Effektiv Nucleic Acid Utvinning og 16S rRNA Gene Sekvense for Bakteriell Fellesskapet Karakterisering

1Ragon Institute of MGH, MIT, and Harvard, Massachusetts General Hospital
Biology
 

Summary

Vi beskriver en effektiv, robust og kostnadseffektiv metode for å utvinne nukleinsyre fra vattpinner for karakterisering av bakterielle samfunn ved hjelp av 16S rRNA-genet amplicon sekvensering. Fremgangsmåten gjør det mulig for en vanlig behandling tilnærming for flere prøvetyper og har plass til en rekke nedstrøms analytiske prosesser.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Det er en økende forståelse for rollen som mikrobielle samfunn som kritiske modulatorer av menneskers helse og sykdom. Høy gjennomstrømning sekvenseringsteknologi har gjort det mulig for rask og effektiv karakterisering av bakterielle miljøer ved hjelp av 16S rRNA-genet sekvensering fra en rekke kilder. Selv om lett tilgjengelige verktøy for 16S rRNA sekvensanalyse har standardiserte beregnings arbeidsflyt, utvalgets behandling for DNA-ekstraksjon forblir en fortsatt kilde til variasjon på tvers av studier. Her beskriver vi en effektiv, robust og kostnadseffektiv metode for å utvinne nukleinsyre fra vattpinner. Vi har også avgrense nedstrømsfremgangsmåter for 16S rRNA-genet sekvensering, inkludert generering av sekvensbiblioteker, kvalitetskontroll av dataene, og sekvensanalyse. Arbeidsflyten kan romme flere prøver typer, inkludert avføring og vattpinner samlet inn fra en rekke anatomiske steder og vertsarter. I tillegg utvinnes DNA og RNA kan separeres og benyttesfor andre programmer, inkludert hele genomsekvensering eller RNA-seq. Fremgangsmåten som er beskrevet gjør det mulig for en vanlig behandling tilnærming for flere prøvetyper og har plass til nedstrøms analyse av genomisk, metagenomic og transkripsjonen informasjon.

Introduction

Den menneskelige lavere skjede, gastrointestinal system, luftveiene og huden blir kolonisert av komplekse bakteriesamfunn som er kritiske for å opprettholde vev homeostase og støtte helsen til verten en. For eksempel, viss laktobasiller skape et ugjestmildt miljø for patogener ved å surgjøre vaginal hvelv, produsere antimikrobielle effektorer og moduler lokale verten immunitet 2-4. Den voksende forståelse for bakteriell mikrobiomer betydning har også økt interesse for å karakterisere bakteriesamfunn i mange kliniske sammenhenger. Her beskriver vi en fremgangsmåte for å bestemme sammensetningen av den bakterielle mikrobiomer av genital spinner. Protokollen kan lett modifiseres for avføringsprøver og vattpinner hentet fra andre anatomiske steder og andre vertsarter.

På grunn av de iboende begrensninger i antall prøver som kan samles og lagres fra en gitt study deltaker, denne protokollen ble utformet for å trekke ut DNA, RNA, og potensielt også protein fra en enkelt pinne ved hjelp av en tilpasset fenol-kloroform basert perle-juling metode 5,6. Kombinasjonen av fysisk forstyrrelse av bakteriecellevegger med perle-vibrerende og kjemisk avbrudd med vaskemidler tillater hurtig lysering av grampositive, gramnegative og syrefaste bakterier, uten ytterligere enzymatisk oppslutning trinn. For å oppnå høy kvalitet RNA, er det anbefalt å bruke tørre kompresser som ble holdt på eller under 4 ° C umiddelbart etter innsamling og under transport til laboratoriet (hvis aktuelt), og lagret langsiktig ved -80 ° C.

For å bestemme bakterie mikrobiomer innenfor en gitt prøve, benytter denne prosedyren 16S rRNA-genet fragment sekvensering, som for tiden er den mest kostnadseffektive måten å omfattende tildele bakteriell taksonomi og utfører relativ kvantifisering. Alternative metoder omfatter målrettet qPCR 7, tilpasset microarrays 8, og hel-genomsekvense 9. 16S rRNA-genet inneholder ni hypervariable områder, og det er ingen enighet om den optimale V-regionen å sekvensere for vaginal mikrobiomer studier. Her bruker vi 515F / 806R primer sett og bygge på rørledningen designet av Caporaso et al. 10-12. Caporaso et al. 'S 515F / 806R primer sett muliggjør multipleksing av hundrevis av prøver på et enkelt sekvense løp på grunn av tilgjengeligheten av tusenvis av validerte strekkode primere og kompatibilitet med Illumina sekvense plattformer. I motsetning til den menneskelige mikrobiomer Prosjektets 27F / 338R primersett 13, 515F / 806R også effektivt forsterker Bifidobacteriaceae og dermed nøyaktig fanger Gardnerella vaginalis, et viktig medlem av vaginal mikrobielle samfunnet i noen kvinner. Alternativt har et 338F / 806R primerpar blitt brukt for pyrosekvensering av vaginale prøver 14 og en 515F / 926R primerpar har recently blir tilgjengelige for neste generasjons sekvense 12.

Til slutt gir denne protokollen grunnleggende instruksjoner for å utføre 16S fragment analyse ved hjelp av kvantitative Innsikt i Microbial Ecology (QIIME) programvarepakken 15. Vellykket gjennomføring av QIIME kommandoene som er beskrevet her gir en tabell som inneholder bakterie taksonomiske hopetall for hver prøve. Mange flere kvalitetskontrolltrinn, taksonomiske klassifisering metoder, og analysefremgangsmåten kan bli innlemmet i analysen, som beskrevet i detalj på QIIME nettsted (http://qiime.org/index.html). Dersom analysen vil bli utført på en Apple-maskin, den MacQIIME pakke 16 gir enkel installasjon av QIIME og dens avhengigheter. Alternative programvarepakker for 16S rRNA-genet sekvensanalyse inkluderer Mothur 17 og UPARSE 18.

Protocol

Studien protokollen ble godkjent av og fulgt retningslinjene for Biomedical forskningsetiske komité ved University of KwaZulu-Natal (Durban, Sør-Afrika) og Massachusetts General Hospital Institutional Review Board (2012P001812 / MGH, Boston, MA).

1. Utvinning av Total nukleinsyre fra cervicovaginal Swabs

Merk: Utfør nukleinsyre ekstraksjoner i sett med 16 prøver eller færre. Protokollen som skrevet under forutsetter prøvene er behandlet i sett på 12. Hvis du utfører flere runder av utdrag, serielt nummerere utvinning grupper og registrere hver prøve ekstraksjonsverk batchnummer samt annen prøve informasjon (inkludere metadata som deltakerens ID-nummer, alder , dato / klokkeslett for innsamling pinne, hormonelle prevensjonstype, seksuelt overførbare infeksjoner testresultater, etc.) i tabell 1.

  1. Utarbeidelse av reagenser og avtrekksvifte
    1. Juster pH av fenol: kloroform: isoamylalkohol (IAA) (25: 24: 1) til pH 7,9 ved tilsetning av 65 ul Tris alkalisk buffer per 1 ml fenol, risting av blandingen i 2 min, og slik at de to faser for å separat enten naturlig eller ved sentrifugering ved 10 000 x g i 5 min ved RT.
      Forsiktig: Fenol er giftig ved svelging, ved innånding, eller i kontakt med hud og øyne. Unngå innånding av røyk. Bruk ugjennomtrengelige hansker, vernebriller med sideskjermer, og en frakk.
    2. Filter-sterilisere 25 ml 20% natrium-dodecyl-sulfat (SDS) gjennom et 0,22 um filter. Gjør 5 ml porsjoner av steriliserte SDS.
    3. Chill en 10 ml alikvot av isopropanol ved -20 ° C.
    4. Forbered en perle juling tube for hver sWAB som skal behandles ved å veie ut 0,3 g glasskuler i et sterilt 2 ml rør som er egnet for vulsten beater.
    5. Skaff vattpinner ved prøvetaking ectocervix med en steril absorberende bomullspinne. Umiddelbart etter samlingen, plassere pinnen inn i en tom og steril kryoampulle, oppbevar ved 4 ° C i 1-4 timer under transport til laboratoriet, og lagre i flere måneder ved -80 ° C. Overfør tørk (som finnes i enkelte rør) for å bli behandlet for å våt is.
    6. Klargjør biologisk sikkerhetskabinett (BSC). Bruke en BSC med en «fingerbøll» som er koblet til bygningen eksos for å sikre tilfredsstillende fjerning av flyktige kjemikalier.
      1. Fjern alle materialer fra panseret.
      2. Rengjør alle overflater av panseret med blekemiddel, etterfulgt av et rengjøringsmiddel som fjerner RNases, DNasene, og DNA fra overflater. Rene alle etterfølgende elementer føres inn i hetten ved hjelp av blekemiddel, etterfulgt av en nukleinsyre rengjøringsmiddel, inkludert hansker. Bruk friske RNase / DNase-frie reagenser, slik som pipette tips, når det er mulig.
      3. Tape en sterilisert kjemisk biohazard bag til baksiden av panseret. All tørt avfall som inneholder fenol eller kloroform bør plasseres i denne posen for riktig avhending.
      4. Plasser en steril flaske i panseret for å samle flytende avfall som inneholder fenol eller kloroform.
  2. Fenol-kloroform ekstraksjon.
    1. I hetten, til hver perle vibrerende rør, tilsett 500 ul buffer (fra trinn 1.1.1), 210 pl av 20% natriumdodecylsulfat, og 500 pl av fenol: kloroform: IAA (25: 24: 1, pH 7.9 ).
    2. Overfør pinnen fra transporthetteglasset inn i perle juling røret ved hjelp av et par nye steril pinsett. Grundig gni hodet pinnen mot de indre veggene i perle juling rør i minst 30 sek. Re-cap prøven når du er ferdig. Hvis du utfører utdrag fra flere vattpinner, bytte hansker mellom hver prøve.
    3. Chill prøven på is i minst 10 min. Fjern pinnen fraperle slo tube ved å holde håndtaket pinnen med sterile pinsetter mens du trykker hodet pinnen mot den indre rørveggen med en ren P200 tips. Kast vattpinner i pulver avfallsposen. Merk: "nal" handling (trykke hodet pinnen) vil frigjøre væske fra absorbenten pinnen og øke nukleinsyre utvinning.
    4. Plasser vulsten bankrøret inn i vulsten beater og homogeniseres i 2 minutter ved 4 ° C.
    5. Sentrifuger vulsten vibrerende rør i 3 minutter ved 6000 xg og 4 ° C for å pelletere rusk og separere de vandige og fenol faser.
    6. Overfør den vandige fase (~ 500-600 pl) til et sterilt 1,5 ml rør. Legge til et likt volum av fenol: kloroform: IAA. Bland ved inversjon og kort virvling.
    7. Sentrifuger røret i 5 min ved 16 000 xg og 4 ° C.
    8. Overfør den vandige fase i et nytt sterilt 1,5 ml rør. Være konservativ og ikke overføre materiale fra inter laget eller den underliggende fenolfase. Legg merke til volumet av den overførte vandige fase. Lagre fenol fase for fremtidig protein isolasjon.
    9. Legg 0,8 volum av isopropanol og 0,1 volum av 3 M natriumacetat (pH 5,5). Bland grundig ved inversjon og kort virvling.
    10. Utfelle nukleinsyren ved avkjøling av røret ved -20 ° C i minst 2 timer (inntil O / N).
  3. Isopropanol nedbør og etanol vask
    1. Sentrifuger røret i 30 minutter ved ca. 16 000 xg og 4 ° C. bruke omhyggelig en pipette for å fjerne supernatanten, slik at pellet intakt.
    2. Legg 500 mL av 100% etanol. Løsne pellet med forsiktig virvling eller pipettering uten å berøre pellet. Sentrifuger i 5 min ved 16 000 xg og 4 ° C.
    3. forkaste forsiktig etanol supernatant. Bruke en P10 pipette for å fjerne så mye etanol som mulig uten å forstyrre pelleten.
    4. Air tørk pellet ved RT i 15 min.
    5. Resuspender pelleten i 20 pl ultra rent 0.1x Tris-EDTA buffer. Tillat prøven å kjøle ned på is i 10 min og pipette gjentatte ganger for å sikre fullstendig resuspensjon. Dersom pelleten ikke oppløses, overføres røret til en 40 ° C varmeblokk i opp til 10 minutter for å lette oppløsning.
    6. Mål-nukleinsyren konsentrasjon ved anvendelse av et spektrofotometer 19.
    7. Dersom det er ønskelig, separat DNA fra RNA ved hjelp av en kolonne clean-up kit, etter produsentens protokoll 20.
    8. Oppbevar nukleinsyre ved -80 ° C eller fortsette.

2. PCR-amplifisering av 16S rRNA Gene V4 hypervariable region

Merk: Utfør PCR-amplifisering i sett på 12 prøver eller færre for å minimalisere risikoen for forurensning og menneskelige feil. Hvis du utfører flere runder med forsterkning, serielt nummer forsterker grupper og registrere hver prøve sin forsterkning batchnummer i tabell 1.

  1. forberedelse of reagenser og PCR hette
    1. Tilsett PCR-amplifisering satt informasjon til tabell 1, som vil tjene som grunnlag for kartlegging filen ved sekvensanalyse trinnet.
    2. Fjern alle materialer fra en PCR hette og rengjør de innvendige overflatene grundig med blekemiddel etterfulgt av et rengjøringsmiddel som fjerner RNases, DNasene og DNA. Sørg for å rense hver reagens og del av utstyret (f.eks pipetter) før du legger dem i panseret. Bruk friske hansker rengjøres med en nukleinsyre dekontaminant før arbeider i panseret.
    3. Om nødvendig fortynnes nukleinsyretemplat til 50-100 ng / mL ved å bruke DNA-fri og nuklease-fri vann.
    4. Tine prøver av 5x high-fidelity (HF) buffer, dNTP og primere i ren PCR hette. Forsiktig vortex og sentrifuger alle løsninger etter tining. For å minimere fryse-tine-sykluser og risiko for forurensning lager, fremstille porsjoner av 5 x HF-buffer, dNTP, og primere.
    5. Plasser enren stasjonære maskiner kulere rack for mikrosentrifugerør og en PCR plate kjøligere i panseret.
  2. For PCR reaksjon, forberede master mix ved å kombinere 15,5 mL av ultrarent vann, 5 mL 5x HF buffer, 0,5 mL av dNTP, 0,5 mL av 515F frem primer, 0,75 mL 3% DMSO og 0,25 mL av Polymerase for hver reaksjon. Monter alle reaksjonskomponentene i kjøligere og tilsett polymerase siste. Bland grundig ved pipettering. Legg til to ekstra prøver å reaksjonen teller når du forbereder master mix, å gjøre rede for pipetteringsfeil.
  3. PCR reaksjon oppsett:
    Merk: Utfør amplifikasjoner i tre eksemplarer, noe som betyr at hver prøve blir forsterket i tre separate 25 ul reaksjoner. Kjør en no-mal vann kontroll med hver primer par. Arbeid raskt, men forsiktig, unngå innføring av eventuell forurensning.
    1. Merk et 8-brønnen stripe med individuelle caps og sted inn i en PCR kjøligere.
    2. Pipetter 90 mL av masterblanding inn i den førstegodt.
    3. Tilsett 2 mL av revers primer (Supplemental File 1). Pass på å nøye merke revers primer strekkode brukes med hver prøve i tabell 1.
    4. Bland godt og overføre 23 mL av Master Mix til den fjerde brønnen (no-mal kontroll).
    5. Tilsett 2 pl vann til den fjerde brønnen.
    6. Tilsett 6 pl av den aktuelle prøven til den første brønnen. Bland godt og overfør 25 pl til den andre brønnen. Endre tips og overføre ytterligere 25 ul fra den første brønnen som den tredje brønnen. Fast cap hver brønn, og pass på at du ikke berører innsiden av brønnene eller cap i prosessen.
    7. Gjenta for hver prøve.
  4. Utfør PCR forsterkning
    1. Overfør strippe rørene til en thermocycler og kjøre det følgende program: 30 sek ved 98 ° C, etterfulgt av 30 sykluser på 10 sek ved 98 ° C, 30 sek ved 57 ° C og 12 sek ved 72 ° C, etterfulgt av en 10 min holder ved 72 ° C og endelig hold ent 4 ° C.
    2. Utfør følgende trinn på en ren lab benk. Raskt spinne rørene for å samle væske fra veggene. Kombiner triplikate PCR-reaksjoner fra hver prøve, med et totalvolum på 75 ul, i en steril merkede rør. Også overføre 25 ul av hver ikke-templat kontroll inn i en separat steril rør. Ikke kombiner amplikonene fra ulike prøvene ennå.
  5. Validering av vellykket PCR-amplifisering av prøver ved hjelp av gelelektroforese.
    1. Tilbered en 1,5% agarosegel (1,5 g agarose pulver i 100 ml 1x TAE buffer) med nok brønner for å holde hver fragment, vann kontroll, og stige 21.
    2. Mens gel stivner (ca 30 min), forberede prøven for elektroforese: Tilsett 1 mL av 6x lasting fargestoff til en ny, merket tube. For dette tube, tilsett 5 mL av amplicon og bland ved pipettering.
    3. Når gelen har satt, fjerne kammene, plassere gel i elektroforese tanken, og fyll tanken med 1x TAE buffer. Til den første brønnen, tilsett 5 mL av DNA stigen.
    4. Load 5 mL av prøven amplicon til en annen også. Belastning 5 ul av den ikke-templat amplikon til en separat brønn. Fortsett som trengs for hver prøve.
    5. Når alle prøvene har blitt lastet, skyver tanken lokket på plass og slå på strømkilden til 120 V. La gelen til å kjøre i 30 - 60 min.
    6. Vis gelen under UV-lys.
      1. Bekreft vellykket forsterkning av hver prøve ved å merke seg én sterk bånd rundt 380 bp. Hvis det er en dobbel band, re-forsterke prøve med en annen omvendt strekkode (trinn 2.3). Hvis det ikke er noen bånd i det hele tatt, gjen forsterke prøven ved bruk av enten den samme reverse strekkode eller en ny omvendt strekkode (trinn 2.3). Ved re-amplifikasjon er vellykket, kan PCR-inhibitorer være til stede i prøven, i hvilket tilfelle, utfører en kolonne basert DNA opprydding for å fjerne PCR-inhibitorer.
        Merk: Vellykket amplifikasjon kanskje ikke være mulig hvis det bakterielle DNA-konsentrasjonen i elleriginal sample er for lite (<5 ng / mL).
      2. Bekrefte mangelen på reagenset forurensning ved å merke fravær av et bånd i den ikke-templat kontroll.
    7. Lagre de gjenværende 70 ul av amplikon ved -20 ° C. Kast de resterende 20 mL av no-mal kontroll, forutsatt at det ikke gir et band.

3. Library Samling og høy gjennomstrømming sekvense

  1. Lag det amplikon bassenget ved å kombinere et likt volum (2-5 ul) av hvert fragment i en enkelt sterilt rør. Dersom båndet fra en prøve så meget svak, tilsett to ganger volumet i forhold til resten av prøvene.
  2. Fjern PCR primere fra amplicon bassenget ved hjelp av en PCR Clean-up kit, etter produsentens anvisninger 22. Utfør oppryddingen med flere kolonner hvis amplicon bassenget volumet er over 100 pl. Merk: Hver kolonne har en 100 mL kapasitet.
    1. Oppbevar biblioteket ved -20 & #176, C eller gå videre til neste trinn.
  3. Hvis det er aktuelt, kombinerer primer fritt amplicon bassenger å skape den endelige biblioteket. Bestem DNA konsentrasjonen av biblioteket ved hjelp av et spektrofotometer eller en fluorometrisk system 23. En 260/280-forhold mellom 1,8 til 2,0 er indikativ for rent DNA.
  4. Spe biblioteket til 20 nM. Bekrefte kvaliteten av biblioteket ved å visualisere et enkelt bånd rundt 400 bp ved hjelp av et instrument elektroforese. Bekrefte konsentrasjonen av biblioteket ved anvendelse av en fluorometrisk system 23.
  5. Utfør en endelig 1:10 fortynning i vann for å fortynne biblioteket til 2 nM. Deretter lagrer biblioteket ved 20 ° C på ubestemt tid.
  6. Sende en prøve av den endelige bibliotek med de tre nødvendige sekvenseringsprimere (Les 1, Les 2, og indekser, se Tables of Materials / utstyr) for å bli sekvensert med en Illumina sequencer. Dersom færre enn 300 prøver har blitt multiplekset for sekvensering, bruke en enkelt-end 300 bp kjøre og med en 12 bp index lese ona MiSeq, med en endelig bibliotek konsentrasjon av 17:00 og 10% denaturert pHix spike-in. Se supplerende materialer Caporaso et al. ISME J 2012 10 for detaljerte sekvense instruksjoner.

4. Sekvensanalyse

Merk: Skissert her er en grunnleggende rørledning for sekvensanalyse ved hjelp av QIIME 1.8.0 programvarepakken. For enkelhets skyld, de angitte kommandoene anta at kartleggingen filen heter mapping.txt, den 12 bp indeksen lese filen kalles index.fastq, og 300 bp sekvense lese filen kalles sequences.fastq. Installer QIIME eller MacQIIME 16 og gjør deg kjent med det grunnleggende UNIX å utføre disse kommandoene. Les komplett guide til QIIME på:

  1. Fullfør tilordningsfilen for forsøket (tabell 1). Inkluder så mye metadata som mulig. Merk som prøver har blitt trukket ut eller forsterkes i samme batch, for å fastslå om det er batch effekter.
  2. f.eks mapping.txt. Valider formateringen av kartleggingen filen ved å kjøre følgende kommando: validate_mapping_file.py -m mapping.txt -o mapping_output
    Merk: Denne kommandoen bruker den innebygde "validate_mapping_file.py" QIIME script som gjør en ny mappe, kalt "mapping_output", som inneholder en HTML-fil som angir kartlegging fil feil, hvis noen.
  3. Kontrollere kvaliteten av sekvense leser ved anvendelse av en high-throughput-sekvensen datakvalitet sjekker programmet, for eksempel FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Figur 5 viser basesekvensen pr kvalitet som kan forventes fra en vellykket løp.
    Merk: sequencer tildeler hvert nukleotid-base en Phred kvalitetspoeng, noe som tilsvarer sannsynligheten for at basen har blitt feilaktig kalt. En Phred kvalitet score på 10 indikerer at det er 10% sjanse for at nucleotide har vært feilaktig tildeleed, 20 indikerer en 1% sjanse, 30 indikerer en 0,1% sjanse, og 40 (høyest mulig poengsum) indikerer en 0,01% sjanse 24.
  4. Bruke tilordningsfilen som en nøkkel, Demultiplekse, kvalitet filtrere sekvense data, og lagre resultatene i en mappe (i dette tilfellet, kalt "sl_out") ved å utføre denne kommandoen 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    Merk: q flagg betegner maksimal uakseptabelt Phred kvalitetspoeng, for eksempel "-q 29" filtrerer ut noen sekvenser med Phred score under 30, noe som sikrer 99,9% nøyaktighet av base samtaler.
  5. Bruke Greengenes 16S operative taksonomisk enhet (Otu) referansedatabase 26 (http://qiime.org/home_static/dataFiles.html), utføre åpen henvisning Otu plukke ved å utføre denne kommandoen 27: pick_open_reference_otus.py -i sl_out / seqs. fna -r 97_otus.fasta -o ucrss / -s 0,1
    Merk: -s flagget indikererbrøkdel av sekvenser som ikke klarte å justere til referansedatabase som skal inkluderes i de novo clustering. "-s 0,1" omfatter 10% av de mislykkede sekvensene i de novo clustering. Bruk et flagg til Parallell den Otu plukke prosessen og redusere behandlingstiden fra dager til timer hvis flere kjerner er tilgjengelige.
  6. Lag en brukervennlig taksonomisk overflod bord ved sammenslåing Otus på artsnivå ved å utføre denne kommandoen 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    Merk: Den resulterende tabellen kan lett sees i noen regneark programvare. Merk at 16S rRNA sekvensering ikke gir pålitelig artsnivå oppløsning.
  7. Bestem økologisk mangfold innen hver prøve ved å beregne flere alfa mangfold beregninger med QIIME script alpha_diversity.py. Deretter bestemmer mangfoldet mellom par av prøvene ved hjelp av QIIME script beta_diversity.py.
  8. Visualize dataene, for eksempel ved hjelp av en keiser 29 rektor koordinerer plott eller heatmap.
  9. Utfør formelle statistiske sammenligninger av tilordningsfilen kategorier, for eksempel, med QIIME er compare_catagories.py script 30.

Representative Results

Den generelle oversikt over protokollen, som gjør det mulig å bestemme relative bakterielle hopetall fra en bomullspinne ved hjelp av 16S rRNA-genet sekvensering, er vist i figur 1 sikret protokollen er optimalisert for menneske vaginale vattpinner, men kan enkelt tilpasses for de fleste slimhinneprøvetakingssteder og andre verter. Figur 2 demonstrerer den høye kvalitet DNA og RNA som kan bli isolert ved hjelp av vulsten-bankende protokoll. Figur 3 illustrerer en vellykket PCR-amplifisering av 12 prøver, hvor hver forsterkning med en prøve ga et enkelt sterkt bånd av riktig størrelse og hvert vann kontroll ga ikke et band. Figur 4 illustrerer kvantifisering av den endelige biblioteket basseng før sekvensering. Figur 5 viser en typisk sekvens kvalitetsprofil etter en enkelt-ende 300 bp MiSeq løp.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
Figur 1. Skjematisk oversikt av protokollen. Først blir nukleinsyre ekstrahert fra en kompress av perle-juling i en bufret oppløsning inneholdende fenol, kloroform og isoamylalkohol. Variabelt område 4 av 16S rRNA-genet ble deretter amplifisert fra den resulterende nukleinsyren ved anvendelse av PCR. PCR-amplikoner fra opp til hundrevis av prøver blir deretter kombinert og sekvensert på en enkelt løp. De resulterende sekvenser blir avstemt til en referansedatabase for å bestemme relative bakterielle abundances. Hele protokollen kan utføres i ca tre dager. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Høy kvalitet Nucleic Acid hentet ved hjelp av Fenol: Kloroform Bead Slo Method. (A) DNA-kvalitet, som målt ved hjelp av et spektrofotometer. En A260 / A280-forhold mellom 1,8 og 2,0 indikerer ren nukleinsyre som ikke er forurenset med fenol eller protein. (B) Etter en kolonne opprydding, kan denne protokollen gi høy kvalitet RNA, angitt med sterke 16S og 23S rRNA topper. (C) RNA degradering kan oppstå hvis prøven ikke holdes kaldt etter samlingen (under transport og lagring) eller hvis RNases er til stede under behandlingen. klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Bekreftelse på vellykket 16S rRNA Gene Amplification Bruke 515F og strek 806R Primer Set. Øverst) Gel elektroforese blir brukt til å bekrefte tilstedeværelsen av et enkelt bånd rundt 380 basepar in hver prøve som ble forsterket med mal. Fraværet av et band indikerer mislykket forsterkning; Dette er vanligvis på grunn av menneskelige feil og PCR-reaksjon fra at prøven bør gjentas. Bottom) Ingen mal (vann) kontrollene kjøres parallelt med samme primerpar bør ikke ha et band til stede. Tilstedeværelsen av et band i vannet kontroll indikerer forurensede reagenser; forkaste reagenser som kan være forurenset og re-gjøre PCR presiseringer av både malen og vann kontroll for at primerpar. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. Kvantifisering av Final Bibliotek Biljard Konsentrasjon og validering av biblioteket størrelse. Etter pooling de enkelte prøve amplikonene, the konsentrasjonen av den endelige Biljard må bestemmes. Biblioteket Bassenget må deretter fortynnes ytterligere for å oppnå en 2 nM konsentrasjon. Klikk her for å se en større versjon av dette tallet.

Figur 5
Figur 5. Representant Bar Plot av sekvensen kvalitetspoeng i hver posisjon av Les. Det er normalt at sekvensen kvalitet for å slippe etter 200 basepar, men den gjennomsnittlige kvaliteten score bør være over 30. Klikk her for å se en større versjon av denne figur.

#SampleID Barcode
LinkerPrimer
Sekvens
rcbcPrimer SampleType Utdrag
Parti
Amplification
Tallerken
Beskrivelse
#An Eksempel kartlegging filen kan finnes på: http://qiime.org/_static/Examples/File_
formater /
Eksempel_
Kartlegging_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 livmorhals~~POS=TRUNC
pinne
1 EN

Tabell 1. Kartlegging File mal. Creating en nøyaktig og grundig kartlegging filen er kritisk for vellykket gjennomføring av protokollen. Kartleggingen filen er ikke bare nødvendig for å gjennomføre QIIME, men det gjør det også mulig for forskeren å opprettholde koblingen mellom prøven strekkode og metadata, for å analysere dataene for eventuelle systematiske skjevheter (f.eks batch-til-batch variasjon), og for å fastslå interessante sammenhenger mellom metadata og bakteriepopulasjoner. En bare-bones tilordningsfilen er gitt, men brukerne oppfordres til å legge til så mange kolonner som inneholder metadata som mulig. Eksempler på ytterligere metadata for en vaginal vattpinne inkluderer deltakerens alder, dato / klokkeslett for innsamling pinne, hormonelle prevensjonstype (hvis aktuelt), seksuelt overførbare infeksjon testing resultater, etc.

suppliment 1
Supplemental fil 1. Liste over strek revers primer Sekvenser 10 Klikk her for å laste ned denne filen.

Discussion

Her beskriver vi en protokoll for identifikasjon og karakterisering av relative bakterielle abundances innenfor et menneske vaginal vattpinne. Denne protokollen kan enkelt tilpasses for andre prøvetyper, for eksempel avføring og vattpinner av andre kroppssider, og for prøver samlet inn fra en rekke kilder. Utvinning av nukleinsyre ved kule-juling i en bufret oppløsning av fenol og kloroform gir mulighet for isolering av både DNA og RNA, noe som er spesielt viktig når man arbeider med kostbare prøver innsamlet gjennom kliniske studier. Det isolerte bakterielt DNA er utmerket for bakteriell taksonomisk identifikasjon og genomisk montering, mens den samtidig samling av RNA gir mulighet for å bestemme funksjonelle bakterielle, vert, og virale bidrag gjennom RNA-seq. Den beskrevne protokollen bruker en validert ett-trinns primersett som har blitt utplassert på en lang rekke prøvetyper, inkludert menneske, hund, og miljøprøver 10

Den nukleinsyre utvinning del av denne protokollen er begrenset av sikkerhetstiltakene som kreves når du arbeider med fenol og kloroform, og utfordringene ved å automatisere rørledningen til en høy gjennomstrømming, 96-brønns plate format. I tillegg er sprek perle juling brukes for mekaniske lysesakser bakteriell DNA til ca 6 kilobase fragmenter; hvis lengre DNA-fragmenter er nødvendig for nedstrøms applikasjoner, varigheten av vulsten vibrerende should bli forkortet. Begrensningene for bakteriell identifikasjon del av denne protokollen er iboende til noen metode som er avhengig av 16S rRNA-genet sekvensering. 16S rRNA sekvensering er ideell for bakteriell identifikasjon til slekten og selv artsnivå, men sjelden gir belastning nivå identifikasjon. Mens V4 variable region av 16S rRNA-genet gir robust diskriminering blant de fleste bakteriearter 11, kan ytterligere beregningsmetoder som Oligotyping 31 må benyttes for å identifisere visse arter, som for eksempel Lactobacillus crispatus. Endelig kan informasjon om den nøyaktige bakterielle funksjonelle evner innen en bestemt prøve ikke bestemmes av 16S rRNA-genet sekvensering alene, selv om denne protokollen muliggjør uttak av hele genomet DNA og RNA som kan brukes til dette formål.

Den mest kritiske skritt for å sikre suksess med denne protokollen tar stor forsiktighet for å hindre forurensning during prøvetaking, nukleinsyre ekstraksjon og PCR-amplifikasjon. Sørg for sterilitet på tidspunktet for prøvetaking av seg rene hansker og bruker sterile kompresser, rør og saks. For å vurdere for forurensning av oppsamlingsmateriell, samle negative kontrollpensler ved å plassere ekstra ubrukte vattpinner direkte i transportrørene på tidspunktet for prøvetaking. I laboratoriet, utføre alle pre-forsterkertrinn i et sterilisert panseret som kun inneholder dekontaminert forsyninger og med bare molekylær klasse, DNA-fri reagenser. Under nukleinsyre utvinning, forhindre krysskontaminering ved hjelp av nye steril pinsett og frisk hansker med hver prøve, og holde alle rør lukket med mindre i bruk. Behandler ubrukte vattpinner parallelt sikrer sterilitet både prøvetaking og nukleinsyre utvinning; ubrukte vattpinner bør ikke gi en pellet etter isopropanol nedbør og etanol vask. Hvis en pellet vises, utfører 16S rRNA-genet forsterkning for å bestemme en mulig kilde tilforurensning (for eksempel, vil tilstedeværelsen av Streptococcus eller Staphylococcus indikere hudforurensning). I tillegg utføre PCR-amplifikasjoner uten mal kontrollreaksjoner i parallell for å sikre at PCR-reagenser og reaksjoner ikke er blitt forurenset. Hvis et band vises i en ingen mal kontroll, kast reagenser og gjenta forsterkning med ferske reagenser. Å ta disse forholdsreglene vil sikre vellykket sekvensering av bakterier av interesse.

PCR forsterkning skritt tendens til å kreve mest feilsøking. Forsterke i sett på tolv prøvene gir en balanse mellom effektivitet og konsistens. Den komplette fravær av bånd på tvers av alle prøvene i en gitt forsterkning sett indikerer en systematisk svikt, for eksempel å glemme å legge til en reagens eller feil programmering av termo. Fraværet av et band fra noen prøver er vanligvis på grunn av menneskelige feil, og de presiseringer bør re-run med samme sammenkobling av prøve og revers primer. I tilfelle av fort fravær av et bånd, kan prøven på nytt amplifisert ved å bruke en revers primer med en annen strekkode. Gjentatte forsterkningsfeil med flere reverse primere kan indikere en inhibitor til stede i prøven. I så fall vil rensing av DNA med en kolonne ofte fjerne inhibitorer uten vesentlig å endre de relative bakterielle abundances. Hvis flere bånd resultere etter forsterkning, re-forsterke prøven sammen med et annet revers primer strekkode.

I tillegg til å hindre miljøforurensning og sikre forsterkning av en enkelt bestemt produkt, avhengig vellykket sekvense om omsorg når du forbereder biblioteket bassenget. Målet er å kombinere ekvimolare mengder av hver prøve er amplikonene for å sikre tilnærmet det samme antall sekvense leser per prøve. Hvis nukleinsyresekvensene konsentrasjoner før amplifikasjon er sammenlignbare, er det bare å tilsette like volumer av hver sample er amplikonene er tilstrekkelig når du oppretter biblioteket bassenget. Men hvis nukleinsyre-konsentrasjoner er vesentlig forskjellig og tilsatt i like volum, prøven med lav nukleinsyre konsentrasjon vil bli dårlig representert med et lavt antall lesninger. I dette tilfelle er det mulig å legge til et høyere volum av amplikonene fra den lave konsentrasjon prøven basert på den relative intensitet av gelen bandet. Alternativt er det mulig å fjerne mer rigorøst primere fra de enkelte amplikonene, kvantifisere enkelt prøve største fragment konsentrasjon ved anvendelse av en fluorometrisk dsDNA kvantifisering kit, og presist kombinere ekvimolare mengder av hver prøve.

Når en velbalansert amplicon bassenget er generert, blir det avgjørende å nøye måle bassenget konsentrasjon. Etterfølgende forsiktig fortynning og spike-in med pHix å øke lese kompleksiteten er avgjørende for å oppnå optimale sekvense resultater. Høy gjennomstrømming sequencere som bruker Sekvenscing ved syntese er svært følsomme for klyngen tetthet på strømningscellen. Legge et bibliotek basseng som er for konsentrert vil resultere i overclustering, med færre kvalitetspoeng, lavere datautgang, og unøyaktig demultiplexing 32. Legge et bibliotek basseng som er for tynn vil også føre til lav datautgang. Nøye kvantifisere biblioteket bassenget før sekvensering vil sikre optimale resultater.

16S rRNA-genet sekvensering gir en helhetlig vurdering av bakteriene innenfor en gitt prøve, og er en helt avgjørende første skritt i hypotesen generasjon. Tilstedeværelsen av et rikt sett av metadata videre gjør det mulig for forskeren å teste sammenhengen mellom bestemte bakteriearter og viktige biologiske faktorer. Videre kan den samme 16S informasjonen kan brukes til å utlede den bakterielle funksjoner ved hjelp av med verktøy som PICRUSt 33. Det ultimate målet er å bruke 16S karakterisering til å identifisere nye foreninger som kan væreytterligere testet og validert i modellsystemer, og legger til vår voksende forståelse av virkningen av bakteriell mikrobiomer på menneskers helse og sykdom.

Acknowledgements

Vi vil gjerne takke Elizabeth Byrne, David Gootenberg, og Christina Gosmann for kritiske tilbakemeldinger på protokollen; Megan Baldridge, Scott Handley, Cindy Monaco, og Jason Norman for prøveopparbeidelse veiledning og demonstrasjoner; Wendy Garrett, Curtis Huttenhower, Skip Virgin, og Bruce Walker for protokollen råd og fruktbare diskusjoner; og Jessica Hoisington-Lopez for sekvensering støtte. Dette arbeidet ble støttet av Bill og Melinda Gates Foundation og NIAID (1R01AI111918). DSK fikk ekstra støtte fra Burroughs Wellcome fondet. MNA ble støttet av award nummer T32GM007753 fra NIGMS, og Paul og Daisy Soros Fellowship. Innholdet er utelukkende ansvaret til forfatterne og ikke nødvendigvis representerer den offisielle utsikt over NIGMS eller NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics