME script beta_diversity.py.
  8. Visualize data, fx ved hjælp af en kejser 29 principal koordinater plot eller Heatmap.
  9. Udfør formelle statistiske sammenligninger af kortlægning fil kategorier, fx med QIIME s compare_catagories.py script 30.

Representative Results

Den generelle overblik over den protokol, som gør det muligt bestemmelse af relative bakterielle forekomster fra en vatpind hjælp 16S rRNA-genet sekventering, er vist i figur 1 .Den protokol er blevet optimeret for humane vaginale podninger, men kan let tilpasses til de fleste slimhinde prøveudtagningssteder og andre værter. Figur 2 viser den høje kvalitet DNA og RNA, som kan isoleres ved hjælp af perle-bankende protokol. Figur 3 illustrerer en vellykket PCR-amplifikation af 12 prøver, hvor hver amplifikation med en prøve gav et enkelt stærkt bånd af den korrekte størrelse og hver vandkontrol gav ikke et band. Figur 4 illustrerer kvantificeringen af den endelige bibliotekspulje inden sekventering. Figur 5 viser en typisk sekvens kvalitet profil efter en enkelt udgang 300 bp MiSeq løb.

"Src =" / files / ftp_upload / 53.939 / 53939fig1.jpg "/>
Figur 1. Skematisk oversigt af protokollen. Først nukleinsyre udvundet fra en vatpind af perle-bankende i en bufferopløsning, der indeholder phenol, chloroform og isoamylalkohol. Variabel region 4 af 16S rRNA-genet forstærkes derefter fra den resulterende nukleinsyre under anvendelse af PCR. PCR amplikoner fra op til flere hundrede prøver kombineres derefter og sekventeret på et enkelt kørsel. De resulterende sekvenser er matchet til en reference, for at fastlægge de relative bakterielle forekomster. Hele protokol kan udføres i cirka tre dage. Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Høj kvalitet Nucleic Acid ekstraheret under anvendelse af Phenol: Chloroform Bead Beating Metode. (A) DNA kvalitet, som vurderet ved anvendelse af et spektrofotometer. En A260 / A280-forhold mellem 1,8 og 2,0 angiver ren nukleinsyre, som ikke er forurenet med phenol eller protein. (B) Efter en søjle oprydning, kan denne protokol opnåelse af høj kvalitet RNA, angivet med stærke 16S og 23S rRNA-toppe. (C) RNA-nedbrydning kan forekomme, hvis prøven ikke holdes kold efter opsamling (under transport og opbevaring), eller hvis RNaser er til stede under behandlingen. klik her for at se en større version af dette tal.

Figur 3
Figur 3. Bekræftelse af Vellykket 16S rRNA Gene Amplification Brug af 515F og Barcoded 806R Primer Set. Top) Gelelektroforese anvendes til at bekræfte tilstedeværelsen af et enkelt bånd omkring 380 basepar in hver prøve, som blev amplificeret med template. Fraværet af et band indikerer mislykket forstærkning; dette er normalt på grund af menneskelige fejl og PCR-reaktionen fra at prøve skal gentages. Bund) nr skabelon (vand) kontroller løbe parallelt med den samme primerpar bør ikke have et band til stede. Tilstedeværelsen af ​​et bånd i vandet kontrol indikerer forurenede reagenser; kassere de reagenser, der kan være kontamineret, og re-do PCR amplifikationer både skabelonen og vand kontrol for at primerparret. Klik her for at se en større version af dette tal.

Figur 4
Figur 4. Kvantificering af den endelige Bibliotek Pool Koncentration og Validering af biblioteket Størrelse. Efter at samle de enkelte prøve amplikoner, the koncentration af den endelige bibliotekspulje skal bestemmes. Biblioteket pulje skal derefter fortyndes yderligere for at opnå en 2 nM koncentration. Klik her for at se en større version af dette tal.

Figur 5
Figur 5. Repræsentant Bar Plot af sekvensen kvalitetsresultaterne i hver position i Læs. Det er normalt for kvaliteten sekvens til at falde efter 200 basepar, men den gennemsnitlige kvalitet score bør ligge over 30. Klik her for at se en større version af dette tal.

#SampleID Stregkode
LinkerPrimer
sekvens
rcbcPrimer SampleType Udvinding
Parti
forstærkning
Plade
Beskrivelse
#An Eksempel kortlægning fil kan findes på: http://qiime.org/_static/Examples/File_
Formater /
Eksempel_
Mapping_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 Cervikal
swab
1 EN

Tabel 1. Kortlægning File skabelon. CreaTing en præcis og grundig kortlægning fil er kritisk for en vellykket udførelse af protokollen. Kortlægningen fil er ikke kun nødvendig for udførelsen QIIME, men det gør det også muligt for forskeren at opretholde forbindelsen mellem prøven stregkode og metadata, at analysere dataene for eventuelle systematiske afvigelser (f.eks batch-til-batch variation), og til at bestemme interessante sammenhænge mellem metadata og bakterielle populationer. En bare-bone kortlægning fil er forudsat, men brugere opfordres til at tilføje så mange kolonner, der indeholder metadata som muligt. Eksempler på ekstra metadata for en vaginal podepind omfatter deltagerens alder, dato / tid for svaber indsamling, hormonelt præventionsmiddel type (hvis relevant), seksuelt overførte infektion prøveresultater mv

suppliment 1
Supplerende fil 1. Liste over Barcoded Reverse primersekvenserne 10 Klik her for at downloade denne fil.

Discussion

Her beskriver vi en protokol for identifikation og karakterisering af relative bakterielle forekomster inden for et menneske vaginal podning. Denne protokol kan nemt tilpasses til andre prøvetyper, såsom afføring og svaberprøver fra andre steder på kroppen, og for prøver indsamlet fra en lang række kilder. Udvindingen af ​​nukleinsyre ved perle-bankende i en bufret opløsning af phenol og chloroform muliggør isolering af både DNA og RNA, hvilket er særligt vigtigt, når man arbejder med kostbare prøver indsamlet i kliniske studier. Det isolerede bakterie-DNA er fremragende til bakteriel taksonomisk identifikation og genomisk samling, medens den samtidige indsamling af RNA giver mulighed for at bestemme funktionel bakteriel, vært og virale bidrag gennem RNA-seq. Den beskrevne protokol anvender en valideret ettrins primer sæt, der er blevet indsat på en lang række prøvetyper, inklusive menneske, hund og miljøprøver 10

Den nukleinsyre udvinding del af denne protokol er begrænset af de sikkerhedsregler, der kræves, når man arbejder med phenol og chloroform, og udfordringerne i at automatisere rørledningen til en high-throughput, 96 brønde format. Derudover kraftig vulst bankende anvendes til mekaniske lysis saks det bakterielle DNA til ca. 6 kilobase-fragmenter; hvis længere DNA-fragmenter er nødvendige for downstream-applikationer, varigheden af ​​perle slå should afkortes. Begrænsningerne i den bakterielle identifikation del af denne protokol er uløseligt forbundet med enhver metode, der bygger på 16S rRNA-genet sekventering. 16S rRNA sekventering er ideel til bakteriel identifikation til slægten og endda artsniveau, men sjældent giver identifikation stamme. Mens V4 variable region af 16S rRNA-genet giver robust diskrimination blandt de fleste bakteriearter 11, kan være nødvendigt at blive anvendt til præcist at identificere visse arter, såsom Lactobacillus crispatus yderligere beregningsmæssige metoder såsom Oligotyping 31. Endelig kan oplysninger om de præcise bakterielle funktionelle egenskaber inden for en bestemt prøve ikke bestemmes ved 16S rRNA-genet sekventering alene, selvom denne protokol muliggør ekstraktion af hele genomet DNA og RNA, som kan anvendes mod dette formål.

Det mest kritiske skridt til at sikre succes med denne protokol tager stor omhu for at forhindre forurening during prøveindsamling, nukleinsyre ekstraktion og PCR-amplifikation. Sørg sterilitet på tidspunktet for prøvetagning ved at bære rene handsker og bruge sterile vatpinde, rør, og sakse. For at vurdere om forurening af indsamlingsmateriel, indsamle negative kontrol svaberprøver ved at placere yderligere ubrugte podninger direkte ind transport rør på tidspunktet for prøveudtagningen. I laboratoriet, udføre alle pre-forstærkning trin i en steriliseret hætte, der kun indeholder dekontamineres forsyninger og hjælp kun molekylærbiologisk kvalitet, DNA-fri reagenser. Under nukleinsyre udvinding, undgå krydskontaminering ved hjælp af nye steril pincet og friske handsker med hver prøve, og holde alle rør lukket, medmindre i brug. Forarbejdning ubrugte svaberprøver parallelt sikrer sterilitet af både prøveopsamlings- og nukleinsyre-ekstraktion; de ubrugte podninger bør ikke give en pille efter isopropanol nedbør og ethanol vask. Hvis en pellet kommer frem udføre 16S rRNA-genet amplifikation for at bestemme en mulig kilde tilforureningen (f.eks ville tilstedeværelsen af Streptococcus eller Staphylococcus indikere forurening af huden). Derudover udføre PCR-amplifikationer uden skabelon kontrolreaktioner parallelt at sikre, at PCR-reagenser og reaktioner ikke er blevet forurenet. Hvis et band optræder i en ingen skabelon kontrol, kassere reagenserne og gentag forstærkning med friske reagenser. Tager disse forholdsregler vil sikre en vellykket sekventering af bakterier af interesse.

PCR-amplifikation trin tendens til at kræve den mest fejlfinding. Forstærker i sæt af tolv prøver giver en balance mellem effektivitet og sammenhæng. Den fuldstændige fravær af bands på tværs af alle prøver i en given forstærkning sæt angiver en systematisk fejl, fx glemmer at tilføje et reagens eller forkert programmering af thermocycler. Fraværet af et band fra et par prøver er normalt på grund af menneskelige fejl, og amplificeringer bør re-run med den samme parring af prøve og reverse primer. I tilfælde af vedvarende fravær af et bånd, prøven kan re-amplificeres under anvendelse af en revers primer med en anden stregkode. Gentagne amplifikationsprodukter svigt med flere reverse primere kan indikere en inhibitor til stede i prøven. I så fald, rengøring af DNA med en kolonne vil ofte fjerne hæmmere uden væsentlig ændring relative bakterielle forekomster. Hvis multiple bånd resulterer efter amplifikation, re-amplificere prøven med en anden reverse primer stregkode.

Ud over at forhindre miljøforurening og sikre forstærkning af et enkelt specifikt produkt, vellykket sekventering afhængig pleje ved udarbejdelsen af ​​biblioteket pool. Målet er at kombinere ækvimolære mængder af hver prøve er amplikoner at sikre tilnærmelsesvis det samme antal sekventering læser per prøve. Hvis nukleinsyre-koncentrationer før amplifikation er sammenlignelige, blot at tilføje lige store volumener af hver sample s amplikoner er tilstrækkelig, når du opretter biblioteket pool. Men hvis nukleinsyre-koncentrationer er meget forskellige og tilsat i lige volumen, prøven med den lave nukleinsyrekoncentration vil blive dårligt repræsenteret med et lavt antal læser. I dette tilfælde er det muligt at tilsætte en større mængde af de amplikoner fra den lave koncentration prøve baseret på den relative intensitet af gelen band. Alternativt er det muligt at mere stringent fjerne primere fra de enkelte amplikoner, kvantificere individuelle prøves amplicon koncentration på en fluorometrisk dsDNA kvantificering kit, og præcist kombinere ækvimolære mængder af hver prøve.

Når en velafbalanceret amplicon pool genereres, bliver det vigtigt at omhyggeligt måle poolens koncentration. Efterfølgende omhyggelig fortynding og spike-in med PhiX at øge den læste kompleksitet er afgørende for at opnå optimale sekventeringsresultaterne. High-throughput sequencers der bruger sequencing ved syntese er meget følsomme over klyngen tæthed på flowcellen. Ilægning et bibliotek pulje, der er alt for koncentreret, vil resultere i overclustering, med lavere kvalitet scoringer, lavere data output, og unøjagtig demultiplexing 32. Ilægning et bibliotek pulje, der er for fortyndet vil også resultere i lav data output. Omhyggeligt kvantificere biblioteket pulje før sekventering vil sikre optimale resultater.

16S rRNA-genet sekventering giver en samlet vurdering af de bakterier, der er til stede inden for en given prøve, og er en helt afgørende første skridt i hypotese generation. Tilstedeværelsen af ​​et rigt sæt af metadata yderligere muliggør forskeren at teste sammenhænge mellem bestemte bakteriearter og vigtige biologiske faktorer. Desuden kan det samme 16S oplysninger bruges til at udlede de bakterielle funktioner med med værktøjer som PICRUSt 33. Det endelige mål er at bruge 16S karakterisering at identificere nye foreninger, der kan væreyderligere testet og valideret i modelsystemer, tilføjelse til vores voksende forståelse af konsekvenserne af den bakterielle microbiome på menneskers sundhed og sygdom.

Acknowledgements

Vi vil gerne takke Elizabeth Byrne, David Gootenberg, og Christina Gosmann for kritisk feedback på protokollen; Megan Baldridge, Scott Handley, Cindy Monaco, og Jason Norman for prøveforberedelse vejledning og demonstrationer; Wendy Garrett, Curtis Huttenhower, Skip Virgin, og Bruce Walker til protokol rådgivning og frugtbare drøftelser; og Jessica Hoisington-Lopez til sekventering support. Dette arbejde blev støttet af Bill og Melinda Gates Foundation og NIAID (1R01AI111918). DSK modtaget yderligere støtte fra Burroughs Wellcome fonden. MNA blev støttet af award nummer T32GM007753 fra NIGMS, og Paul og Daisy Soros Fellowship. Indholdet er alene forfatternes ansvar og repræsenterer ikke nødvendigvis de officielle udsigt over NIGMS eller NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics