L'extraction d'acide nucléique et efficace de l'ARNr 16S bactérien pour Séquençage génique communautaire Caractérisation

1Ragon Institute of MGH, MIT, and Harvard, Massachusetts General Hospital
Biology
 

Summary

Nous décrivons une méthode efficace, robuste et rentable pour extraire l'acide nucléique à partir des prélèvements pour la caractérisation des communautés bactériennes en utilisant ARNr 16S séquençage de l'amplicon du gène. La méthode permet une approche de traitement commun pour les types d'échantillons multiples et peut accueillir un certain nombre de processus d'analyse en aval.

Cite this Article

Copy Citation | Download Citations

Anahtar, M. N., Bowman, B. A., Kwon, D. S. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization. J. Vis. Exp. (110), e53939, doi:10.3791/53939 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Il y a une prise de conscience croissante du rôle des communautés microbiennes en tant que modulateurs critiques de la santé humaine et la maladie. technologies de séquençage à haut débit ont permis la caractérisation rapide et efficace des populations bactériennes en utilisant le séquençage de l'ARNr 16S des gènes à partir d'une variété de sources. Bien que les outils facilement disponibles pour l'analyse de séquence ARNr 16S ont des flux de travail de calcul normalisées, le traitement des échantillons d'extraction d'ADN reste une source continue de la variabilité entre les études. Nous décrivons ici une méthode efficace, robuste et rentable pour extraire l'acide nucléique à partir des prélèvements. Nous délimiter également des procédés en aval pour le séquençage du gène 16S ARNr, y compris la génération de bibliothèques de séquençage, le contrôle de la qualité des données et l'analyse des séquences. Le flux de travail peut accueillir des échantillons multiples types, y compris les selles et les écouvillons collectés à partir d'une variété d'emplacements anatomiques et les espèces hôtes. En outre, récupéré ADN et l'ARN peut être séparé et utilisépour d'autres applications, y compris le séquençage du génome entier ou de l'ARN-seq. La méthode décrite permet une approche de traitement commun pour les types d'échantillons multiples et accueille l'analyse en aval de l'information génomique, métagénomique et de la transcription.

Introduction

Le tube humain faible reproduction, système gastro - intestinal, les voies respiratoires et la peau sont colonisées par des communautés bactériennes complexes qui sont essentielles pour le maintien de l' homéostasie tissulaire et en soutenant la santé de l'hôte 1. Par exemple, certains lactobacilles créer un environnement inhospitalier pour les agents pathogènes , en acidifiant la voûte vaginale, produisant effecteurs antimicrobiens et la modulation de l' immunité d'hôte local 2-4. L'appréciation croissante de l'importance du microbiome bactérien a également accru l'intérêt pour la caractérisation des communautés bactériennes dans de nombreux contextes cliniques. Nous décrivons ici une méthode pour déterminer la composition du microbiome bactérienne des frottis génitaux. Le protocole peut être facilement modifié pour les échantillons de selles et des prélèvements provenant d'autres emplacements anatomiques et d'autres espèces hôtes.

En raison des limites inhérentes au nombre d'échantillons qui peuvent être collectées et stockées à partir d'un plot donnéy participant, ce protocole a été conçu pour extraire l' ADN, l' ARN, et peut -être même protéine à partir d' un tampon en utilisant une adaptation du phénol-chloroforme bourrelet raclée méthode basée sur 5,6. La combinaison de la perturbation physique des parois des cellules bactériennes avec un bourrelet de battage et de perturbation chimique avec des détergents permet la lyse rapide des bactéries Gram-positives, Gram-négatives, et acidorésistants sans étapes supplémentaires de digestion enzymatique. Afin d'obtenir l'ARN de haute qualité, il est recommandé d'utiliser des tampons secs qui ont été conservés au niveau ou en dessous de 4 ° C immédiatement après le prélèvement et pendant le transport au laboratoire (le cas échéant), et à long terme conservés à -80 ° C.

Pour déterminer le microbiome bactérien dans un échantillon donné, cette procédure utilise ARNr 16S séquençage de l'amplicon du gène, qui est actuellement le moyen le plus rentable pour affecter globalement la taxonomie bactérienne et effectuer une quantification relative. Les méthodes alternatives incluent qPCR 7 ciblés, microarr personnaliséays 8, et l' ensemble du séquençage du génome 9. Le gène ARNr 16S contient neuf régions hypervariables, et il n'y a pas de consensus sur la région optimale de V à la séquence pour les études sur le microbiome vaginal. Ici , nous utilisons l'ensemble d' amorces 515F / 806R et de construire sur le pipeline conçu par Caporaso et al. , 10-12. Caporaso et al 's. 515F / 806R ensemble d' amorces permet le multiplexage de centaines d'échantillons sur un seul passage de séquençage en raison de la disponibilité de milliers d'amorces validées code - barres et la compatibilité avec les plates - formes de séquençage Illumina. Contrairement à 27F / 338R l'amorce du projet microbiome humain défini 13, 515F / 806R amplifie aussi efficacement Bifidobacteriaceae et capture ainsi précisément Gardnerella vaginalis, un membre important de la communauté microbienne vaginale chez certaines femmes. En variante, une paire d'amorces 338F / 806R est utilisé avec succès pour pyroséquençage des échantillons vaginaux 14 et une paire d'amorces 515F / 926R a recently deviennent disponibles pour le séquençage de prochaine génération 12.

Enfin, ce protocole donne des instructions de base pour effectuer une analyse de 16S amplicon utilisant les Insights quantitatives en écologie microbienne (QIIME) progiciel 15. la mise en œuvre réussie des commandes QIIME décrites ici donne un tableau contenant les abondances taxonomiques bactériens pour chaque échantillon. De nombreuses mesures supplémentaires de contrôle de la qualité, les méthodes de classification taxonomique, et les étapes d'analyse peuvent être incorporés dans l'analyse, comme décrit en détail sur le site QIIME (http://qiime.org/index.html). Si l'analyse sera effectuée sur un ordinateur Apple, le paquet MacQIIME 16 permet une installation facile de QIIME et ses dépendances. Logiciels alternatifs pour 16S ARNr analyse de la séquence du gène comprennent mothur 17 et UPARSE 18.

Protocol

Le protocole d'étude a été approuvé par et a suivi les lignes directrices de la recherche Comité d'éthique biomédicale de l'Université de KwaZulu-Natal (Durban, Afrique du Sud) et le Conseil du Massachusetts General Hospital Institutional Review (2012P001812 / MGH, Boston, MA).

1. L'extraction de l'acide nucléique total de cervico écouvillons

Remarque: Effectuer des extractions d'acides nucléiques dans des ensembles de 16 échantillons ou moins. Le protocole écrit ci-dessous suppose échantillons sont traités dans des ensembles de 12. Si vous effectuez plusieurs séries d'extractions, le numéro en série les lots d'extraction et d'enregistrer l'extraction du numéro de lot de chaque échantillon ainsi que d'autres informations sur l'échantillon (y compris les métadonnées telles que le numéro d'identification, l'âge du participant , date / heure de la collecte de l' écouvillon, le type de contraception hormonale, les résultats des tests d'infection sexuellement transmissibles, etc.) dans le tableau 1.

  1. Préparation des réactifs et hotte
    1. Ajuster le pH du mélange phénol: chloroforme: alcool isoamylique (IAA) (25: 24: 1) à pH 7,9 par addition de 65 pl de Tris tampon alcalin pour 1 ml phénol, en agitant le mélange pendant 2 min, et en laissant les deux phases soit naturellement, soit séparée par centrifugation à 10 000 xg pendant 5 min à température ambiante.
      Attention: Phénol est toxique en cas d'ingestion, inhalation ou contact avec la peau et les yeux. Ne pas respirer les fumées. Porter des gants imperméables, des lunettes de sécurité avec protections latérales, et une blouse de laboratoire.
    2. Filtre à stériliser 25 ml de 20% de dodécylsulfate de sodium (SDS) à travers un filtre de 0,22 um. Faire 5 ml aliquotes des SDS stérilisés.
    3. Réfrigérer une aliquote de 10 ml d'isopropanol à -20 ° C.
    4. Préparer un tube bourrelet battant pour chaque souab à traiter par pesée 0,3 g des perles de verre dans un tube de 2 ml stérile qui convient pour le batteur à billes.
    5. Obtenir les écouvillons en échantillonnant l'exocol avec un tampon absorbant stérile. Immédiatement après la collecte, placer l'écouvillon dans un cryovial vide et stérile, conserver à 4 ° C pendant 1 à 4 heures pendant le transport au laboratoire, et les stocker pendant plusieurs mois à -80 ° C. Transférer les écouvillons (contenus dans des tubes individuelles) à traiter de la glace mouillée.
    6. Préparer l'enceinte de sécurité biologique (BSC). Utilisez un BSC avec un "dé" connecté à l'échappement du bâtiment pour assurer l'élimination appropriée des produits chimiques volatils.
      1. Retirez tous les matériaux de la hotte.
      2. Nettoyer toutes les surfaces du capot avec l'eau de Javel, suivie d'un décontaminant qui élimine les RNases, DNases, et de l'ADN à partir des surfaces. Nettoyer tous les articles suivants introduits dans la hotte à l'aide de Javel suivie d'une décontaminant d'acide nucléique, y compris des gants. Utilisez / réactifs DNase RNase frais, tels que pconseils ipette, chaque fois que possible.
      3. Collez un stérilisée sac biohazard chimique à l'arrière de la hotte. Tous les déchets secs contenant du phénol ou le chloroforme doit être placé dans ce sac pour une élimination appropriée.
      4. Placez un flacon stérile dans la hotte pour recueillir les déchets liquides contenant phénol ou chloroforme.
  2. extraction phénol- chloroforme.
    1. Dans le capot, à chaque tube de battage de talon, ajouter 500 ul de tampon (étape 1.1.1), 210 ul de 20% de dodécylsulfate de sodium et 500 pi de phénol: chloroforme: IAA (25: 24: 1, à pH 7,9 ).
    2. Transférer l'écouvillon dans le flacon de transport dans le tube perle de battre en utilisant une nouvelle paire de pinces stériles. Soigneusement frotter la tête de l'écouvillon contre les murs intérieurs du tube bourrelet battant au moins 30 sec. Reboucher l'échantillon lorsque vous avez terminé. Si vous effectuez des extractions à partir de plusieurs tampons, changer de gants entre chaque échantillon.
    3. Refroidir l'échantillon sur de la glace pendant au moins 10 min. Retirer le tampon de laperler battre le tube en tenant la poignée de tige avec des pincettes stériles tout en appuyant sur la tête de l'écouvillon contre la paroi du tube interne à l'aide d'une pointe de P200 propre. Jetez les tampons dans le sac de déchets de produits chimiques secs. Remarque: L'action «squeegee» (presser la tête de l'écouvillon) va libérer le liquide de l'écouvillon absorbant et augmenter la récupération de l'acide nucléique.
    4. Placer le tube perles battant dans le batteur à talon et homogénéiser pendant 2 min à 4 ° C.
    5. Centrifuger le tube de battage à billes pendant 3 min à 6000 x g à 4 ° C pour sédimenter les débris et séparer les phases aqueuses et de phénol.
    6. Transférer la phase aqueuse (~ 5-600 ul) dans un tube stérile de 1,5 ml. Ajouter un volume égal de phénol: chloroforme: IAA. Mélanger par inversion et brève tourbillonnement.
    7. Centrifuger le tube pendant 5 minutes à 16.000 xg et 4 ° C.
    8. Transférer la phase aqueuse dans un nouveau tube stérile de 1,5 ml. Soyez prudent et ne pas transférer le matériau de la couche d'interphase ou le phénol sous-jacentephase. Noter le volume de la phase aqueuse est transférée. Enregistrer la phase de phénol pour l'avenir de l'isolement des protéines.
    9. Ajouter 0,8 volume d'isopropanol et 0,1 volume d'acétate de sodium 3M (pH 5,5). Mélanger soigneusement par inversion et tourbillonner brièvement.
    10. Précipiter l'acide nucléique en refroidissant le tube à -20 ° C pendant au moins 2 heures (jusqu'à O / N).
  3. précipitation Isopropanol et lavage à l'éthanol
    1. Centrifuger le tube pendant 30 minutes à environ 16.000 xg et 4 ° C. Soigneusement utiliser une pipette pour éliminer le surnageant, en laissant le culot intact.
    2. Ajouter 500 ul d'éthanol à 100%. Déloger le culot avec tourbillonnement doux ou pipetage sans toucher le culot. Centrifugeuse pendant 5 minutes à 16.000 xg et 4 ° C.
    3. jetez soigneusement le surnageant de l'éthanol. Utilisez une pipette P10 pour éliminer autant que possible l'éthanol sans perturber le culot.
    4. Sécher à l'air le culot à température ambiante pendant 15 min.
    5. Remettre en suspension le culot dans 20 pi d'ultra pur 0,1x de tampon Tris-EDTA. Laisser l'échantillon refroidir sur de la glace pendant 10 minutes et la pipette à plusieurs reprises pour assurer la pleine remise en suspension. Si la pastille ne se dissout pas, le transfert du tube vers un bloc C à la chaleur 40 ° C pendant jusqu'à 10 minutes pour faciliter la dissolution.
    6. Mesurer la concentration d'acide nucléique en utilisant un spectrophotomètre 19.
    7. Si on le désire, l' ADN séparé de l' ARN en utilisant un kit de nettoyage de la colonne, en suivant le protocole du fabricant 20.
    8. Stocker l'acide nucléique à -80 ° C ou continuer.

2. L' amplification par PCR du gène V4 région hypervariable de l' ARNr 16S

Remarque: Effectuez l'amplification par PCR dans des ensembles de 12 échantillons ou moins pour réduire au minimum le risque de contamination et de l'erreur humaine. Si vous effectuez plusieurs cycles d'amplification, numéro en série les lots d'amplification et d' enregistrer le numéro d' amplification du lot de chaque échantillon dans le tableau 1.

  1. Préparation of les réactifs et hotte PCR
    1. Ajouter l'amplification par PCR définir les informations au tableau 1, qui servira de base du fichier de mappage à l'étape de l' analyse de l' ordre.
    2. Retirez tous les matériaux d'un capot PCR et nettoyer les surfaces internes avec l'eau de Javel suivie d'un décontaminant qui enlève RNases, DNases, et de l'ADN. Assurez - vous de décontaminer tous les réactifs et pièce d'équipement (par exemple, pipettes) avant de les placer dans la hotte. Porter des gants frais nettoyés avec un décontaminant acide nucléique avant de travailler dans la hotte.
    3. Si nécessaire, diluer la matrice d'acide nucléique à 50-100 ng / pl en utilisant l'eau exempte d'ADN et sans nucléases.
    4. aliquotes Décongeler des 5x haute fidélité (HF) tampons, dNTPs, et les amorces dans la hotte PCR clean. Doucement vortex et centrifuger toutes les solutions après décongélation. Pour minimiser les cycles de gel-dégel et le risque de contamination des stocks, préparation des aliquotes des 5x HF tampon, des dNTP et des amorces.
    5. Placer unpaillasse propre support refroidisseur pour tubes à centrifuger et une plaque de refroidissement PCR dans la hotte.
  2. Pour la réaction PCR, préparer le mélange maître en combinant 15,5 pi d'eau ultra-pure, 5 pl de tampon 5x Hf, 0,5 pi de dNTP, 0,5 pi de 515F amorce avant, 0,75 ul de 3% de DMSO, et 0,25 pi de polymerase pour chaque réaction. Assemblez tous les composants de la réaction dans le refroidisseur et ajouter la polymerase dernière. Mélanger soigneusement par pipetage. Ajouter deux échantillons supplémentaires pour le compte de la réaction lors de la préparation du mélange maître, pour tenir compte des erreurs de pipetage.
  3. PCR setup de réaction:
    Remarque: Effectuez amplifications en triple exemplaire, ce qui signifie chaque échantillon est amplifié dans trois 25 réactions ul séparées. Exécuter un contrôle de l'eau non-modèle avec chaque paire d'amorces. Travaillez rapidement mais soigneusement, en évitant l'introduction de toute contamination.
    1. Etiqueter une bande de 8 puits avec des capuchons individuels et les placer dans un refroidisseur PCR.
    2. Pipette 90 ul de mélange maître dans la premièrebien.
    3. Ajouter 2 ul de l'amorce inverse (Fichier supplémentaire 1). Assurez - vous de bien noter le code - barres d'amorce inverse utilisé avec chaque échantillon dans le tableau 1.
    4. Bien mélanger et transférer 23 pi de mélange maître du quatrième puits (le contrôle sans matrice).
    5. Ajouter 2 ul d'eau à la quatrième puits.
    6. Ajouter 6 ul de l'échantillon approprié pour le premier puits. Bien mélanger et transférer 25 ul du second puits. conseils de modification et de transférer un autre 25 pi de la première et à la troisième puits. Fermement plafonner chaque puits, en veillant à ne pas toucher l'intérieur des puits ou un bouchon dans le processus.
    7. Répétez l'opération pour chaque échantillon.
  4. Effectuer une amplification par PCR
    1. Transférer les tubes de la bande à un thermocycleur et exécuter le programme suivant: 30 sec à 98 ° C, suivi de 30 cycles de 10 sec à 98 ° C, 30 s à 57 ° C et 12 sec à 72 ° C, suivi d'un 10 min tiennent à 72 ° C et maintien finale d'unt 4 ° C.
    2. Effectuez les étapes suivantes sur un banc de laboratoire propre. faire tourner rapidement les tubes pour recueillir le liquide sur les parois. Combiner les réactions de PCR provenant de chaque échantillon en triple, avec un volume total de 75 pi dans un tube étiqueté stérile. transférer également 25 pl de chaque contrôle sans matrice dans un tube stérile séparé. Ne combinez pas encore amplicons de différents échantillons.
  5. La validation de l'amplification par PCR réussie des échantillons par électrophorèse sur gel.
    1. Préparer un gel d' agarose à 1,5% (1,5 g de poudre d'agarose dans 100 ml de tampon TAE 1X) avec suffisamment de puits pour maintenir chaque amplicon, le contrôle de l' eau, et l' échelle 21.
    2. Alors que le durcissement du gel (environ 30 minutes), préparer l'échantillon pour l'électrophorèse: Ajouter 1 pi de colorant de charge 6x à un nouveau tube étiqueté. Pour ce tube, ajouter 5 ul de l'amplicon et mélanger par pipetage.
    3. Lorsque le gel est fixé, enlever les peignes, placer le gel dans le réservoir d'électrophorèse, et remplir le réservoir avec du tampon TAE 1x. Pour le premier puits, ajouter 5 pl d'échelle d'ADN.
    4. Charge 5 pi de l'échantillon amplicon à un autre puits. Charge 5 pi de l'amplicon sans matrice à un puits séparé. Continuer selon les besoins pour chaque échantillon.
    5. Lorsque tous les échantillons ont été chargés, glissez le couvercle du réservoir en place et allumer la source d'alimentation à 120 V. Laisser le gel de fonctionner pendant 30 - 60 min.
    6. Voir le gel sous lumière UV.
      1. Vérifier l'amplification réussie de chaque échantillon en notant une seule bande forte autour de 380 pb. S'il y a une double bande, ré-amplifier l'échantillon avec un code à barres inverse différent (étape 2.3). S'il n'y a pas de bande du tout, ré-amplifier l'échantillon en utilisant soit le même code à barres inversé ou d'un nouveau code à barres inverse (étape 2.3). Si re-amplification est infructueuse, inhibiteurs de la PCR peuvent être présents dans l'échantillon, auquel cas, effectuer un ADN de nettoyage à base de colonne pour éliminer les inhibiteurs de PCR.
        Remarque: l'amplification réussie peut ne pas être possible si la concentration de l'ADN bactérien ou dans leéchantillon iginal est insuffisante (<5 ng / ul).
      2. Vérifier l'absence de contamination réactif en notant l'absence d'une bande dans le contrôle sans matrice.
    7. Stocker les 70 ul restants de amplicon à -20 ° C. Jeter les 20 ul restants de la commande sans modèle, en supposant qu'il n'a pas donné une bande.

3. Bibliothèque Pooling et High-Throughput Sequencing

  1. Créez le pool amplicon en combinant un volume égal (2-5 pi) de chaque amplicon dans un tube stérile unique. Si la bande à partir d'un échantillon de l'air particulièrement faibles, ajouter deux fois le volume relatif au reste des prélèvements.
  2. Retirer les amorces de PCR à partir du pool de amplicon en utilisant un kit de nettoyage PCR, en suivant les instructions du fabricant 22. Effectuer le nettoyage avec plusieurs colonnes si le volume de la piscine de amplicon est de plus de 100 pi. Note: Chaque colonne a une capacité de 100 pi.
    1. Conserver la bibliothèque à -20 & #176; ou C passez à l'étape suivante.
  3. Le cas échéant, combiner les pools d'amplicon sans apprêt à créer la bibliothèque finale. Déterminer la concentration d'ADN de la bibliothèque à l' aide d' un spectrophotomètre ou d' un système 23 fluorométrique. Un rapport 260/280 entre 1,8 à 2,0 est indicative de l'ADN pur.
  4. Diluer la bibliothèque à 20 nm. Confirmer la qualité de la bibliothèque en visualisant une seule bande d'environ 400 pb en utilisant un instrument d'électrophorèse. Confirmer que la concentration de la bibliothèque en utilisant un système 23 fluorométrique.
  5. Effectuer une dernière dilution 1:10 dans de l'eau pour diluer la bibliothèque à 2 nM. Ensuite, stocker la bibliothèque à 20 ° C une durée indéterminée.
  6. Envoyer une aliquote de la bibliothèque finale avec les trois amorces de séquençage requises (Lire 1, Lire 2, et l'indice; voir les tableaux des Matériaux / Équipement) à séquencer sur un séquenceur Illumina. Si moins de 300 échantillons ont été multiplexées pour le séquençage, utilisez une seule fin de 300 pb course et ayant un indice de 12 pb lu ona MiSeq, avec une concentration de la bibliothèque finale de 17 heures et un dénaturée PhiX spike-in 10%. Voir les documents supplémentaires de Caporaso et al. ISME J, 2012 10 pour obtenir des instructions détaillées de séquençage.

4. Analyse de la séquence

Note: Décrites ici est un pipeline de base pour l'analyse de séquence en utilisant le progiciel QIIME 1.8.0. Pour plus de simplicité, les commandes fournies supposent que le fichier de mappage est appelé mapping.txt, l'indice de 12 pb lire le fichier est appelé index.fastq, et le séquençage de 300 pb lire le fichier est appelé sequences.fastq. Installez QIIME ou MacQIIME 16 et vous familiariser avec les bases de UNIX pour exécuter ces ordres. Lire le guide complet de QIIME à:

  1. Remplissez le fichier de mappage pour l'expérience (tableau 1). Inclure autant de métadonnées que possible. Notez que les échantillons ont été extraits ou amplifiés dans le même lot, afin de déterminer s'il y a des effets de traitement par lots.
  2. par exemple, mapping.txt. Valider le formatage du fichier de mappage en exécutant la commande suivante: validate_mapping_file.py -m mapping.txt -o mapping_output
    Note: Cette commande utilise le script QIIME intégré "validate_mapping_file.py" qui fait un nouveau dossier, appelé "mapping_output", contenant un fichier .html indiquant les erreurs de fichier de mappage, le cas échéant.
  3. Vérifier la qualité du séquençage lit au moyen d' un haut débit séquence la qualité des données programme de vérification, telles que FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Figure 5 démontre la qualité par séquence de base que l'on peut attendre d'une course réussie.
    Remarque: Le séquenceur attribue chaque base nucléotidique un score de qualité Phred, ce qui correspond à la probabilité que la base a été appelée à tort. Un score de qualité Phred de 10 indique qu'il ya une chance de 10% que le nucléotide a été incorrectement attribuered, 20 indique une chance de 1%, 30 indique une chance de 0,1%, et 40 (le score le plus élevé possible) indique une chance de 0,01% 24.
  4. Utilisation du fichier de mappage comme une clé, démultiplexage, filtrer la qualité des données de séquençage, et enregistrer les résultats dans un dossier (dans ce cas, appelé "sl_out") en exécutant cette commande 25: split_libraries_fastq.py --rev_comp_mapping_barcodes -i sequences.fastq -o sl_out / -b index.fastq -m mapping.txt -q 29
    Remarque: Le q drapeau indique le score inacceptable de la qualité Phred maximale, par exemple, "-q 29" filtre toutes les séquences avec Phred scores inférieurs à 30, assurant 99,9% de précision des appels de base.
  5. Utilisation de l'unité opérationnelle taxonomique (OTU) base de données Greengenes 16S de référence 26 (http://qiime.org/home_static/dataFiles.html), effectuer open-référence OTU picking en exécutant cette commande 27: pick_open_reference_otus.py -i sl_out / SEQS. fna -r 97_otus.fasta -o ucrss / -s 0,1
    Remarque: Le drapeau -s indiquela fraction de séquences qui n'a pas réussi à aligner sur la base de données de référence qui sera inclus dans le regroupement de novo. "-s 0,1" comprend 10% des séquences ayant échoué dans le regroupement de novo. Utilisez l'indicateur -a pour paralléliser le processus de préparation OTU et de réduire le temps de traitement de jours en heures si plusieurs noyaux sont disponibles.
  6. Créer une table taxinomique abondance conviviale en fusionnant OTU au niveau de l' espèce en exécutant cette commande 28: summarize_taxa.py -i ucress / otu_table_mc2.biom -o summarized_otuSpecies / -L 7
    Remarque: Le tableau résultant peut être facilement vu dans un logiciel de tableur. Notez que le séquençage de l'ARNr 16S ne prévoit pas de manière fiable résolution de niveau des espèces.
  7. Déterminer la diversité écologique dans chaque échantillon en calculant plusieurs métriques de diversité alpha avec le alpha_diversity.py script QIIME. Ensuite, déterminer la diversité entre les paires d'échantillons en utilisant le script beta_diversity.py QIIME.
  8. visualize les données, par exemple, en utilisant un principe EMPEREUR 29 coordonne la parcelle ou heatmap.
  9. Effectuer des comparaisons statistiques officielles des catégories de fichiers de mappage, par ex, avec le script compare_catagories.py de QIIME 30.

Representative Results

L'aperçu général du protocole, qui permet la détermination des abondances bactériennes par rapport à partir d' un écouvillon utilisant ARNr 16S séquençage du gène, est représenté sur la figure 1 du protocole .Le a été optimisé pour les prélèvements vaginaux humains, mais peut être facilement adapté pour la plupart des sites muqueux d'échantillonnage et d' autres hôtes. la figure 2 montre l'ADN de haute qualité et de l' ARN qui peut être isolé à l' aide du protocole de perles raclée. la figure 3 illustre une amplification par PCR réussie de 12 échantillons, où chaque amplification avec un échantillon produit une bande unique forte du bon taille et chaque contrôle de l' eau n'a donné une bande. la figure 4 illustre la quantification du pool de bibliothèque finale avant le séquençage. la figure 5 montre un profil typique de qualité de la séquence après une seule fin de 300 pb MiSeq terme.

"Src =" / files / ftp_upload / 53939 / 53939fig1.jpg "/>
Figure 1. Schéma Vue d' ensemble du protocole. Tout d' abord, l' acide nucléique est extrait d'un écouvillon en bourrelet raclée dans une solution tampon contenant du phénol, de chloroforme et d'alcool isoamylique. région variable 4 du gène de l'ARNr 16S est ensuite amplifié à partir de l'acide nucléique obtenu par PCR. amplicons PCR provenant jusqu'à des centaines d'échantillons sont ensuite combinés et séquencées sur un seul terme. Les séquences résultantes sont adaptées à une base de données de référence pour déterminer les abondances bactériennes relatives. Le protocole complet peut être effectué en environ trois jours. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. haute qualité Nucleic Acid Extrait Utilisation du Phénol: Perle Chloroforme Beating Méthode. (A) la qualité de l' ADN, comme évalué à l' aide d' un spectrophotomètre. Un rapport A260 / A280 entre 1,8 et 2,0 indique l' acide nucléique pur qui ne soit pas contaminé avec du phénol ou d'une protéine. (B) Après une colonne de nettoyage, ce protocole peut donner l' ARN de haute qualité, indiqué par de forts pics 16S et 23S. (C) dégradation de l' ARN peut se produire si l'échantillon n'a pas été conservé au froid après la collecte (pendant le transport et le stockage) ou si RNases sont présents au cours du traitement. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. Confirmation du succès ARNr 16S Gene Amplification Utilisation du 515F et Barcoded 806R Primer Set. Top électrophorèse sur gel) est utilisé pour confirmer la présence d'une seule bande autour de 380 paires de bases in chaque échantillon qui a été amplifié avec le modèle. L'absence d'une bande indique une amplification sans succès; cela est généralement dû à une erreur humaine et la réaction PCR à partir de cet échantillon doit être répété. Bottom) Aucun modèle (eau) contrôles fonctionner en parallèle avec la même paire d'amorces ne devraient pas avoir une bande présente. La présence d'une bande dans le contrôle de l'eau indique des réactifs contaminés; jeter les réactifs qui peuvent être contaminés et re-faire les amplifications PCR à la fois du modèle et de l' eau de contrôle pour cette paire d'amorces. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4. Quantification de la concentration finale Bibliothèque Piscine et Validation de la taille de la bibliothèque. Après la mise en commun des amplicons d'échantillons individuels, econcentration e de la piscine de la bibliothèque finale doit être déterminée. La piscine de la bibliothèque doit ensuite être diluée pour obtenir une concentration de 2 nM. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Figure 5
Figure 5. Représentant Bar Terrain de la séquence de qualité Scores à chaque position de la lecture. Il est normal que la qualité de la séquence d'abandonner après 200 paires de bases, mais le score de qualité moyenne devrait rester au- dessus 30. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

#SampleID code à barre
LinkerPrimer
Séquence
rcbcPrimer Échantillons Extraction
Lot
Amplification
assiette
La description
fichier #An exemple de cartographie peut être trouvé à: http://qiime.org/_static/Examples/File_
Formats /
Exemple_
Mapping_
Fichier.txt
AG2350 TCCCTTGTCTCC CCGGACTACHVGGGTWTCTAAT rcbc000 Cervical
Écouvillon
1 UNE

Tableau 1. Mapping fichier Template. Creating un fichier précis et exhaustif de cartographie est essentielle pour exécuter avec succès le protocole. Le fichier de mappage est non seulement nécessaire pour exécuter QIIME, mais il permet également aux chercheurs de maintenir le lien entre le code - barres de l' échantillon et des métadonnées, pour analyser les données pour les biais systématiques (par exemple, variation de lot à lot), et de déterminer corrélations intéressantes entre les métadonnées et les populations bactériennes. Un fichier de mappage bare-bones est fourni, mais les utilisateurs sont encouragés à ajouter autant de colonnes contenant des métadonnées que possible. Des exemples de métadonnées supplémentaires pour un prélèvement vaginal comprend l'âge, la date / heure de la collecte de l'écouvillon, le type de contraceptif hormonal (le cas échéant), les résultats des tests d'infection sexuellement transmissibles, etc. du participant

suppliment 1
Supplemental fichier 1. Liste des Barcoded Amorce Sequences 10 S'il vous plaît cliquer ici pour télécharger ce fichier.

Discussion

Nous décrivons ici un protocole pour l'identification et la caractérisation des abondances bactériennes relatives dans un prélèvement vaginal humain. Ce protocole peut facilement être adapté à d'autres types d'échantillons, tels que des selles et des tampons d'autres sites du corps, et pour les échantillons prélevés à partir d'une grande variété de sources. L'extraction de l'acide nucléique par billes raclée dans une solution tamponnée de phénol et de chloroforme, permet d'isoler de l'ADN et l'ARN, ce qui est particulièrement important lorsque l'on travaille avec des échantillons prélevés précieux au moyen d'études cliniques. L'ADN bactérien isolé est excellent pour l'identification taxonomique bactérienne et l'assemblage génomique, tandis que la collecte simultanée de l'ARN offre la possibilité de déterminer bactérienne fonctionnelle, l'hôte et les contributions virales par l'ARN-seq. Le protocole décrit utilise une seule étape primaire ensemble validé qui a été déployé avec succès sur un large éventail de types d'échantillons, y compris humain, canin, et des échantillons environnementaux 10

La partie d'extraction d'acide nucléique de ce protocole est limitée par les mesures de sécurité nécessaires lorsque l'on travaille avec du phénol et du chloroforme, et les défis de l'automatisation de la conduite à un haut-débit, le format de plaque à 96 puits. En outre, la perle battre vigoureuse utilisé pour des cisailles de lyse mécanique l'ADN bactérien à environ 6 fragments de kilobases; si des fragments d'ADN plus longs sont nécessaires pour les applications en aval, la durée du bourrelet battant should être raccourci. Les limites de la partie d'identification bactérienne de ce protocole sont inhérentes à toute méthode qui repose sur le séquençage des gènes ARNr 16S. Le séquençage de l'ARNr 16S est idéal pour l'identification bactérienne au niveau du genre et de même espèce, mais fournit rarement identification de niveau de tension. Alors que la région variable V4 du gène ARNr 16S fournit la discrimination robuste chez la plupart des espèces bactériennes 11, les méthodes de calcul supplémentaires tels que oligotypage 31 peuvent devoir être utilisés pour identifier précisément certaines espèces, telles que Lactobacillus crispatus. Enfin, des informations sur les capacités fonctionnelles bactériennes précises au sein d'un échantillon particulier ne peut pas être déterminée par ARNr 16S séquençage du gène seul, bien que ce protocole permet l'extraction de l'ADN du génome entier et de l'ARN qui peut être utilisé à cette fin.

L'étape la plus essentielle pour assurer le succès de ce protocole prend grand soin pour éviter la contamination durment le prélèvement d'échantillons, l'extraction d'acide nucléique, et une amplification par PCR. Assurer la stérilité au moment de la collecte d'échantillons en portant des gants propres et en utilisant des écouvillons stériles, tubes, et des ciseaux. Pour évaluer la contamination des matériaux de collecte, de recueillir des tampons de contrôle négatif en plaçant des tampons inutilisés supplémentaires directement dans des tubes de transport au moment de l'échantillonnage. Dans le laboratoire, effectuer toutes les étapes de pré-amplification dans une hotte stérile contenant des fournitures ne décontaminés et en utilisant uniquement la biologie moléculaire, des réactifs exempts d'ADN. Au cours de l'extraction d'acide nucléique, d'empêcher la contamination croisée à l'aide d'une pince stérile et de nouveaux gants frais à chaque échantillon, et en gardant l'ensemble des tubes fermés sauf lors de l'utilisation. Traitement des tampons inutilisés en parallèle assure la stérilité à la fois du prélèvement de l'échantillon et l'extraction d'acide nucléique; les tampons inutilisés ne devraient pas donner une pastille après précipitation de l'isopropanol et le lavage à l'éthanol. Si une pastille ne semble, effectuer des ARNr 16S amplification génique pour déterminer une source possible dela contamination (par exemple, la présence de Streptococcus ou Staphylococcus indiquerait une contamination de la peau). En outre, effectuer des amplifications par PCR avec aucune réaction de commande de modèle en parallèle pour garantir que les réactifs et les réactions PCR sont pas contaminés. Si un groupe apparaît dans une commande pas de modèle, jeter des réactifs et répéter l'amplification avec des réactifs frais. Compte tenu de ces précautions permettra d'assurer le séquençage réussie des bactéries d'intérêt.

L'étape d'amplification PCR a tendance à exiger le plus dépannage. Amplifier dans des ensembles de douze échantillons fournit un équilibre entre l'efficacité et la cohérence. L'absence totale de bandes dans tous les échantillons dans un ensemble d'amplification donnée indique une défaillance systématique, par exemple, en oubliant d'ajouter un réactif ou de programmation de façon incorrecte le thermocycleur. L'absence d'une bande de quelques échantillons est généralement dû à une erreur humaine, et les amplifications doivent être re-rnon avec le même appariement de l'échantillon et l'amorce inverse. Dans le cas d'une absence continue d'une bande, l'échantillon peut être ré-amplifié en utilisant une amorce inverse avec un code à barres différent. échecs répétés d'amplification avec plusieurs amorces inverses peuvent indiquer un inhibiteur présent dans l'échantillon. Dans ce cas, le nettoyage de l'ADN avec une colonne souvent éliminer les inhibiteurs sans altérer de manière significative les abondances bactériennes relatives. Si plusieurs bandes résultent après amplification, re-amplifier l'échantillon avec un autre code à barres amorce inverse.

En plus de prévenir la contamination de l'environnement et de veiller à l'amplification d'un produit spécifique unique, le séquençage succès repose sur les soins lors de la préparation de la piscine de la bibliothèque. L'objectif est de combiner des quantités équimolaires des amplicons de chaque échantillon pour assurer approximativement le même nombre de lectures par séquençage de l'échantillon. Si les concentrations d'acide nucléique avant amplification sont comparables, en ajoutant simplement des volumes égaux de chacun saLes amplicons de Mple est suffisante lors de la création de la piscine de la bibliothèque. Cependant, si les concentrations d'acides nucléiques sont très différentes et ajoutée en volume égal de l'échantillon avec la concentration d'acide nucléique faible sera mal représentée avec un faible nombre de lectures. Dans ce cas, il est possible d'ajouter un plus grand volume des amplicons de l'échantillon à faible concentration en fonction de l'intensité relative de la bande de gel. En variante, il est possible d'éliminer de manière plus rigoureuse à partir amplicons amorces individuelles, de quantifier la concentration de l'amplicon de l'échantillon individuel à l'aide d'un kit de quantification fluorométrique ADNdb, et précisément combiner des quantités équimolaires de chaque échantillon.

Une fois une piscine amplicon bien équilibré est généré, il devient essentiel de mesurer soigneusement la concentration de la piscine. dilution soigneuse ultérieure et spike-in avec PhiX pour augmenter la complexité de lecture est essentielle pour obtenir des résultats optimaux de séquençage. séquenceurs à haut débit qui utilisent séquenCing par synthèse sont très sensibles à la densité de la grappe sur la cellule d'écoulement. Chargement d' une piscine bibliothèque qui est trop concentré se traduira par Redondance, avec des scores de qualité inférieure, la sortie de données inférieure, et démultiplexage inexactes 32. Chargement d'une piscine bibliothèque qui est trop diluée se traduira également par la production de données à faible. Soigneusement quantifier la piscine de la bibliothèque avant le séquençage permettra d'assurer des résultats optimaux.

séquençage du gène ARNr 16S fournit une évaluation complète des bactéries présentes dans un échantillon donné et est une première étape absolument essentiel dans la production d'hypothèse. La présence d'un riche ensemble de métadonnées permet en outre aux chercheurs de tester les associations entre certaines espèces bactériennes et les facteurs biologiques importants. En outre, les mêmes informations 16S peut être utilisée pour déduire les fonctions bactériennes en utilisant des outils tels que PICRUSt 33. Le but ultime est d'utiliser la caractérisation 16S pour identifier des associations nouvelles qui peuvent êtreen outre testé et validé dans des systèmes modèles, en ajoutant à notre compréhension croissante de l'impact du microbiome bactérien sur la santé humaine et de la maladie.

Acknowledgements

Nous tenons à remercier Elizabeth Byrne, David Gootenberg, et Christina Gosmann pour des commentaires critiques sur le protocole; Megan Baldridge, Scott Handley, Cindy Monaco, et Jason Norman pour la préparation des échantillons d'orientation et démonstrations; Wendy Garrett, Curtis Huttenhower, Skip Virgin, et Bruce Walker pour obtenir des conseils de protocole et des discussions fructueuses; et Jessica Hoisington-Lopez pour le soutien de séquençage. Ce travail a été soutenue par la Fondation Bill et Melinda Gates, et le NIAID (1R01AI111918). DSK a reçu un soutien supplémentaire du Fonds Burroughs Wellcome. MNA a été soutenu par plusieurs prix T32GM007753 du NIGMS, et Paul et Daisy Soros Fellowship. Le contenu est exclusivement la responsabilité des auteurs et ne représentent pas nécessairement les vues officielles de l'NIGMS ou le NIH.

Materials

Name Company Catalog Number Comments
Equipment:
Mini-Beadbeater-16 BioSpec 607
PCR workstation Any PCR hood can be used, e.g., the AirClean 600.
Thermocycler Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.
Electrophoresis system Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.
Nanodrop Thermo Scientific 2000C Any other DNA quantification method will be sufficient
Bioanalyzer Agilent 2100 An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.
MiSeq or HiSeq Illumina
Name Company Catalog Number Comments
Materials:
Catch-All Sample Collection swab Epibio QEC89100 Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project. 
ELIMINase Fisher 04-355-31
SteriFlip 50 ml filtration device (0.22 µm) EMD Millipore SCGP00525
0.1 mm glass beads BioSpec 11079101
2 ml screw-cap tubes Sarstedt 72.694.006 For bead beating
UltraPure 5M NaCl Life Technologies 24740-011 Molecular Biology Grade
1 M Tris-HCl Ambion (Invitrogen) AM9856 Molecular Biology Grade
0.5 M EDTA Ambion (Invitrogen) AM9260G Molecular Biology Grade
Sodium Dodecyl Sulfate, 20% Solution Fisher BP1311-200 Molecular Biology Grade
UltraPure DNase/RNase-free distilled water Ambion 10977-015 Molecular Biology Grade, for buffer preparation
2-Propanol BioReagent, for molecular biology, ≥99.5% Sigma I9516-500ML Molecular Biology Grade
Phenol:Chloroform:IAA, 25:24:1 Invitrogen AM9730 Warning: Toxic
3 M Sodium Acetate, pH 5.5 Life Technologies AM9740 Molecular Biology Grade
Disposable sterile polystyrene forceps, PS Cole Parmer EW-06443-20
1.5 ml, clear, PCR clean tubes Eppendorf 22364120
PCR grade water MoBio 17000-11 For PCR
Phusion High-Fidelity DNA Polymerase New England Biolabs M0530S
dNTP mix Sigma D7295-0.5mL
0.2 ml PCR 8-tube with attached clear flat caps, natural USA Scientific 1492-3900 Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work
Agarose BioExpress E-3121-25
50x TAE buffer Lonza 51216
DNA gel stain Invitrogen S33102
6x DNA Loading Dye Thermo (Fisher) R0611
50 bp GeneRuler Ladder Thermo (Fisher) SM0373
AllPrep DNA/RNA kit Qiagen 80284
UltraClean PCR Clean-up Kit MoBio 12500-100
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496 An alternative is Qubit Fluorometric Quantification (Life Technologies)
Name Company Catalog Number Comments
Primers:
515F (forward primer) 5'-AATGATACGGCGACCACCGAG
ATCTACACTATGGTAATTGT
GTGCCAGCMGCCGCGGTAA-3'
Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 µM. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded
_primers_515F_806R.txt
IDT is recommended If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 μM. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and
_resuspension.doc.  **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**
Read 1 Sequencing Primer 5'-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3' 25 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Read 2 Sequencing Primer 5'-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3' 26 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
Index Sequencing Primer 5'-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3' 27 nmole; Purification: Standard Desalting. Resuspend at 100 µM.
PhiX Control v3 Illumina FC-110-3001 Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.

DOWNLOAD MATERIALS LIST

References

  1. Huttenhower, C. Structure, function and diversity of the healthy human microbiome. Nature. 486, 207-214 (2012).
  2. O'Hanlon, D. E., Moench, T. R., Cone, R. A. Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota. PloS one. 8, e80074 (2013).
  3. Aldunate, M. Vaginal concentrations of lactic acid potently inactivate HIV. The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).
  4. Anahtar, M. N., et al. Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract. Immunity. 42, 965-976 (2015).
  5. Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).
  6. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162, 156-159 (1987).
  7. Srinivasan, S., et al. Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PloS one. 5, e10197 (2010).
  8. Dols, J. A., et al. Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis. American journal of obstetrics and gynecology. 204, 301-307 (2011).
  9. Segata, N., et al. Metagenomic microbial community profiling using unique clade-specific marker genes. Nature methods. 9, 811-814 (2012).
  10. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 6, 1621-1624 (2012).
  11. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4516-4522 (2011).
  12. 16S rRNA Amplification Protocol. Earthmicrobiome Project. Available from: www.earthmicrobiome.org (2015).
  13. Ravel, J., et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences of the United States of America. 108, Suppl 1 4680-4687 (2011).
  14. Srinivasan, S., et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PloS one. 7, e37818 (2012).
  15. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 7, 335-336 (2010).
  16. Werner, J. MacQIIME. Available from: http://www.wernerlab.org/software/macqiime (2015).
  17. Schloss, P. D., et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 75, 7537-7541 (2009).
  18. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature. 10, 996-998 (2013).
  19. NanoDrop 2000/2000c Spectrophotometer, V1.0 User Manual. Thermo Fisher Scientific. Available at: http://www.thermoscientific.com/content/dam/tfs/ATG/CAD/CAD Documents/Product Manuals & Specifications/Molecular Spectroscopy/UV Visible Spectrophotometers/Spectrophotometer Systems/NanoDrop/NanoDrop-2000-User-Manual-EN.pdf (2009).
  20. AllPrep DNA/RNA Mini Kit. Qiagen. Available from: https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/ - orderinginformation (2015).
  21. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of visualized experiments. (2012).
  22. UltraClean PCR Clean-Up Kit Instruction Manual. MoBio. Available from: http://www.mobio.com/images/custom/file/12500(1).pdf (2013).
  23. Quant-iT PicoGreen dsDNA Reagent. Invitrogen. Available at: https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf (2008).
  24. Quality Scores for Next-Generation Sequencing. Illumina. Available from: http://www.illumina.com/documents/products/technotes/technote_Q-Scores.pdf (2011).
  25. split_libraries_fastq.py. QIIME. Available from: http://qiime.org/scripts/split_libraries_fastq.html (2015).
  26. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 72, 5069-5072 (2006).
  27. pick_open_reference_otus.py. QIIME. Available from: http://qiime.org/scripts/pick_open_reference_otus.html (2015).
  28. summarize_taxa_otus.py. QIIME. Available from: http://qiime.org/scripts/summarize_taxa.html (2015).
  29. Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. GigaScience. 2, 16 (2013).
  30. Comparing categories. QIIME. Available from: http://qiime.org/tutorials/category_comparison.html (2015).
  31. Eren, A. M., et al. Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation. PloS one. 6, e26732 (2011).
  32. Diagnosing and preventing flow cell overclustering on the MiSeq system. Illumina. Available from: http://support.illumina.com/content/dam/illumina-marketing/documents/products/other/miseq-overclustering-primer-770-2014-038.pdf (2015).
  33. Langille, M. G., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 31, 814-821 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics