Efficiënte Nucleic Acid Extraction en 16S rRNA Gene Sequencing voor Bacteriële Gemeenschap karakterisering

1Ragon Institute of MGH, MIT, and Harvard, Massachusetts General Hospital
Biology
 

Summary

We beschrijven een efficiente en rendabele methode voor het extraheren van nucleïnezuur uit uitstrijkjes ter karakterisering van bacteriële 16S rRNA gen gebruiken amplicon sequencing. De methode maakt het mogelijk voor een gemeenschappelijke aanpak voor de verwerking van meerdere soorten monster en herbergt een aantal downstream-analytische processen.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Er is een groeiende waardering voor de rol van microbiële gemeenschappen als kritiek modulators van de menselijke gezondheid en ziekte. Sequenering technologieën hebben geleid tot een snelle en doeltreffende karakterisering van bacteriële gemeenschappen door 16S rRNA gensequentie uit verschillende bronnen. Hoewel gemakkelijk beschikbare instrumenten voor 16S rRNA sequentie-analyse hebben gestandaardiseerde computational workflows, monster verwerking voor DNA-extractie blijft een voortdurende bron van variabiliteit tussen studies. Hier beschrijven we een efficiente en rendabele methode voor het extraheren van nucleïnezuur uit uitstrijkjes. We bakenen ook verder werkwijzen voor 16S rRNA gensequentie, inclusief generatie sequencing bibliotheken, de kwaliteitscontrole en sequentieanalyse. De workflow is geschikt voor meerdere monsters types, inclusief kruk en zwabbers uit verschillende anatomische locaties en gastheer species. Bovendien teruggewonnen DNA en RNA kunnen worden gescheiden en gebruiktvoor andere toepassingen, met inbegrip van whole genome sequencing of RNA-seq. De beschreven methode zorgt voor een gemeenschappelijke aanpak voor de verwerking van meerdere soorten monster en is geschikt voor downstream analyse van genomische, metagenomic en transcriptie informatie.

Introduction

De menselijke lagere voortplantingsorganen, maagdarmkanaal, luchtwegen en huid worden gekoloniseerd door complexe bacteriële gemeenschappen die kritisch zijn voor het handhaven weefsel homeostase en ondersteunen van de gezondheid van de gastheer 1 zijn. Bijvoorbeeld, bepaalde lactobacilli maakt een onherbergzame omgeving voor ziekteverwekkers door aanzuren van het vaginale gewelf, het produceren van antimicrobiële effectoren en modulerende lokale host immuniteit 2-4. De groeiende waardering voor het belang van de bacteriële microbiome heeft ook toegenomen belangstelling voor het karakteriseren van bacteriële gemeenschappen in vele klinische contexten. Hier beschrijven we een werkwijze om de samenstelling van de bacteriële microbiome uit genitale swabs bepalen. Het protocol kan gemakkelijk worden aangepast voor ontlasting en uitstrijkjes verzameld van andere anatomische locaties en andere host-soorten.

Door de inherente beperkingen van het aantal monsters dat kan worden verzameld en opgeslagen door een bepaalde study deelnemer is dit protocol werd ontwikkeld om DNA, RNA en mogelijk zelfs eiwit uit een zwabber extraheren met een geschikt fenol-chloroform gebaseerde bead-methode 5,6 slaan. De combinatie van fysieke verstoring van bacteriële celwanden met kraal-beating en chemische verstoring met schoonmaakmiddelen maakt een snelle lysis van Gram-positieve, Gram-negatieve en zuurvaste bacteriën zonder bijkomende enzymatische afbraak stappen. Om hoge kwaliteit RNA te verkrijgen, is het raadzaam om gaasjes die op of onder 4 ° C werden gehouden gebruiken onmiddellijk na het verzamelen en tijdens het vervoer naar het laboratorium (indien van toepassing), en opgeslagen op lange termijn bij -80 ° C.

De bacteriële microbiome binnen een bepaald monster bepalen, deze procedure gebruikt 16S rRNA gen amplicon sequencing, die momenteel de meest kosteneffectieve manier om bacteriële taxonomie volledig toewijzen en uitvoeren relatieve kwantificatie. Alternatieve methoden omvatten gerichte qPCR 7, douane microarrays 8, en het hele genoom sequencing 9. Het 16S rRNA-gen bevat negen hypervariabele gebieden, en er bestaat geen consensus over de optimale V-gebied aan opeenvolging voor vaginale microbiome studies. Hier gebruiken we de 515F / 806R primer set en voort te bouwen op de pijpleiding ontworpen door Caporaso et al., 10-12. Caporaso et al. 'S 515F / 806R primer set maakt het multiplexen van honderden monsters op één sequencing run als gevolg van de beschikbaarheid van duizenden gevalideerde barcode primers en compatibiliteit met Illumina sequencing platforms. In tegenstelling tot de Human Microbiome Project 27F / 338R primer set 13, 515F / 806R ook effectief versterkt Bifidobacteriaceae en dus nauwkeurig vangt Gardnerella vaginalis, een belangrijk lid van de vaginale microbiële gemeenschap in sommige vrouwen. Als alternatief kan een 338F / 806R primerpaar is met succes gebruikt voor pyrosequencing vaginale monsters 14 en 515F / 926R primerpaar heeft recently voor next-generation sequencing 12 beschikbaar komen.

Tot slot, dit protocol bevat algemene instructies voor het 16S amplicon analyses uit te voeren met behulp van de kwantitatieve Inzichten in Microbiële Ecologie (QIIME) softwarepakket 15. Succesvolle implementatie van de QIIME commando's die hier beschreven levert een tabel met bacteriële taxonomische abundances voor elk monster. Vele bijkomende stappen van kwaliteitscontrole, taxonomische classificatie methoden en analyse stappen in de analyse zijn opgenomen, zoals beschreven op de website QIIME (http://qiime.org/index.html). Als de analyse zal worden uitgevoerd op een Apple-computer, de MacQIIME pakket 16 biedt eenvoudige installatie van QIIME en de afhankelijkheden. Alternatieve software pakketten voor 16S rRNA gensequentie analyse omvatten Mothur 17 en UPARSE 18.

Protocol

De studie protocol werd goedgekeurd door en volgde de richtlijnen van het Biomedical Research Ethics Committee van de Universiteit van KwaZulu-Natal (Durban, Zuid-Afrika) en het Massachusetts General Hospital Institutional Review Board (2012P001812 / MGH, Boston, MA).

1. Winning van Total nucleïnezuur uit cervicovaginal Zwabbers

Opmerking: Voer nucleïnezuur extracties in sets van 16 monsters of minder. Het protocol zoals hieronder geschreven veronderstelt monsters worden verwerkt in sets van 12. Als het uitvoeren van meerdere rondes van extracties, serieel nummer de winning partijen en nemen elk monster extractie batchnummer evenals andere monster informatie (onder andere metadata zoals de deelnemer ID-nummer, leeftijd , datum / tijd van wattenstaafje collectie, hormonale anticonceptie-type, de seksueel overdraagbare aandoening testresultaten, etc.) in tabel 1.

  1. Voorbereiding van de reagentia en zuurkast
    1. De pH van de fenol: chloroform: isoamylalcohol (IAA) (25: 24: 1) tot pH 7,9 door toevoeging van 65 pl Tris alkalische buffer per 1 ml fenol, het mengsel schudden gedurende 2 min, en waarbij de twee fasen afzonderlijk hetzij natuurlijk, hetzij door centrifugatie bij 10.000 xg gedurende 5 minuten bij kamertemperatuur.
      Let op: Fenol is giftig bij inslikken, bij inademing of bij contact met de huid en ogen. Inademen van rook vermijden. Draag ondoordringbare handschoenen, veiligheidsbril met zijschermen en een laboratoriumjas.
    2. Filter-steriliseer 25 ml 20% natriumdodecylsulfaat (SDS) door een 0,22 urn filter. Maak 5 ml porties van de gesteriliseerde SDS.
    3. Chill een 10 ml aliquot van isopropanol bij -20 ° C.
    4. Bereid een kraal pak slaag buis voor elk swab te verwerken door weging uit 0,3 g glasparels in een steriele 2 ml buis die geschikt is voor de bead beater.
    5. Verkrijgen swabs door middel van steekproeven de ectocervix met een steriel absorberend doekje. Onmiddellijk na het verzamelen, zet het staafje in een lege steriele cryovial, bewaren bij 4 ° C gedurende 1 tot 4 uur tijdens het transport naar het laboratorium, en meerdere maanden bewaren bij -80 ° C. Breng de swabs (opgenomen in de afzonderlijke buizen) om te worden verwerkt tot nat ijs.
    6. Bereid de biologische veiligheid kast (BSC). Gebruik een BSC met een "vingerhoedje" verbonden met het gebouw uitlaat goede verwijdering van vluchtige stoffen te waarborgen.
      1. Verwijder alle materialen uit de kap.
      2. Reinig alle oppervlakken van de kap met bleekmiddel, gevolgd door een ontsmettingsmiddel dat RNases, DNasen en DNA verwijdert op oppervlakken. Schoon alle volgende items gebracht in de kap bleekmiddel gevolgd door een nucleïnezuur ontsmettingsmiddel, zoals handschoenen. Gebruik verse RNase / DNase-vrije reagentia, zoals pipette tips, waar mogelijk.
      3. Tape een gesteriliseerde chemische biologisch zak aan de achterzijde van de kap. Alle droge afval dat fenol of chloroform moeten in deze zak voor de juiste beschikking gesteld worden.
      4. Plaats een steriele fles in de motorkap om vloeibaar afval dat fenol of chloroform te verzamelen.
  2. Fenol-chloroform extractie.
    1. In de kap, aan elke kraal slaan buis, voeg 500 pl buffer (uit stap 1.1.1), 210 ui 20% natriumdodecylsulfaat en 500 pl fenol: chloroform: IAA (25: 24: 1, pH 7,9 ).
    2. Breng de wattenprop het transport flacon in de kraal slaan buis met behulp van een nieuw paar steriel pincet. Grondig wrijf het wattenstaafje hoofd tegen de binnenwanden van de kraal slaan buis tenminste 30 sec. Re-cap het monster als u klaar bent. Als het uitvoeren van extracties uit meerdere swabs, veranderen handschoenen tussen elk monster.
    3. Koel het monster op ijs gedurende ten minste 10 min. Verwijder het wattenstaafje uit dekraal verslaan buis door het houden van het staafje handvat met steriel pincet terwijl u het wattenstaafje hoofd tegen de inwendige buiswand met een schone P200 tip. Gooi de doekjes in de droge chemisch afval zak. Opmerking: De "rakel" actie (het indrukken van het wattenstaafje hoofd) zal vloeistof bevrijden van de absorberende wattenstaafje en verhoging van de nucleïnezuur herstel.
    4. Plaats de kraal kloppende buis in de bead beater en gehomogeniseerd gedurende 2 minuten bij 4 ° C.
    5. Centrifugeer de kraal slaan buis 3 min bij 6000 xg en 4 ° C om vuil pelleteren en scheiden de waterige fase en fenol.
    6. Breng de waterige fase (~ 500-600 ui) in een steriele 1,5 ml buis. Voeg een gelijk volume fenol: chloroform: IAA. Meng door inversie en kort vortexen.
    7. Centrifugeer de buis gedurende 5 minuten bij 16.000 xg en 4 ° C.
    8. Breng de waterige fase naar een nieuwe steriele 1,5 ml buis. Conservatief en geen materiaal niet dragen van de interfase laag of de onderliggende fenolfase. Noteer het volume van de waterfase overgedragen. Sla de fenol fase voor toekomstige eiwit isolement.
    9. Voeg 0,8 volume isopropanol en 0,1 volume 3 M natriumacetaat (pH 5,5). Meng goed door inversie en kort vortexen.
    10. Precipiteren van het nucleïnezuur door koeling de buis bij -20 ° C gedurende ten minste 2 uur (tot O / N).
  3. Isopropanol neerslag en ethanol wassen
    1. Centrifugeer de buis gedurende 30 minuten bij ongeveer 16.000 xg en 4 ° C. Gebruik een pipet zorgvuldig de supernatant te verwijderen, waardoor de pellet intact.
    2. Voeg 500 ul 100% ethanol. Los de pellet met zachte vortexen of pipetteren zonder het aanraken van de pellet. Centrifugeer gedurende 5 minuten bij 16.000 xg en 4 ° C.
    3. gooi de ethanol supernatant voorzichtig. Gebruik een pipet P10 zoveel mogelijk ethanol te verwijderen zonder de pellet te verstoren.
    4. Lucht droog de pellet bij kamertemperatuur gedurende 15 min.
    5. Resuspendeer de pellet in 20 ul uLTRA zuiver 0,1x Tris-EDTA buffer. Laat het monster koelen op ijs gedurende 10 min en pipetteer herhaaldelijk volledige resuspensie waarborgen. Indien de pellet niet oplost, breng de buis een 40 ° C warmteblok gedurende maximaal 10 min te helpen oplossen.
    6. Meet de nucleïnezuurconcentratie met een spectrofotometer 19.
    7. Desgewenst gescheiden DNA van RNA toepassing van een kolom clean-up kit, volgens het protocol van de fabrikant 20.
    8. Bewaar het nucleïnezuur bij -80 ° C of doorgaan.

2. PCR amplificatie van het 16S rRNA gen V4 hypervariabele gebied

Opmerking: Voer de PCR amplificatie in sets van 12 monsters of minder om het risico op contaminatie en menselijke fouten te minimaliseren. Als uitvoeren van meerdere ronden van amplificatie serieel nummer de amplificatie batches en nemen elk monster amplificatie batchnummer in tabel 1.

  1. voorbereiding of de reagentia en de PCR-afzuigkap
    1. Voeg de PCR amplificatie bedoelde informatie tabel 1, die als basis voor het toewijzingsbestand op sequentieanalyse fase dient.
    2. Verwijder alle materialen uit een PCR-kap en reinig de inwendige oppervlakken grondig met bleekwater, gevolgd door een ontsmettingsmiddel dat RNases, DNasen en DNA verwijdert. Zorg ervoor dat elke reagens en stuk van apparatuur (bijvoorbeeld pipetten) ontsmetten voordat u ze in de motorkap. Draag handschoenen vers gereinigd met een nucleïnezuur decontaminant aanvang van de werkzaamheden in de kap.
    3. Indien nodig verdunnen nucleïnezuurmatrijs tot 50 - 100 ng / ul met behulp van DNA-vrij en nuclease-vrij water.
    4. Dooi hoeveelheden van de 5x high-fidelity (HF) buffer, dNTPs en primers in de schone PCR motorkap. Voorzichtig vortex en centrifugeer alle oplossingen na ontdooien. Om vries-dooicycli en het risico van een besmetting te minimaliseren, aliquots van de HF 5x buffer, dNTPs en primers.
    5. Plaats eenclean benchtop koeler rek voor microcentrifuge buizen en een PCR-plaat koeler in de kap.
  2. Voor PCR reactie, bereidt de master mix door het combineren van 15,5 ui ultrazuiver water, 5 pl 5x HF-buffer, 0,5 pl dNTP's, 0,5 gl 515F voorwaartse primer, 0,75 gl 3% DMSO en 0,25 pl polymerase voor elke reactie. Verzamel alle reactie componenten in de koeler en voeg de polymerase laatste. Meng goed door pipetteren. Voeg twee extra monsters om de reactie te tellen bij de voorbereiding van de master mix, om rekening te houden pipetteren fouten.
  3. PCR reactie setup:
    Opmerking: Voer amplificaties in drievoud, wat betekent dat elk monster wordt versterkt in drie afzonderlijke 25 ul reacties. Voer een no-template water control met elke primer paar. Werk snel maar zorgvuldig, het vermijden van de invoering van elke vorm van verontreiniging.
    1. Label een 8-well strip met individuele caps en plaats in een PCR-koeler.
    2. Pipetteer 90 ul van master mix in de eerstegoed.
    3. Voeg 2 ul van de reverse primer (Supplemental File 1). Zorg ervoor dat u zorgvuldig let op de reverse primer barcode gebruikt met elk monster in tabel 1.
    4. Meng goed en breng 23 ul van master mix naar de vierde bron (de no-template controle).
    5. Voeg 2 ul water aan de vierde put.
    6. Voeg 6 ul van de juiste monster op de eerste ook. Meng goed en breng 25 ul naar de tweede put. tips veranderingen en dragen een 25 gl van de eerste en de derde put. Stevig cap elke goed, zorg ervoor dat niet aan de binnenkant van de putten of pet in het proces te raken.
    7. Herhaal dit voor elk monster.
  4. Voer PCR amplificatie
    1. Breng de strip buizen een thermocycler en het volgende programma: 30 sec bij 98 ° C, gevolgd door 30 cycli van 10 sec bij 98 ° C, 30 sec bij 57 ° C en 12 sec bij 72 ° C, gevolgd door een 10 minuten houden op 72 ° C en een Eindhandhavingstijdt 4 ° C.
    2. Voer de volgende stappen uit op een schone lab bench. Snel draaien de buizen om vloeistof op te vangen van de muren. Combineer drievoud PCR reacties van elk monster, met een totaal volume van 75 pi, in een steriele gelabelde buis. Ook de overdracht 25 ul van elk no-template controle in een aparte steriele buis. Nog niet amplicons van verschillende monsters te combineren.
  5. Validatie van succesvolle PCR amplificatie monsters door gelelektroforese.
    1. Bereid een 1,5% agarosegel (1,5 g agarose poeder in 100 ml 1x TAE buffer) met voldoende putten elke amplicon, water control, en ladder 21 te houden.
    2. Terwijl de gel hardt (ongeveer 30 min), voorbereiding van het monster voor elektroforese Voeg 1 ul van 6x laden kleurstof een nieuwe, gemerkte buis. Dat buis, voeg 5 ul van het amplicon en meng door pipetteren.
    3. Wanneer de gel heeft ingesteld, verwijdert u het kammen, plaatst u de gel in de elektroforese tank en vul de tank met 1x TAE buffer. Om de eerste goed, voeg 5 ul van DNA ladder.
    4. Belasting 5 pi van het monster amplicon naar een andere put. Belasting 5 pi van de niet-matrijs amplicon een aparte goed. Ga verder als nodig is voor elk monster.
    5. Wanneer alle monsters zijn geladen, schuift u de tank deksel op zijn plaats en zet de krachtbron tot 120 V. Laat de gel te lopen voor 30 - 60 min.
    6. Bekijk hier de gel onder UV-licht.
      1. Controleer succesvolle versterking van elk monster door op te merken een sterke band rond 380 bp. Als er een dubbele band, re-versterken van het monster met een andere reverse barcode (Stap 2.3). Als er geen band helemaal, opnieuw amplificeren van het monster met behulp van dezelfde omgekeerde barcode of een nieuwe reverse barcode (stap 2,3). Als re-amplificatie is mislukt, kunnen PCR remmers aanwezig zijn in het monster, in welk geval het uitvoeren van een kolom gebaseerde DNA cleanup aan PCR remmers verwijderen.
        Opmerking: Succesvolle amplificatie niet mogelijk als het bacteriële DNA-concentratie in de ofiginal monster onvoldoende (<5 ng / ul).
      2. Controleer de reagenstekort besmetting met het vaststellen van de afwezigheid van een band in de niet-mal controle.
    7. Bewaar de resterende 70 pl amplicon bij -20 ° C. Gooi de resterende 20 ul van de no-template controle, ervan uitgaande dat het niet een band opleveren.

3. Bibliotheek Pooling en High-throughput sequencing

  1. Maak de amplicon zwembad met een gelijk volume combineren (2-5 pi) van elk amplicon in een enkele steriele buis. Indien de band uit een monster leek bijzonder zwak, voeg tweemaal het volume ten opzichte van de rest van de monsters.
  2. Verwijder de PCR primers van de amplicon zwembad met een PCR Clean-up kit volgens de instructies van de fabrikant 22. Voer de sanering met meerdere kolommen of de amplicon zwembad volume groter is dan 100 pl. Let op: Elke kolom heeft een 100 pl capaciteit.
    1. Bewaar de bibliotheek bij -20 & #176, C of doorgaan naar de volgende stap.
  3. Eventueel combineren de primer-vrije amplicon pools de uiteindelijke bibliotheek te maken. Bepaal de DNA concentratie van de bibliotheek met behulp van een spectrofotometer of fluorometrische systeem 23. Een 260/280 verhouding tussen 1,8-2,0 wijst op zuiver DNA.
  4. Verdun de bibliotheek 20 nM. Bevestigen de kwaliteit van de bibliotheek door visualiseren van een enkele band ongeveer 400 bp met behulp van een elektroforese instrument. Bevestigen de concentratie van de bibliotheek met behulp van een fluorometrische systeem 23.
  5. Voer een uiteindelijke 1:10 verdunning in water om de bibliotheek te verdunnen tot 2 Nm. Vervolgens Bewaar de bibliotheek bij 20 ° C oneindig.
  6. Stuur een hoeveelheid van de uiteindelijke bibliotheek met de drie vereiste sequencing primers (schrijf 1, Lees 2 en index, tabellen of Materials / Equipment) te sequeneren op Illumina sequencer. Als er minder dan 300 monsters zijn gemultiplext voor sequencing, gebruik maken van een single-end 300 bp lopen en met een 12 bp index lezen ona MiSeq, met een definitieve bibliotheek concentratie van 5:00 en een 10% gedenatureerde PhiX spike-in. Zie de aanvullende materialen van Caporaso et al. ISME J, 2012 10 voor gedetailleerde instructies sequencing.

4. Sequence Analysis

Let op: hier geschetste is een fundamenteel pijpleiding voor sequentie-analyse met behulp van de QIIME 1.8.0 softwarepakket. Voor de eenvoud, de verstrekte opdrachten aannemen dat de mapping bestand heet mapping.txt, de 12 bp index lezen bestand heet index.fastq, en de 300 bp sequencing lezen bestand heet sequences.fastq. Installeer QIIME of MacQIIME 16 en vertrouwd te maken met de basisprincipes van UNIX om deze opdrachten uit te voeren. Lees de complete gids voor QIIME bij:

  1. Vul het toewijzingsbestand het experiment (tabel 1). Sluiten zoveel mogelijk metadata. Let op welke monsters zijn gewonnen of versterkt in dezelfde batch, om vast te stellen of er sprake is batch-effecten.
  2. bijvoorbeeld mapping.txt. Valideren van de opmaak van de mapping file door het uitvoeren van het volgende commando: validate_mapping_file.py -m mapping.txt -o mapping_output
    Opmerking: Deze opdracht maakt gebruik van de ingebouwde "validate_mapping_file.py" QIIME script dat een nieuwe map, genaamd "mapping_output" maakt, met daarin een HTML-bestand met vermelding van de mapping-bestand fouten, indien aanwezig.
  3. Controleer de kwaliteit van de sequencing leest met behulp van een high-throughput-sequentie data kwaliteitscontrole programma, zoals FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Figuur 5 toont de per basensequentie kwaliteit die kunnen worden verwacht van een succesvolle run.
    Opmerking: De sequencer wijst elk nucleotide base een Phred kwaliteit score die overeenkomt met de waarschijnlijkheid dat de basis ten onrechte is genoemd. Een Phred kwaliteit score van 10 geeft aan dat er een kans van 10% dat de nucleotide verkeerd is geweest toewijzened, 20 duidt op een kans van 1%, 30 duidt op een kans van 0,1%, en 40 (de hoogst mogelijke score) geeft een kans van 0,01% 24.
  4. Met behulp van de mapping bestand als een sleutel, demultiplex, kwaliteit filter instellen voor het sequencing data, en de resultaten opslaan in een map (in dit geval, de zogenaamde "sl_out") door het uitvoeren van dit commando 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    Opmerking: De q vlag geeft de maximale onaanvaardbare Phred kwaliteit score, bijvoorbeeld, "q 29" filtert elke sequenties met Phred scores lager dan 30, zorgen voor 99,9% nauwkeurigheid van de basis gesprekken.
  5. Met behulp van de Greengenes 16S operationele taxonomische eenheid (OTU) referentiedatabank 26 (http://qiime.org/home_static/dataFiles.html), het uitvoeren van open verwijzing OTU plukken door het uitvoeren van dit commando 27: pick_open_reference_otus.py -i sl_out / seq. fna -r 97_otus.fasta -o ucrss / -s 0,1
    Opmerking: de -s vlag geeftde fractie van sequenties die niet aan te passen aan het referentiedatabase die worden opgenomen in de de novo clustering. "-s 0,1" omvat 10% van de mislukte sequenties in de de novo clustering. Gebruik de -a vlag om de OTU picking-proces in parallel en vermindering van de doorlooptijd van dagen naar uren als er meerdere cores beschikbaar zijn.
  6. Maak een gebruiksvriendelijke taxonomische overvloed tafel door het samenvoegen van OTU de soortnaam worden door het uitvoeren van dit commando 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / L 7
    Opmerking: De resulterende tabel kan gemakkelijk worden bekeken in een spreadsheet software. Merk op dat 16S rRNA sequencing niet op betrouwbare wijze te voorzien soort niveau resolutie.
  7. Bepaal de ecologische diversiteit binnen elk monster door het berekenen van een aantal alpha diversiteit metrics met de QIIME script alpha_diversity.py. Vervolgens bepalen de diversiteit tussen paren van monsters met behulp van de QIIME script beta_diversity.py.
  8. Visualize de gegevens, bijvoorbeeld door het gebruik van een keizer 29 principal coördineert plot of heatmap.
  9. Voer formele statistische vergelijkingen van mapping categorieën bestand, bijvoorbeeld met QIIME's compare_catagories.py script 30.

Representative Results

De algemeen overzicht van het protocol, dat het bepalen van de relatieve bacteriële abundanties van een uitstrijkje gebruik 16S rRNA gensequentie maakt, wordt weergegeven in figuur 1 .De protocol is geoptimaliseerd voor menselijke vaginale uitstrijkjes, maar kan gemakkelijk worden aangepast voor de meeste mucosale bemonsteringsplaatsen en andere gastheren. Figuur 2 toont de hoge-kwaliteit DNA en RNA dat geïsoleerd kan worden met de kraal-beating protocol. Figuur 3 illustreert een succesvolle PCR amplificatie van 12 monsters, waarbij elke amplificatie met een monster gaf een sterke band van de juiste grootte en elke watercontrole heeft een band niet op. Figuur 4 toont de kwantificering van de uiteindelijke bibliotheekverzameling voorafgaand aan sequencing. Figuur 5 toont een typische sequentie kwaliteitsprofiel na één einde 300 bp MiSeq run.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
Figuur 1. Schematische weergave van het protocol. Eerst wordt nucleïnezuur geëxtraheerd uit een uitstrijkje van kraalvormige slaan in een gebufferde oplossing met fenol, chloroform en isoamylalcohol. Variabel gebied 4 van het 16S rRNA-gen wordt vervolgens geamplificeerd uit de resulterende nucleïnezuur met PCR. PCR amplicons van maximaal honderden monsters worden vervolgens samengevoegd en de sequentie op een enkele run. De resulterende sequenties worden gekoppeld aan een referentiedatabank relatieve bacteriële abundanties bepalen. De gehele protocol kan worden uitgevoerd in ongeveer drie dagen. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. Hoogwaardige nucleïnezuur extractie met behulp van de fenol: chloroform Bead Beating Methode. (A) DNA kwaliteit, zoals bepaald met een spectrofotometer. Een A260 / A280-verhouding tussen 1,8 en 2,0 geeft zuiver nucleïnezuur dat niet is verontreinigd met fenol of eiwit. (B) Na een kolom clean-up, kan dit protocol hoogwaardige RNA verkregen, aangegeven met sterke 16S en 23S rRNA pieken. (C) RNA afbraak kan optreden als het monster niet koud na de inzameling (tijdens transport en opslag) wordt gehouden of indien RNases tijdens de verwerking aanwezig zijn. klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3. Bevestiging van succesvolle 16S rRNA Gene Amplification Met behulp van de 515F en streepjescode 806R Primer Set. Geplaatst) Gelelektroforese wordt gebruikt om de aanwezigheid van een enkele band rond 380 basenparen bevestigen in ieder monster dat werd versterkt met sjabloon. Het ontbreken van een band geeft mislukte amplificatie; Dit wordt meestal veroorzaakt door menselijke fouten en de PCR-reactie van die steekproef te herhalen. Onder) nr template (water) controles parallel met hetzelfde primerpaar mag geen band aanwezig. De aanwezigheid van een band in het water controle geeft verontreinigde reagentia; gooi de reagentia die kunnen worden besmet en opnieuw te doen van de PCR amplificaties van zowel de template en water controle voor die primerpaar. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4. Kwantificering van de Final Library Pool Concentratie en Validatie van de bibliotheek Size. Na het bundelen van de afzonderlijke monster amplicons, the concentratie van de uiteindelijke bibliotheek pool worden bepaald. De bibliotheek zwembad moet dan verder worden verdund tot een 2 nM concentratie te bereiken. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 5
Figuur 5. Representatieve Bar Plot van de Sequence kwaliteitsscores op elke positie van het lezen. Het is normaal dat de sequentie kwaliteit te dalen na 200 basenparen, maar de gemiddelde kwaliteitsscore moet boven 30. blijven Klik hier om een grotere versie te bekijken van dit cijfer.

#SampleID Barcode
LinkerPrimer
Volgorde
rcbcPrimer SampleType Extraction
Partij
versterking
Bord
Beschrijving
#An Bijvoorbeeld mapping-bestand is te vinden op: http://qiime.org/_static/Examples/File_
formaten /
Voorbeeld_
Mapping_
file.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 hals-
zwabber
1 EEN

Tabel 1. Mapping Template File. Creating een nauwkeurige en grondige mapping file is van cruciaal belang voor het succesvol uitvoeren van het protocol. Het in kaart brengen bestand is niet alleen nodig voor het uitvoeren van QIIME, maar het maakt het ook mogelijk de onderzoeker om de koppeling tussen het monster barcode en metadata te behouden, om de gegevens voor een systematische fouten (bijvoorbeeld batch-to-batch variatie) te analyseren, en om te bepalen interessante correlaties tussen de metadata en bacteriële populaties. Een kale mapping bestand wordt geleverd, maar gebruikers worden aangemoedigd om zoveel mogelijk kolommen met metadata mogelijk toe te voegen. Voorbeelden van extra metadata voor een vaginale uitstrijkje omvat de deelnemer de leeftijd, de datum / tijd van wattenstaafje collectie, hormonale soort anticonceptiemiddel (indien van toepassing), seksueel overdraagbare infectie testresultaten, enz.

suppliment 1
Aanvullende File 1. Lijst van de streepjescode Reverse Primer Sequences 10 Klik hier om dit bestand te downloaden.

Discussion

Hier beschrijven we een protocol voor de identificatie en karakterisering van de relatieve bacteriële abundanties binnen een menselijke vaginale uitstrijkje. Dit protocol kan gemakkelijk worden aangepast voor andere soorten monsters zoals ontlasting en uitstrijkjes van andere lichaamsplaatsen, en monsters uit diverse bronnen. De extractie van nucleïnezuur door kraalvormige slaan in een gebufferde oplossing van fenol en chloroform maakt isolatie van zowel DNA als RNA, wat bijzonder belangrijk is bij het werken met edele monsters door middel van klinische studies. De geïsoleerde bacterieel DNA is uitstekend geschikt voor bacteriële taxonomische identificatie en genoom assemblage, terwijl de gelijktijdige verzameling van RNA biedt de mogelijkheid om functionele bacteriële, host en virale bijdragen te bepalen door middel van RNA-seq. De beschreven protocol maakt gebruik van een gevalideerde in één stap primer set die met succes heeft ingezet op een breed scala aan soorten monsters, met inbegrip van de mens, honden, en milieu-monsters 10

Nucleïnezuur extractie deel van dit protocol wordt beperkt door de veiligheidsmaatregelen vereist het werken met fenol en chloroform, en de uitdagingen van het automatiseren van de pijpleiding naar een high-throughput, 96-well plaat formaat. Bovendien, de krachtige kraal slaan voor mechanische lysis shears het bacteriële DNA tot ongeveer 6 kilobase fragmenten; bij langere DNA-fragmenten nodig zijn voor verdere toepassingen, de duur van korrel s slaanhould worden ingekort. De beperkingen van de bacteriële identificatie deel van dit protocol zijn inherent aan een methode die is gebaseerd op 16S rRNA gensequentie. 16S rRNA sequencing is ideaal voor bacteriële identificatie tot het geslacht en zelfs species niveau, maar biedt zelden stamniveau identificatie. Terwijl de V4 variabele gebied van het 16S rRNA gen verschaft robuuste discriminatie tussen meeste bacteriesoorten 11, moet additionele rekentechnieken zoals Oligotyping 31 worden gebruikt om bepaalde soorten, zoals Lactobacillus crispatus nauwkeurig te identificeren. Tenslotte kan informatie over de precieze bacteriële functionele mogelijkheden in een bepaald monster niet bepaald 16S rRNA gen sequencing alleen, hoewel dit protocol laat extractie van geheel genoom DNA en RNA die kunnen worden aangewend voor dit doel.

De meest kritische stap om ervoor te zorgen succes met dit protocol is het nemen van grote zorg om besmetting te voorkomen during monstername, nucleïnezuur extractie en PCR-amplificatie. Zorg ervoor dat de steriliteit op het moment van monstername door het dragen van schone handschoenen en het gebruik van steriele wattenstaafjes, buizen, en schaar. Om te bepalen voor besmetting van de collectie materialen, het verzamelen van negatieve controle swabs door het plaatsen van extra ongebruikte swabs direct in transportbuizen op het moment van de bemonstering. In het laboratorium, voeren alle pre-amplificatie stappen in een steriele kap met alleen ontsmet levert die alleen met moleculair-biologische kwaliteit, DNA-vrije reagentia. Tijdens nucleïnezuur extractie, te voorkomen dat kruisbesmetting door het gebruik van nieuwe steriel pincet en verse handschoenen met elk monster, en het houden van alle buizen afgesloten, tenzij in gebruik. Het verwerken van ongebruikte swabs parallel verzekert steriliteit van zowel de monstername en nucleïnezuur extractie; de ongebruikte swabs mag geen pellet na isopropanol neerslag en ethanol wassen opleveren. Als een pellet wordt weergegeven, voert 16S rRNA genamplificatie een mogelijke bron van vastde verontreiniging (bv zou de aanwezigheid van Streptococcus of Staphylococcus verontreiniging van de huid aan te geven). Bovendien voeren PCR amplificaties zonder matrijs controlereacties parallel zodat de PCR-reagentia en reacties zijn niet besmet. Als een band verschijnt in een no-template controle, gooi de reagentia en herhaal de versterking met verse reagentia. Rekening houdend met deze voorzorgsmaatregelen zal zorgen voor een succesvolle sequencing van de bacteriën van belang.

De PCR-amplificatiestap neigt de probleemoplossing vereist. Amplificeren in sets van twaalf bemonsteringen verschaft een evenwicht tussen efficiëntie en consistentie. De volledige afwezigheid van bands in alle monsters in een bepaalde versterking set geeft een systematisch falen, bijvoorbeeld, vergeten om een reagens toe te voegen of onjuist programmeren van de thermocycler. Het ontbreken van een band van een paar monsters is meestal te wijten aan menselijke fouten, en de amplificaties opnieuw moet worden run met dezelfde koppeling van monster en reverse primer. Bij blijvende afwezigheid van een band, het monster kan opnieuw geamplificeerd onder toepassing van een reverse primer met een andere barcode. Herhaalde amplificatie storingen met meerdere omgekeerde primers kunnen een remmer in het monster aan te geven. In dat geval, het schoonmaken van het DNA met een kolom vaak inhibitoren verwijderen zonder noemenswaardige verandering relatieve bacteriële abundanties. Als meerdere banden resultaat na amplificatie, opnieuw amplificeren van het monster met een andere reverse primer barcode.

Naast het voorkomen van milieuverontreiniging en zorgen voor amplificatie van één specifiek product, succesvol sequentiebepaling voert bij het gereedmaken van de bibliotheek pool. Het doel is om equimolaire hoeveelheden van elk monster amplicons combineren om te waarborgen ongeveer hetzelfde aantal sequentiebepaling leest per monster. Indien het nucleïnezuur concentraties voorafgaand aan amplificatie vergelijkbaar, simpelweg toevoegen gelijke volumina elk sample's amplicons voldoende is bij het maken van de bibliotheek zwembad. Indien het nucleïnezuur concentraties enorm verschillend en toegevoegd gelijk volume van het monster met de lage nucleïnezuurconcentratie slecht wordt afgebeeld met een klein aantal leest. In dit geval is het mogelijk om een ​​groter volume van de amplicons toevoegen in de lage concentratie van het monster op de relatieve intensiteit van de gelband. Als alternatief is het mogelijk om strikter primers uit het individu amplicons gekwantificeerd amplicon concentratie individueel monster met behulp van een fluorometrische dsDNA kwantificering kit en juist combineren equimolaire hoeveelheden van elk monster.

Zodra een goed uitgebalanceerde amplicon zwembad is gegenereerd, wordt het van cruciaal belang om zorgvuldig te meten concentratie van het zwembad. Daaropvolgende zorgvuldige verdunning en spike-met PhiX stijgen de lees complexiteit is essentieel voor het bereiken van optimale resultaten sequencing. High-throughput sequencers die sequen gebruikencing door synthese zijn zeer gevoelig voor de cluster dichtheid van de stroomcel. Het laden van een bibliotheek zwembad dat ook is geconcentreerd zal resulteren in overclustering, met een lagere kwaliteit scores, lagere data-uitgang, en onnauwkeurig demultiplexing 32. Het laden van een bibliotheek zwembad dat ook wordt verdund zal ook resulteren in een lage data-uitgang. Zorgvuldig het kwantificeren van de bibliotheek zwembad voorafgaand aan de sequencing zal zorgen voor een optimaal resultaat.

16S rRNA gen sequencing biedt een uitgebreide evaluatie van de huidige binnen een bepaald monster bacteriën en is absoluut een belangrijke eerste stap in de hypothese generatie. De aanwezigheid van een rijke set van metadata verder stelt de onderzoeker om associaties tussen bepaalde soorten bacteriën en belangrijke biologische factoren te testen. Bovendien kan dezelfde 16S informatie gebruikt worden om de bacteriële functies gebruikt met hulpmiddelen zoals PICRUSt 33 afleiden. Het uiteindelijke doel is 16S karakterisering gebruiken om nieuwe associaties die te identificerenverder getest en gevalideerd in modelsystemen, toe te voegen aan onze groeiende inzicht in de effecten van de bacteriële microbiome op de menselijke gezondheid en ziekte.

Acknowledgements

We willen graag Elizabeth Byrne, David Gootenberg en Christina Gosmann bedanken voor kritische feedback op het protocol; Megan Baldridge, Scott Handley, Cindy Monaco, en Jason Norman voor de monstervoorbereiding begeleiding en demonstraties; Wendy Garrett, Curtis Huttenhower, Skip Virgin, en Bruce Walker protocol advies en vruchtbare gesprekken; en Jessica Hoisington-Lopez voor sequencing ondersteuning. Dit werk werd ondersteund door de Bill en Melinda Gates Foundation en de NIAID (1R01AI111918). DSK kreeg extra steun van de Burroughs Wellcome Fonds. MNA werd ondersteund door award nummer T32GM007753 uit de NIGMS, en het Paul en Daisy Soros Fellowship. De inhoud is uitsluitend de verantwoordelijkheid van de auteurs en niet noodzakelijkerwijs het officiële standpunt van de NIGMS of de NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics