Efficient Nucleic Acid Extracción y 16S rRNA genes de secuenciación para bacteriana Comunidad Caracterización

Biology
 

Summary

Se describe un método eficiente y robusta, y rentable para la extracción de ácido nucleico a partir de hisopos para la caracterización de las comunidades bacterianas utilizando 16S rRNA secuenciación de genes de amplificación. El método permite un enfoque de procesamiento común para múltiples tipos de muestras y acomoda un número de procesos de análisis de aguas abajo.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hay un interés creciente por el papel de las comunidades microbianas como moduladores críticos de la salud humana y la enfermedad. tecnologías de secuenciación de alto rendimiento han permitido la caracterización rápida y eficiente de las comunidades bacterianas utilizando 16S rRNA secuenciación de genes de una variedad de fuentes. Aunque las herramientas fácilmente disponibles para el análisis de secuencias de ARNr 16S tienen flujos de trabajo estandarizados de cálculo, procesamiento de muestras para la extracción de ADN sigue siendo una fuente continua de la variabilidad entre los estudios. Aquí se describe un método eficiente y robusta, y rentable para la extracción de ácido nucleico a partir de hisopos. También delineamos métodos aguas abajo para la secuenciación de genes 16S rRNA, incluyendo la generación de bibliotecas de secuenciación, el control de calidad de los datos, y análisis de secuencias. El flujo de trabajo puede alojar múltiples tipos de muestras, incluyendo las heces y torundas recogidos de una variedad de ubicaciones anatómicas y especies huésped. Además, se recuperó el ADN y el ARN se puede separar y utilizarpara otras aplicaciones, incluyendo la secuenciación de todo el genoma o RNA-seq. El método descrito permite un enfoque de procesamiento común para múltiples tipos de muestras y tiene capacidad para análisis de aguas abajo de la información genómica, metagenomic y transcripcional.

Introduction

El tracto inferior humana reproductiva, sistema gastrointestinal, tracto respiratorio, la piel y son colonizados por comunidades bacterianas complejas que son críticos para el mantenimiento de la homeostasis del tejido y apoyar la salud del huésped 1. Por ejemplo, ciertos lactobacilos crear un ambiente inhóspito para los patógenos mediante la acidificación de la cúpula vaginal, la producción de efectores antimicrobianos y modulación de la inmunidad anfitrión local 2-4. El creciente reconocimiento de la importancia del microbioma bacteriana también ha aumentado el interés en la caracterización de las comunidades bacterianas en muchos contextos clínicos. Aquí se describe un método para determinar la composición de la microbiota bacteriana de hisopos genitales. El protocolo puede modificarse fácilmente para muestras de heces e hisopos recogidos de otras localizaciones anatómicas y otras especies huésped.

Debido a las limitaciones inherentes en el número de muestras que pueden ser recogidos y almacenados a partir de un determinado espárragoy participante, este protocolo se diseñó para extraer el ADN, el ARN, y, potencialmente, incluso la proteína de una sola torunda utilizando una adaptada fenol-cloroformo bead-latidos método basado en 5,6. La combinación de la interrupción física de las paredes celulares bacterianas con bead-golpeo y la alteración química con detergentes permite una rápida lisis de las bacterias Gram-positivas, Gram-negativas, y ácido-rápidos sin pasos adicionales de digestión enzimática. Para obtener ARN de alta calidad, se recomienda el uso de hisopos secos que se mantuvieron igual o inferior a 4 ° C inmediatamente después de la recolección y durante su transporte al laboratorio (si procede), y se almacena a largo plazo a -80 ° C.

Para determinar la microbiota bacteriana en una muestra dada, este procedimiento utiliza la secuencia 16S rRNA gen de amplificación, que es actualmente el medio más rentables para asignar exhaustiva taxonomía bacteriana y llevar a cabo la cuantificación relativo. Los métodos alternativos incluyen dirigidos qPCR 7, microarr personalizadaays 8, y la secuenciación de todo el genoma 9. El gen 16S rRNA contiene nueve regiones hipervariables, y no hay consenso con respecto a la región V óptima para secuenciar para estudios microbioma vaginal. Aquí se utiliza el conjunto de cebadores 515F / 806R y construimos en la tubería diseñada por Caporaso et al., 10-12. Caporaso et al. 'S conjunto de cebadores 515F / 806R permite la multiplexación de cientos de muestras en una única ejecución de secuenciación debido a la disponibilidad de miles de cebadores con código de barras validados y la compatibilidad con las plataformas de secuenciación de Illumina. A diferencia de imprimación 27F / Proyecto 338R del microbioma humano creado 13, 515F / 806R también amplifica eficazmente Bifidobacteriaceae y captura de este modo con precisión Gardnerella vaginalis, un miembro importante de la comunidad microbiana vaginal en algunas mujeres. Alternativamente, un par de cebadores 338F / 806R se ha utilizado con éxito para la pirosecuenciación de muestras vaginales 14 y un par de cebadores 515F / 926R tiene recently estén disponibles para la secuenciación de próxima generación 12.

Por último, este protocolo ofrece instrucciones básicas para llevar a cabo el análisis de 16S de amplificación usando los Insights cuantitativos en Ecología Microbiana (QIIME) paquete de software 15. La implementación exitosa de los comandos QIIME descritos aquí se obtiene una tabla que contiene las abundancias taxonómicos de bacterias para cada muestra. Muchas medidas adicionales de control de calidad, métodos de clasificación taxonómica, y pasos de análisis se pueden incorporar en el análisis, como se describe en detalle en la web QIIME (http://qiime.org/index.html). Si el análisis se llevará a cabo en un ordenador Apple, el paquete MacQIIME 16 proporciona una fácil instalación de QIIME y sus dependencias. Paquetes de software alternativos para 16S rRNA análisis de secuencias génica incluyen Mothur 17 y 18 UPARSE.

Protocol

El protocolo de estudio fue aprobado por y siguió las directrices del Comité de Ética de Investigación Biomédica de la Universidad de KwaZulu-Natal (Durban, Sudáfrica) y la Junta del Hospital General de Massachusetts de Revisión Institucional (2012P001812 / MGH; Boston, MA).

1. Extracción del total de ácidos nucleicos a partir de hisopos cervicovaginales

Nota: Realizar extracciones de ácido nucleico en grupos de 16 muestras o menos. El protocolo tal como está escrita a continuación supone muestras se procesan en grupos de 12. Si la realización de múltiples rondas de extracciones de forma seriada numerar los lotes de extracción y registrar el número de lote de extracción de cada muestra, así como otra información de la muestra (incluye metadatos, como número de identificación, la edad del participante , fecha / hora de la recogida de hisopo, el tipo de anticonceptivos hormonales, de transmisión sexual resultados de pruebas de infección, etc.) en la Tabla 1.

  1. Preparación de reactivos y campana de humos
    1. Ajustar el pH del fenol: cloroformo: alcohol isoamílico (IAA) (25: 24: 1) a pH 7,9 mediante la adición de 65 l de tampón alcalino Tris por 1 ml de fenol, agitando la mezcla durante 2 min, y permitiendo que las dos fases de separada de forma natural o por centrifugación a 10.000 xg durante 5 min a TA.
      Precaución: El fenol es tóxico por ingestión, inhalación o contacto con la piel y los ojos. No respirar los humos. Use guantes impermeables, gafas de seguridad con protección lateral, y una bata de laboratorio.
    2. Filter-esterilizar 25 ml de 20% de dodecil sulfato de sodio (SDS) mediante un filtro de 0,22 micras. Hacer alícuotas de 5 ml de SDS esterilizados.
    3. Enfriar una alícuota de 10 ml de isopropanol a -20 ° C.
    4. Preparar un tubo de talón golpes para cada sWAB a procesar pesando 0,3 g de perlas de vidrio en un tubo estéril de 2 ml que es conveniente para el batidor de perlas.
    5. Obtener hisopos tomando muestras del exocérvix con un hisopo estéril absorbente. Inmediatamente después de la recolección, colocar el hisopo en un criovial vacía y estéril, se almacena a 4 ° C durante 1 a 4 horas durante el transporte al laboratorio, y almacenar durante varios meses a -80 ° C. La transferencia de los hisopos (contenidos en tubos individuales) que se procesa para hielo húmedo.
    6. Preparar la cabina de seguridad biológica (BSC). Utilizar un BSC con un "dedal" conectado a la extracción del edificio para asegurar la eliminación adecuada de los productos químicos volátiles.
      1. Retire todo el material de la campana.
      2. Limpiar todas las superficies de la campana con lejía, seguido de un descontaminante que elimina RNasas, ADNasas, y el ADN de las superficies. Limpias todos los artículos subsiguientes introducidas en el capó el uso de cloro seguido de un descontaminante ácido nucleico, incluidos guantes. Utilice / reactivos RNasa libre de DNasa frescos, como pconsejos ipette, siempre que sea posible.
      3. Cinta de una bolsa de riesgo biológico química esterilizada a la parte trasera de la campana. Todos los residuos secos que contiene fenol o cloroformo se debe colocar en esta bolsa para su eliminación adecuada.
      4. Coloque una botella estéril en la campana para recoger residuos líquidos que contengan fenol o cloroformo.
  2. extracción con fenol-cloroformo.
    1. En la campana, a cada tubo de golpeo del talón, añadir 500 l de tampón (de la etapa 1.1.1), 210 l de 20% de dodecil sulfato de sodio, y 500 l de fenol: cloroformo: IAA (25: 24: 1, pH 7,9 ).
    2. Transferir el hisopo del vial en el transporte de tubo de bolas golpes utilizando un nuevo par de pinzas estériles. A fondo frotar la cabeza hisopo contra las paredes internas del tubo de talón latido durante al menos 30 seg. Vuelva a tapar la muestra cuando haya terminado. Si la realización de extracciones de varios hisopos, cambiar los guantes entre cada muestra.
    3. Enfriar la muestra en hielo durante al menos 10 minutos. Retire el hisopo deltalón superando tubo sujetando el mango hisopo con pinzas estériles mientras se presiona la cabeza torunda contra la pared del tubo interno usando una punta P200 limpia. Deseche los hisopos en la bolsa de residuos químicos secos. Nota: La acción "escurridor" (presionar la cabeza hisopo) liberará el líquido del hisopo absorbente y aumentar la recuperación de ácido nucleico.
    4. Se coloca el tubo de talón golpes en el batidor de bolas y homogeneizar durante 2 minutos a 4 ° C.
    5. Centrifugar el tubo latido de microesferas durante 3 min a 6.000 xg y 4 ° C para sedimentar los desechos y separar las fases acuosa y de fenol.
    6. Transferir la fase acuosa (~ 500-600 l) a un tubo estéril de 1,5 ml. Añadir un volumen igual de fenol: cloroformo: IAA. Mezclar por inversión y una breve agitación en vórtex.
    7. Centrifugar el tubo durante 5 minutos a 16.000 x g y 4 ° C.
    8. Transferir la fase acuosa a un nuevo tubo estéril de 1,5 ml. Sea conservador y no transferir material de la capa de interfase o el fenol subyacentefase. Tenga en cuenta el volumen de la fase acuosa transferida. Save la fase de fenol para la futura aislamiento de proteínas.
    9. Añadir 0,8 volumen de isopropanol y 0,1 volumen de acetato de sodio 3 M (pH 5,5). Mezclar bien mediante inversión y agitación en vórtex brevemente.
    10. Precipitar el ácido nucleico enfriando el tubo a -20 ° C durante al menos 2 horas (hasta O / N).
  3. precipitación con isopropanol y lavado con etanol
    1. Centrifugar el tubo durante 30 minutos a aproximadamente 16.000 xg y 4 ° C. Con cuidado, usar una pipeta para eliminar el sobrenadante, dejando intacto el pellet.
    2. Añadir 500 l de 100% de etanol. Desalojar el sedimento con vórtex suave o pipeteo sin tocar el pellet. Centrifugar durante 5 min a 16.000 xg y 4 ° C.
    3. desechar con cuidado el sobrenadante de etanol. Utilice una pipeta P10 para eliminar la mayor cantidad de etanol como sea posible sin perturbar el sedimento.
    4. Deje secar al aire el sedimento a temperatura ambiente durante 15 min.
    5. Resuspender el precipitado en 20 l de ultra-puro 0,1x tampón de Tris-EDTA. Dejar que la muestra se enfría en hielo durante 10 minutos y la pipeta varias veces para asegurar la resuspensión completa. Si la pastilla no se disuelve, transferir el tubo a un bloque de calor C 40 ° para un máximo de 10 min para ayudar a la disolución.
    6. Medir la concentración de ácido nucleico usando un espectrofotómetro de 19.
    7. Si se desea, el ADN separado a partir de ARN usando un kit de limpieza de la columna, siguiendo el protocolo del fabricante 20.
    8. Almacenar el ácido nucleico a -80 ° C o continuar.

2. PCR La amplificación del gen V4 región hipervariable de 16S rRNA

Nota: Realizar la amplificación por PCR en series de 12 muestras o menos para minimizar el riesgo de contaminación y de error humano. Si la realización de múltiples rondas de amplificación, en serie numerar las tandas de amplificación y registrar el número de lote de amplificación de cada muestra en la Tabla 1.

  1. preparación df los reactivos y el capó PCR
    1. Añadir la información del conjunto de la amplificación por PCR con la Tabla 1, que servirá como base del archivo de asignación en la etapa de análisis de la secuencia.
    2. Retire todo el material de una campana de PCR y limpiar las superficies internas a fondo con lejía seguido de un descontaminante, que elimina DNasas RNasas, y el ADN. Asegúrese de descontaminar todos los reactivos y pieza de equipo (por ejemplo, pipetas) antes de colocarlos en el capó. Use guantes frescos limpiados con un descontaminante ácido nucleico antes de trabajar en la campana.
    3. Si es necesario, diluir la plantilla de ácido nucleico a 50 - 100 ng / l usando agua libre de ADN y libre de nucleasas.
    4. Descongelar las alícuotas de las 5x tampón, dNTP y cebadores de alta fidelidad (HF) en el capó PCR limpio. Suavemente vortex y centrifugar todas las soluciones después de la descongelación. Para reducir al mínimo los ciclos de congelación-descongelación y el riesgo de contaminación madre, preparar alícuotas de las 5x HF tampón, dNTP y cebadores.
    5. Colocar unamesa de trabajo limpia estante más fresco para recipientes de reacción y un enfriador de placas PCR en el capó.
  2. Para la reacción PCR, preparar la mezcla maestra mediante la combinación de 15,5 l de agua ultra pura, 5 l de tampón 5x HF, 0,5 l de dNTPs, 0,5 l de cebador directo 515F, 0,75 l de 3% de DMSO, y 0,25 l de la polimerasa para cada reacción. Montar todos los componentes de reacción en el refrigerador y agregar la polimerasa pasado. Mezclar bien con la pipeta. Añadir dos muestras adicionales para el recuento de reacción cuando se prepara la mezcla maestra, para dar cuenta de errores de pipeteo.
  3. configuración de la reacción de PCR:
    Nota: Realice amplificaciones por triplicado, lo que significa cada muestra se amplifica en tres reacciones de 25 l por separado. Ejecutar un control de agua sin molde con cada par de cebadores. Trabajar con rapidez, pero con cuidado, evitando la introducción de cualquier tipo de contaminación.
    1. Etiquetar una tira de 8 pocillos con tapas y lugar individuales en un enfriador de PCR.
    2. Pipeta 90 l de mezcla maestra en el primerbien.
    3. Añadir 2 l de cebador inverso (Archivo Suplementario 1). Asegúrese de anotar cuidadosamente el código de barras cebador inverso se utiliza con cada muestra en la Tabla 1.
    4. Mezclar bien y transferir 23 l de mezcla maestra a la cuarta bien (el control sin molde).
    5. Añadir 2 l de agua a la cuarta también.
    6. Añadir 6 l de la muestra apropiada a la primera también. Mezclar bien y transferir 25 l para el segundo pozo. Cambie las puntas y transferir otros 25 l de la primera y la tercera también. Firmemente a cabo cada pozo, teniendo cuidado de no tocar el interior de los pozos o gorra en el proceso.
    7. Repita este procedimiento para cada muestra.
  4. Realizar la amplificación por PCR
    1. La transferencia de las tiras de tubos de un termociclador y ejecute el siguiente programa: 30 seg a 98 ° C, seguido por 30 ciclos de 10 segundos a 98 ° C, 30 seg a 57 ° C y 12 seg a 72 ° C, seguido de una 10 min mantienen a 72 ° C y un mantenimiento finalt 4 ° C.
    2. Realice los pasos siguientes en un banco de laboratorio limpia. girar rápidamente los tubos para recoger el líquido de las paredes. Combinar las reacciones de PCR por triplicado de cada muestra, con un volumen total de 75 l, en un tubo etiquetado estéril. transferir también 25 l de cada control sin plantilla en un tubo estéril separada. No combine amplicones de diferentes muestras todavía.
  5. Validación de éxito la amplificación por PCR de las muestras por electroforesis en gel.
    1. Preparar un gel de agarosa al 1,5% (1,5 g de agarosa en polvo en 100 ml de tampón 1x TAE) con suficientes pocillos para contener cada uno de amplificación, el control de agua, y la escalera 21.
    2. Mientras que los endurece gel (aproximadamente 30 min), preparar la muestra para la electroforesis: Añadir 1 l de colorante de carga 6x a un nuevo tubo, etiquetado. A tal tubo, añadir 5 l de la amplificación y mezclar con la pipeta.
    3. Cuando el gel se ha puesto, quitar los peines, colocar el gel en la cubeta de electroforesis, y llene el tanque con tampón TAE 1x. Para el primer pozo, añadir 5 l de escalera de ADN.
    4. Carga de 5 l de la amplicón muestra a otra así. De carga 5 l de la amplificación sin molde a un pozo separado. Continuar según sea necesario para cada muestra.
    5. Cuando todas las muestras se han cargado, deslice la tapa del tanque en su lugar y encienda la fuente de alimentación a 120 V. Deje que el gel se ejecute durante 30 - 60 min.
    6. Ver gel con luz UV.
      1. Verificar el éxito de amplificación de cada muestra por señalar una sola banda fuerte alrededor de 380 pb. Si hay una doble banda, re-amplificar la muestra con un código de barras inversa diferente (Paso 2.3). Si no hay ninguna banda en absoluto, re-amplificar la muestra utilizando el mismo código de barras inversa o un nuevo código de barras hacia atrás (paso 2.3). Si re-amplificación no tiene éxito, inhibidores de la PCR pueden estar presentes en la muestra, en cuyo caso, realizar una limpieza de ADN basada en la columna para eliminar los inhibidores de la PCR.
        Nota: El éxito de amplificación puede no ser posible si la concentración de ADN bacteriano en el omuestra iginal es insuficiente (<5 ng / l).
      2. Verificar la falta de contaminación de los reactivos al señalar la ausencia de una banda en el control sin plantilla.
    7. Almacenar los 70 l restantes de amplicón a -20 ° C. Desechar los 20 l restantes del control sin plantilla, suponiendo que no dió una banda.

3. Biblioteca Pooling y secuenciación de alto rendimiento

  1. Crear la piscina amplicón mediante la combinación de un volumen igual (2-5 l) de cada uno de amplificación en un solo tubo estéril. Si la banda de una muestra parecía particularmente débil, añadir el doble de volumen en relación con el resto de las muestras.
  2. Retire los cebadores de PCR de la piscina de amplificación utilizando un kit de PCR Clean-up, siguiendo las instrucciones del fabricante 22. Realizar la limpieza con múltiples columnas, si el volumen de la agrupación de amplificación es más de 100 l. Nota: Cada columna tiene una capacidad de 100 l.
    1. Almacenar la biblioteca a -20 & #176; C o proceder al siguiente paso.
  3. En su caso, se combinan las piscinas de amplicón sin imprimación para crear la biblioteca final. Determinar la concentración de ADN de la biblioteca usando un espectrofotómetro o un sistema fluorométrico 23. Una relación de 260/280 entre 1,8 a 2,0 es indicativo de ADN puro.
  4. Diluir la biblioteca a 20 nM. Confirmar la calidad de la biblioteca mediante la visualización de una única banda de alrededor de 400 pb usando un instrumento de electroforesis. Confirmar la concentración de la biblioteca utilizando un sistema fluorométrico 23.
  5. Realizar una dilución final 1:10 en agua para diluir la biblioteca a 2 nM. A continuación, almacenar la biblioteca a 20 ° C indefinidamente.
  6. Enviar una alícuota de la biblioteca final con los tres cebadores de secuenciación requeridos (Lea 1, 2 Lea, y el índice; véanse los cuadros de Materiales / Equipo) para ser secuenciados en un secuenciador de Illumina. Si menos de 300 muestras han sido multiplexados para la secuenciación, utilizar una gama única de 300 pares de bases de ejecución y con un índice de 12 pb o leerna MiSeq, con una concentración final de 5 biblioteca pM y un 10% desnaturalizado PhiX espiga-en. Vea los materiales complementarios de Caporaso et al. ISME J, 2012 10 para obtener instrucciones detalladas de secuenciación.

Análisis 4. Secuencia

Nota: esbozado aquí es una tubería de base para el análisis de secuencias utilizando el paquete de software QIIME 1.8.0. Para simplificar, los comandos presentados suponen que el archivo de asignación se llama mapping.txt, el índice de 12 pb leer archivo se llama index.fastq, y la secuencia de 300 pb leer archivo se llama sequences.fastq. Instalar QIIME o MacQIIME 16 y familiarizarse con los conceptos básicos de UNIX para ejecutar estas órdenes. Lea la guía completa a QIIME en:

  1. Completar el archivo de asignación para el experimento (Tabla 1). Incluyendo la mayor cantidad posible de metadatos. Nota que las muestras han sido extraídos o amplificado en el mismo lote, para determinar si hay efectos lotes.
  2. por ejemplo, mapping.txt. Validar el formato del archivo de asignación mediante la ejecución del siguiente comando: validate_mapping_file.py -m -o mapping.txt mapping_output
    Nota: Este comando utiliza la secuencia de comandos QIIME incorporada "validate_mapping_file.py" que hace una nueva carpeta, llamada "mapping_output", que contiene un archivo .html que indica los errores del archivo de mapeo, en su caso.
  3. Comprobar la calidad de la secuenciación lee usando una calidad de datos de secuencias de alto rendimiento programa de comprobación, como FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Figura 5 demuestra la calidad por la secuencia de bases que se puede esperar de una carrera exitosa.
    Nota: El secuenciador asigna a cada base nucleotídica una puntuación de calidad Phred, que corresponde a la probabilidad de que la base ha sido llamado erróneamente. Una puntuación de calidad de Phred 10 indica que hay una probabilidad del 10% que el nucleótido ha sido incorrectamente asignared, 20 indica una probabilidad de 1%, el 30 indica una probabilidad del 0,1%, y el 40 (la máxima puntuación posible) indica una probabilidad de 0,01% 24.
  4. Utilizando el archivo de asignación como una clave, demultiplexar, filtro de calidad de los datos de secuenciación, y guardar los resultados en una carpeta (en este caso, llamado "sl_out") mediante la ejecución de este comando 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b -m index.fastq mapping.txt -q 29
    Note: La bandera q denota la máxima puntuación de calidad inaceptable Phred, por ejemplo, "29-q" filtra cualquier secuencias con puntajes Phred por debajo de 30, lo que garantiza la precisión del 99,9% de las llamadas de base.
  5. Utilizando la base de datos operativa Greengenes 16S unidad taxonómica (OTU) de referencia 26 (http://qiime.org/home_static/dataFiles.html), realice una referencia abierta OTU recoger mediante la ejecución de este comando 27: pick_open_reference_otus.py -i sl_out / SEQs. Fna -r -o 97_otus.fasta ucrss / -s 0,1
    Nota: La opción -s indicala fracción de secuencias que no se suman a la base de datos de referencia que será incluida en el agrupamiento de novo. "-s 0.1" incluye el 10% de las secuencias fallidas en la agrupación de novo. Utilice la opción -a para paralelizar el proceso de selección de OTU y reducir el tiempo de procesamiento de días a horas si varios núcleos están disponibles.
  6. Crear una tabla abundancia taxonómica fácil de usar mediante la fusión de UOT a nivel de especie mediante la ejecución de este comando 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    Nota: La tabla resultante puede ser vista fácilmente en cualquier software de hoja de cálculo. Tenga en cuenta que la secuenciación del 16S rRNA no proporciona de forma fiable resolución a nivel de especie.
  7. Determinar la diversidad ecológica dentro de cada muestra mediante el cálculo de varias métricas de diversidad alfa con la secuencia de comandos alpha_diversity.py QIIME. A continuación, determinar la diversidad entre pares de muestras utilizando el script de beta_diversity.py QIIME.
  8. visualize de los datos, por ejemplo, utilizando un principal emperador 29 coordina trama o mapa de calor.
  9. Realizar comparaciones estadísticas formales de mapeo categorías de archivos, por ejemplo, con guión de compare_catagories.py QIIME 30.

Representative Results

La visión general del protocolo, que permite la determinación de abundancias relativas de bacterias usando un hisopo de 16S rRNA secuenciación de genes, se muestra en la Figura 1 .El protocolo ha sido optimizado para muestras vaginales humanos, pero se puede adaptar fácilmente para la mayoría de los sitios de muestreo de la mucosa , y otros huéspedes. la Figura 2 demuestra el ADN de alta calidad y ARN que puede ser aislado utilizando el protocolo de talones de latir. la figura 3 ilustra un éxito amplificación por PCR de 12 muestras, donde cada amplificación con una muestra dio una sola banda fuerte de la correcta tamaño y cada control de agua no dió una banda. la Figura 4 ilustra la cuantificación de la piscina última biblioteca antes de la secuenciación. Figura 5 muestra un perfil típico de secuencia de calidad después de un fin de solo 300 pb de ejecución MiSeq.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
Figura 1. Esquema general del Protocolo. Primero, el ácido nucleico se extrae de un bastoncillo por bead-golpeo en una solución tamponada que contiene fenol, cloroformo y alcohol isoamílico. región variable 4 del gen 16S rRNA se amplificó a continuación, a partir del ácido nucleico resultante usando PCR. amplicones de PCR de hasta cientos de muestras se combinan entonces y se secuencian en una única prueba. Las secuencias resultantes se hacen coincidir con una base de datos de referencia para determinar las abundancias relativas bacterianas. El protocolo completo se puede realizar en aproximadamente tres días. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. alta calidad de ácido nucleico extraído utilizando el fenol: cloroformo Bead Beating Método. (A) la calidad del ADN, como se evaluó mediante un espectrofotómetro. Una proporción A260 / A280 entre 1,8 y 2,0 indica ácido nucleico puro que no está contaminada con fenol o proteína. (B) Después de una columna de limpieza, este protocolo puede producir ARN de alta calidad, indicado por fuertes picos de 16S y 23S rRNA. (C) la degradación del ARN puede ocurrir si la muestra no se mantiene fría después de la recolección (durante el transporte y almacenamiento) o si RNasas están presentes durante el proceso. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. La confirmación de éxito de 16S rRNA gene amplificación utilizando el 515F y 806R Barcoded Primer Set. Top La electroforesis en gel) se utiliza para confirmar la presencia de una única banda de alrededor de 380 pares de bases in cada muestra que se amplificó con la plantilla. La ausencia de una banda de amplificación indica éxito; esto es por lo general debido a un error humano y la reacción PCR a partir de esa muestra se debe repetir. Inferior) n plantilla () controles de agua correr en paralelo con el mismo par de cebadores no deben tener una banda presente. La presencia de una banda en el control de agua indica reactivos contaminados; descartar los reactivos que pueden estar contaminados y volver a hacer las amplificaciones de PCR tanto del control de plantilla y agua para ese par de cebadores. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. La cuantificación de la concentración final Biblioteca piscina y Validación del tamaño de biblioteca. Después de la puesta en común de los amplificados de muestra individuales, THconcentración e de la piscina biblioteca final debe ser determinado. La piscina de la biblioteca debe entonces diluirse más para lograr una concentración de 2 nM. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5. Representante barra gráfica de los niveles de calidad de secuencia en cada posición de la lectura. Es normal que la secuencia de calidad para caer después de 200 pares de bases, pero la puntuación media de calidad debe mantenerse por encima de 30. Por favor, haga clic aquí para ver una versión más grande de esta cifra.

#SampleID Código de barras
LinkerPrimer
Secuencia
rcbcPrimer SampleType Extracción
Lote
Amplificación
Plato
Descripción
ejemplo de archivo de mapeo #an se puede encontrar en: http://qiime.org/_static/Examples/File_
formatos /
Ejemplo_
Cartografía_
archivo.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 Cervical
Torunda
1 UN

Tabla 1. Mapeo archivo de plantilla. Creating un archivo de asignación precisa y minuciosa es crítica para ejecutar con éxito el protocolo. El archivo de correlación no sólo es necesaria para la ejecución de QIIME, sino que también permite al investigador a mantener el vínculo entre el código de barras de la muestra y los metadatos, para analizar los datos de las desviaciones sistemáticas (por ejemplo, variación de lote a lote), y para determinar correlaciones interesantes entre los metadatos y las poblaciones bacterianas. Se proporciona un archivo de asignación escueto, pero los usuarios se les anima a añadir tantas columnas que contienen metadatos como sea posible. Ejemplos de metadatos adicionales para una muestra vaginal incluye del participante edad, fecha / hora de la recogida de hisopo, el tipo de anticonceptivos hormonales (en su caso), infecciones de transmisión sexual resultados de las pruebas, etc.

suppliment 1
Suplementario Archivo 1. Lista de Códigos de Barras cebador inverso Secuencias 10 Por favor, haga clic aquí para descargar este archivo.

Discussion

Aquí se describe un protocolo para la identificación y caracterización de las abundancias relativas de bacterias dentro de un hisopo vaginal humana. Este protocolo se puede adaptar fácilmente para otros tipos de muestras, tal como heces y frotis de otras partes del cuerpo, y para muestras recogidas de una amplia variedad de fuentes. La extracción de ácido nucleico por bead-golpeo en una solución tamponada de fenol y cloroformo permite el aislamiento de DNA y RNA, que es particularmente importante cuando se trabaja con muestras preciosos recogidos a través de estudios clínicos. El ADN bacteriano aislado es excelente para la identificación taxonómica de bacterias y ensamblaje genómico, mientras que la recolección simultánea de ARN ofrece la oportunidad de determinar bacteriana funcional, el huésped y virales a través de las contribuciones de RNA-seq. El protocolo descrito utiliza un conjunto validado de un solo paso de imprimación que ha sido desplegado con éxito en una amplia gama de tipos de muestras, incluyendo humano, canino, y muestras ambientales 10

La parte de extracción de ácido nucleico de este protocolo está limitado por las medidas de seguridad necesarias cuando se trabaja con fenol y cloroformo, y los desafíos de la automatización de la tubería a un alto rendimiento, formato de placa de 96 pocillos. Además, los vigorosos golpes de talón utiliza para cizallas mecánicas lisis del ADN bacteriano a aproximadamente 6 fragmentos de kilobases; si se requieren fragmentos de ADN más largos para aplicaciones posteriores, la duración del cordón latiendo should acortarse. Las limitaciones de la porción de identificación de bacterias de este protocolo son inherentes a cualquier método que se basa en la secuenciación del gen 16S rRNA. secuenciación del 16S rRNA es ideal para la identificación bacteriana a nivel de género e incluso las especies, pero rara vez proporciona la identificación a nivel de cepa. Mientras que la región variable V4 del gen 16S rRNA proporciona discriminación robusta entre la mayoría de especies bacterianas 11, pueden necesitar ser utilizado para identificar con precisión ciertas especies, tales como Lactobacillus crispatus métodos computacionales adicionales tales como oligotipificación 31. Finalmente, la información acerca de las capacidades funcionales bacterianas precisas dentro de una muestra particular no se puede determinar por secuenciación del gen 16S rRNA solo, aunque este protocolo permite la extracción de ADN de todo el genoma y ARN que puede ser utilizado para este propósito.

El paso más crítico para asegurar el éxito con este protocolo está tomando gran cuidado para evitar la contaminación during recogida de muestras, extracción de ácidos nucleicos, y la amplificación PCR. Asegure su esterilidad en el momento de la recogida de muestras con el uso de guantes limpios y el uso de hisopos estériles, tubos y tijeras. Para evaluar la contaminación de los materiales de la colección, recoger hisopos de control negativo mediante la colocación de hisopos adicionales no utilizadas directamente en tubos de transporte en el momento del muestreo. En el laboratorio, realizar todos los pasos de pre-amplificación en una campana esterilizada que contienen sólo suministros descontaminados y utilizando sólo de grado molecular, reactivos sin ADN. Durante la extracción de ácidos nucleicos, evitar la contaminación cruzada mediante el uso de las nuevas pinzas estériles y guantes nuevos con cada muestra, y el mantenimiento de todos los tubos cerrados a menos que esté en uso. El procesamiento de hisopos no utilizados en paralelo asegura la esterilidad tanto de la toma de muestras y extracción de ácidos nucleicos; los hisopos no utilizados no deben producir un sedimento después de la precipitación con isopropanol y lavado con etanol. Si aparece un sedimento, lleve a cabo la amplificación del gen 16S rRNA para determinar una posible fuente decontaminación (por ejemplo, la presencia de estreptococos o estafilococos indicaría contaminación de la piel). Además, realizar amplificaciones por PCR con reacciones de control de plantilla en paralelo para asegurar que los reactivos y las reacciones de PCR no han sido contaminados. Si aparece una banda en un control sin molde, desechar los reactivos y repetir la amplificación con reactivos frescos. Tomando estas precauciones se asegurará de secuenciación con éxito de las bacterias de interés.

La etapa de amplificación por PCR tiende a requerir más de solución de problemas. Amplificando en grupos de doce de muestras proporciona un equilibrio entre la eficiencia y la consistencia. La ausencia completa de bandas en todos las muestras en un conjunto de amplificación dado indica una falla sistemática, por ejemplo, haber olvidado agregar un reactivo o programación incorrecta el termociclador. La ausencia de una banda de unas pocas muestras es por lo general debido a un error humano, y las amplificaciones debe ser re-rONU con la misma apareamiento de muestra y cebador inverso. En el caso de ausencia continuada de una banda, la muestra puede ser re-amplificado utilizando un cebador inverso con un código de barras diferente. fallos de amplificación repetidas con múltiples cebadores inversos pueden indicar un inhibidor presente en la muestra. En ese caso, la limpieza de la DNA con una columna a menudo eliminar los inhibidores sin alterar significativamente la abundancia de bacterias relativos. Si hay varias bandas resultan después de la amplificación, re-amplificar la muestra con un código de barras cebador inverso diferente.

Además de prevenir la contaminación del medio ambiente y garantizar la amplificación de un único producto específico, la secuenciación de éxito se basa en el cuidado en la preparación de la piscina de la biblioteca. El objetivo es combinar cantidades equimolares de amplicones de cada muestra para asegurar aproximadamente el mismo número de secuenciación lee por muestra. Si las concentraciones de ácido nucleico antes de la amplificación son comparables, la simple adición de volúmenes iguales de cada saamplicones de MPLE es suficiente al crear el conjunto de la biblioteca. Sin embargo, si las concentraciones de ácido nucleico son muy diferentes y se añaden en un volumen igual, la muestra con la baja concentración de ácido nucleico estará mal representada con un bajo número de lecturas. En este caso, es posible añadir un mayor volumen de los amplicones de la muestra de baja concentración en base a la intensidad relativa de la banda de gel. Alternativamente, es posible eliminar de forma más rigurosa cebadores de los amplicones individuales, cuantificar la concentración de amplicón de muestra individual usando un kit de ADN de doble cadena cuantificación fluorométrica, y precisamente combinar cantidades equimoleculares de cada muestra.

Una vez que se genera una piscina amplicón bien equilibrado, se vuelve crítico para medir cuidadosamente la concentración de la piscina. La posterior dilución cuidadosa y con espiga-en PhiX para aumentar la complejidad de lectura es esencial para lograr resultados óptimos de secuenciación. secuenciadores de alto rendimiento que utilizan Sequencing por síntesis son muy sensibles a la densidad de clúster en la célula de flujo. Carga de una piscina de biblioteca que está demasiado concentrada dará lugar a overclustering, con niveles de calidad inferiores, menor producción de datos, y demultiplexación imprecisa 32. Carga de una piscina de biblioteca que está demasiado diluida también dará lugar a la salida de datos de baja. Con cuidado, la cuantificación de la piscina de la biblioteca antes de la secuenciación se asegurará resultados óptimos.

16S rRNA secuenciación de genes proporciona una evaluación exhaustiva de las bacterias presentes en una muestra dada y es un primer paso absolutamente crítico en la generación de hipótesis. La presencia de un rico conjunto de metadatos además permite al investigador para probar asociaciones entre especies bacterianas particulares y factores biológicos importantes. Además, el mismo 16S información puede utilizarse para inferir las funciones bacterianas usando con herramientas como PICRUSt 33. El objetivo final es utilizar 16S caracterización para identificar nuevas asociaciones que pueden sermás probado y validado en sistemas modelo, añadiendo a nuestra creciente comprensión del impacto de la microbiota bacteriana en la salud humana y la enfermedad.

Acknowledgements

Nos gustaría dar las gracias a Elizabeth Byrne, David Gootenberg, y Christina Gosmann de retroalimentación crítica en el protocolo; Megan Baldridge, Scott Handley, Cindy Mónaco, y Jason Norman como guía de preparación de muestras y demostraciones; Wendy Garrett, Curtis Huttenhower, Skip Virgen, y Bruce Walker para el consejo de protocolo y fructíferos debates; Hoisington y Jessica-López por el apoyo secuenciación. Este trabajo fue apoyado por la Fundación Bill y Melinda Gates y el NIAID (1R01AI111918). DSK recibió apoyo adicional del Fondo Burroughs Wellcome. MNA fue apoyada por varios premios T32GM007753 del NIGMS, y el Paul y Daisy Soros Fellowship. El contenido es responsabilidad exclusiva de los autores y no representa necesariamente la opinión oficial de la NIGMS oa los NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics