Screening for Funksjonell Non-koding genetiske varianter Bruke Elektro Mobility Skift Assay (EMSA) og DNA-affinitet Nedbør analyse (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Sekvensering og genotyping baserte studier, inkludert Genome-Wide Association Studies (GWAS), kandidat locus studier, og dyp-sekvense studier har identifisert mange genetiske varianter som er statistisk assosiert med en sykdom, trekk, eller fenotype. I motsetning til tidligere prediksjoner, er de fleste av disse variantene (85-93%) lokalisert i ikke-kodende regioner og endrer ikke aminosyresekvensen til proteiner 1,2. Tolking av funksjonen av disse ikke-kodende varianter og å bestemme de biologiske mekanismer som forbinder dem til den tilhørende sykdom, har egenskap, eller fenotype vist seg vanskelig 3-6. Vi har utviklet en generell strategi for å identifisere de molekylære mekanismene som lenker varianter til en viktig mellom fenotype - genuttrykk. Denne rørledningen er spesielt utviklet for å identifisere modulering av TF bindende av genetiske varianter. Denne strategien kombinerer beregnings tilnærminger og molekylærbiologiske teknikker som mål å forutsibiologiske effekter av kandidat varianter i silico og bekrefte disse spådommene empirisk (figur 1).

Figur 1
Figur 1:.. Strategisk tilnærming for analyse av ikke-kodende genetiske varianter trinn som ikke er inkludert i detaljert protokoll i forbindelse med dette manuskriptet er skyggelagt i grått Klikk her for å se en større versjon av dette tallet.

I mange tilfeller er det viktig å begynne med å utvide listen over varianter for å inkludere alle de i høy linkage-ulikevekt (LD) med hver statistisk tilhørende variant. LD er et mål på ikke-tilfeldig forening av alleler ved to forskjellige kromosomale stillinger, som kan måles ved R 2 7. R2 er et mål på linKage ulikevekt mellom to varianter, med en r 2 = 1 betegner perfekt kobling mellom to varianter. Alleler i høy LD er funnet å co-skille på kromosomet over forfedrenes populasjoner. Nåværende genotyping arrays omfatter ikke alle kjente varianter i det menneskelige genom. I stedet, de utnytte LD innenfor det menneskelige genom, og inkluderer en undergruppe av de kjente variantene som fungerer som stedfortredere for andre varianter innenfor en bestemt region av LD 8. Således kan en variant uten noe biologisk konsekvens være assosiert med en spesiell sykdom fordi det er i LD med den kausale variant-varianten med en meningsfull biologisk virkning. Prosedyremessig anbefales det å konvertere den nyeste utgaven av 1000 genomer projisere 9 variant samtalefiler (vcf) i binærfiler som er kompatible med plink 10,11, en ​​åpen kildekode-verktøy for hele genomet forening analyse. Deretter alle andre genetiske varianter med LD r 2> 0,8 med hver inngang genetisk vaRiant kan identifiseres som kandidater. Det er viktig å bruke riktig referansegruppen for dette trinn for eksempel hvis en variant ble identifisert i fagene europeisk opphav, data fra personer av samme herkomst bør brukes for LD ekspansjon.

LD ekspansjon resulterer ofte i en rekke kandidat varianter, og det er sannsynlig at bare en liten brøkdel av disse bidrar til sykdom mekanisme. Ofte er det umulig å eksperimentelt undersøke hver av disse variantene individuelt. Det er derfor nyttig å utnytte de tusenvis av offentlig tilgjengelige funksjonell genomikk datasett som et filter for å prioritere varianter. For eksempel har KODE konsortiet 12 utført tusenvis av chip-seq eksperimenter som beskriver binding av TFS og co-faktorer, og histone karakterer i et bredt spekter av sammenhenger, sammen med kromatin tilgjengelighets data fra teknologier som DNase-seq 13, ATAC -seq 14, og FAIRE-seq 15. Databases og webservere som UCSC Genome Browser 16, Roadmap Epigenomics 17, Blueprint epigenome 18, Cistrome 19, og tilordne 20 gir gratis tilgang til data som produseres av disse og andre eksperimentelle teknikker over et bredt spekter av celletyper og vilkår. Når det er for mange varianter å undersøke eksperimentelt, kan disse dataene brukes til å prioritere de som ligger innenfor sannsynlig regulatoriske regioner i relevante celle- og vevstyper. Videre, i tilfeller der en variant er innenfor en chip-seq topp for et bestemt protein, kan disse dataene gir potensielle kunder med hensyn til spesifikke TF (e) eller co-faktorer som bindende kan påvirke.

Deretter blir de resulterende prioritert variantene vist eksperimentelt å validere spådd genotype-avhengige proteinbinding ved hjelp av EMSA 21,22. EMSA måler endringen i migreringen av oligo på en ikke-reduserende TBE gel. Fluorescensmerkede oligo inkuberes med denatom lysat, og binding av nukleære faktorer vil retardere bevegelsen av oligo på gelen. På denne måte oligo som har bundet flere nukleære faktorer vil presentere som en sterkere fluorescerende signal på skanning. Spesielt, har EMSA ikke krever spådommer om spesifikke proteiner som binding vil bli berørt.

Når varianter er identifisert som befinner seg innenfor forutsagte regulatoriske områder og er i stand til differensielt bindende nukleære faktorer, blir beregningsmetoder anvendt for å forutsi den aktuelle TF (e) hvis binding de kan påvirke. Vi foretrekker å bruke cis-BP 23,24, RegulomeDB 25, UniProbe 26, og Jaspar 27. Når kandidaten TFS er identifisert, kan disse spådommene være spesielt testet ved hjelp av antistoffer mot disse TFS (EMSA-supershifts og DAPA-Westerns). En EMSA-supershift involverer tilsetning av et TF-spesifikt antistoff til det nukleære lysatet og oligo. Et positivt resultat i en EMSA-supershift er represented som en ytterligere forskyvning i EMSA band, eller et tap av bandet (anmeldt i referanse 28). I den komplementære DAPA, er en 5'-biotinylert oligo duplex inneholder variant og 20 basepar flankerer nukleotider inkubert med atom lysat fra relevant celletype (r) for å fange opp eventuelle atom faktorer spesifikt binde oligos. Oligo duplex-nukleær faktor komplekset er immobilisert streptavidin av mikroperler i en magnetisk kolonne. De bundet kjernefysiske faktorer samles direkte gjennom eluering 29,48 -kan. Bindings forutsigelser kan deretter bli vurdert av en Western blot ved anvendelse av antistoffer som er spesifikke for proteinet. I tilfeller der det er ingen åpenbare forutsigelser, eller for mange spådommer, de elueringer fra variant pull-downs av DAPA eksperimenter kan sendes til en proteomikk kjerne for å identifisere kandidat TFS hjelp massespektrometri, som senere kan bli validert ved hjelp av disse tidligere beskrevet metoder.

I det gjenværende av article er detaljert protokoll for EMSA og DAPA analyse av genetiske varianter forutsatt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Utarbeidelse av løsninger og reagenser

  1. Bestille tilpassede DNA oligonukleotid prober for bruk i EMSA og DAPA.
    1. For å redusere ikke-spesifikk proteinbinding, utforme korte oligonukleotider (mellom 35-45 basepar (bp) i lengde) 30, og plassere den varianten av interesse direkte i midten flankert av sin 17 bp endogent genomisk sekvens. For EMSA oligonukleotider, legge til en 5 'fluorophore. For DAPA oligonukleotider, legge til en 5 'biotin tag.
    2. Bestille både den forstand tråden og dens revers komplement strand. Alternativt, for duplex (pre-annealed) oligos. Når navngi oligonukleotider, basere nomenklaturen på en etablert referanse genom.
      Merk: "Risiko" og "ikke-risiko" betegnelse kan være sykdom og prosjektspesifikke, mens "referanse" og "ikke-referanse" er mer universelt relevant.
    3. Ved ankomst av oligonukleotider, kort spinne ned innholdet og resuspender i nuklease-fritt vann til en sluttkonsentrasjon på 100 μ; M. Oppbevares resuspendert lager ved -20 ° C. Beskytt oligos merket med en fluorofor fra lys ved å pakke med aluminiumsfolie.
Navn Sekvens
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG En GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC

Tabell 1: Eksempel EMSA / DAPA oligonukleotid design for å teste en SNP for differensial binding. "REF" står for referanse allele, mens "NONREF" står for den ikke-referanse-allelet. "FOR" står for den videre strand, mens "REV" indikerer dens komplement. SNP er sett i rødt.

  1. Forbered cytoplasmiske ekstraksjon (CE) buffer med en sluttkonsentrasjon på 10 mM HEPES (pH 7,9), 10 mM KCl og 0,1 mM EDTA i avionisert vann.
  2. Fremstille kjerne ekstraksjon (NE) buffer med en endelig konsentrasjon på 20 mM HEPES (pH 7,9), 0,4 M NaCl, og 1 mM EDTA i avionisert vann.
  3. Forbered sammensmeltningsbuffer med en sluttkonsentrasjon på 10 mM Tris (pH 7,5-8,0), 50 mM NaCl, og 1 mM EDTA i avionisert vann.

2. Utarbeidelse av Nuclear Lysate fra dyrkede celler

Merk: Dette eksperimentelle protokollen ble optimalisert ved hjelp av B-lymfoblastoid cellelinjer, men har blitt testet i flere andre urelaterte tilhenger / fjæring cellelinjer og fungerer universelt.

  1. Culture B-lymfoblastoid-celler i Roswell Park Memorial Institute (RPMI) 1640 med 2 mM L-glutamin, 10% føtalt bovint serum, og 1x antibiotika-antimykotisk inneholdende 100 enheter / ml penicillin, 100 ug / ml streptomycin, og 250 ng / ml amfotericin B.
    1. Frø med en rekkevidde på 200,000-500,000 levedyktige celler / ml og inkuberes kolber ved 37 ° C med 5% karbondioksyd i en oppreist posisjon med ventilerte eller løse hetter.
      Merk: Veksten av B-lymfoblastoid celler bremser når de nå over en million celler / ml. Bryt opp celleblaster ved å pipettere opp og ned flere ganger og gå tilbake celler til 200,000-500,000 celler / ml for å opprettholde en rask vekst.
  2. Vask dyrkede cellene to ganger med 10 ml iskald fosfatbufret saltløsning (PBS), spinne ned ved 4 ° C, 300 xg i 5 minutter og fjerne PBS via aspirasjon.
  3. Cellene telles ved hjelp av et hemocytometer og resuspender pelleten som 1 ml iskald PBS per 10 7 celler.
    Merk: For eksempel, hvis lyse 2 x 10 7 </ Sup> celler, resuspender i 2 ml PBS.
  4. Aliquot 1 ml til 1,5 ml mikrosentrifugerør, slik at hvert rør inneholder 10 7 celler i PBS. Sentrifuger ved 3300 x g i 2 minutter 4 ° C og aspireres av PBS.
  5. Før bruk, tilsett 1 mM ditiotreitol (DTT), 1x fosfatase inhibitor, og 1x proteasehemmer til en fungerende lager av CE buffer. Resuspender cellepelleten med 400 mL av CE-buffer og inkuberes på is i 15 minutter.
  6. Legg 25 ul av 10% Nonidet P-40 og blandes ved pipettering. Sentrifuge ved 4 ° C, maks hastighet i 3 min. Dekanter og kast supernatanten.
  7. Før bruk, tilsett 1 mM DTT, 1x fosfatase inhibitor, og 1x proteasehemmer til en fungerende lager av NE buffer. Resuspender cellepelleten med 30 pl av NE-buffer og bland ved virvling.
  8. Inkuber ved 4 ° C i et rør rotator eller på is i 10 min. Sentrifuger 3300 xg i 2 min 4 ° C.
  9. Samle den klare supernatanten (atom lysat) og delmengde før lagring ved -806; C for å unngå at flere fryse-tine-sykluser som kan degradere proteinet. La en 10 pl prøve for å måle proteinkonsentrasjon ved hjelp av bichoninic syre-analyse (BCA) 31.

3. Elektro Mobility Skift Assay (EMSA)

  1. Forbered Oligo Working Stock og EMSA Gel.
    1. Hvis oligonukleotider ble bestilt i duplex, tine 100 mikrometer lager og fortynne 1: 2000 i annealing buffer for å oppnå en 50 nM arbeider lager.
    2. Hvis oligonukleotider ble bestilt enkeltrådet, tine 100 mikrometer aksjer og fortynnet 1:10 i annealing buffer for å oppnå 100 Nm aksjer. Kombiner 100 ul av 100 nM komplement tråd oppløsning med hverandre i et mikrosentrifugerør.
      1. Plasser i en varmeblokk ved 95 ° C i 5 min. Slå av varmen blokken og tillater oligoer å sakte kjøle ned til værelsetemperatur i minst en time før bruk.
    3. Forhånds kjøre EMSA Gel.
      1. Fjern lysbildet fra en pre-cast 6% TBE gel og skyll under avionisert vann flere ganger for å fjerne en hvilken som helst buffer fra brønnene. Fremstille 1 liter av 0,5x TBE-buffer ved å tilsette 50 ml av 10 x TBE til 950 ml avionisert vann.
      2. Monter gelelektroforese apparat og se etter lekkasjer ved å fylle det indre kammeret med 0.5x TBE buffer. Hvis ingen buffer lekker inn i det ytre kammer, fylle det ytre kammer omtrent to tredjedeler av veien.
      3. Pre-drevne gelen ved 100 V i 60 min.
      4. Skyll hver brønn med 200 ul 0.5x TBE buffer.
  2. Forbered Binding Buffer Master Mix.
    1. Fremstille 10 x bindingsbuffer med en endelig konsentrasjon på 100 mM Tris, 500 mM KCl, 10 mM DTT; pH 7,5 i deionisert vann.
    2. I et mikrosentrifugerør, skape en konsentrat-blanding bestående av de reagenser som er felles for alle reaksjoner (10 ul 10 x bindingsbuffer, 10 ul DTT / polysorbat, 5 ul poly d (IC), og 2,5 ul laksesperm DNA, tabell 2). Forbered en ytterligere 10%å ta hensyn til volumtapet på grunn av pipettering.
reagens Endelig Kons. Rxn # 1 Rxn # 2 Rxn # 3 Rxn # 4
ultrarent vann til 20 ul vol. 13,5 mL 11,98 mL 13.5μl 11,98 mL
10x bindingsbuffer 1x 2 pl 2 pl 2 pl 2 pl
DTT / TW-20 1x 2 pl 2 pl 2 pl 2 pl
Laks Sperm DNA 500 ng / mL 0,5 ul 0,5 ul 0,5 ul 0,5 ul
1 ug / ul Poly d (IC) 1 mikrogram 1 mL 1 mL 1 mL 1 mL
Nuclear Extract (5,26 ug / ul) 8 mikrogram - 1,52 mL - 1,52 mL
NE Buffer 1,52 mL - 1,52 mL -
Referanse allel oligo 50 fmol 1 mL 1 mL - -
Non-Reference allelet oligo 50 fmol - - 1 mL 1 mL

Tabell 2: Eksempel EMSA reaksjon SETUs. Tabellen viser et eksempel EMSA for å teste hypotesen om at det er genotype-avhengig binding av TFS til en spesifikk SNP.

  1. Legg nuklease-fritt vann til hver mikrosentrifugerør slik at det endelige volum etter tilsetning av alle reagenser som vil være 20 pl.
  2. Tilsett passende mengde (5,5 mL) master mix til hvert mikrosentrifugerør.
  3. Legg 8 mikrogram av atom lysat til de riktige mikrosentrifugerør. Inkluder rør som inneholder oligo uten kjernefysiske ekstrakt som negative kontroller (f.eks tabell 2, Rxn # 1 og Rxn # 3).
    Merk: Den optimale mengde av lysat per reaksjon må bestemmes eksperimentelt ved titrering. Vanligvis titrering et område på 2-10 ug lysat er tilstrekkelig.
  4. Tilsett 50 fmol av oligonukleotidet til de passende mikrosentrifugerør. Flick å blande og kort spinne innholdene til bunnen av røret. Inkuber i 20 minutter ved romtemperatur.
    Merk: Hvis attempting en supershift, inkuber lysatet blandingen med antistoffet i 20 minutter ved romtemperatur før tilsetning av oligoer. Det anbefales å bruke en mikrogram av en chip-grade antistoff for best resultat.
  5. Tilsett 2 mL av 10x Orange Loading Dye til hvert mikrosentrifugerør. Pipetter opp og ned for å blande.
  6. Last prøvene inn i pre-run 6% TBE gel ved å pipettere opp og ned for å blande og deretter utvise hver prøve i et eget godt. Kjør gelen ved 80 V til oransje fargestoffet har migrert 02.03 til 03.04 på veien ned gel. Dette bør ta ca 60-75 min.
  7. Fjern gel fra plastkassett ved å lirke den åpen med en gel kniv og legg gel i en beholder med 0,5% TBE buffer for å holde den tørker ut.
  8. Plassere gelen på overflaten av en infrarød og kjemiluminescens avbildningssystem, å være sikker på å eliminere eventuelle bobler eller forurensninger som vil forstyrre bildet.
  9. Bruke skannesystemprogramvaren, klikk på "Acquire" -kategorienog velg deretter "Tegn ny" for å tegne en boks rundt området som tilsvarer hvor gelen er plassert på overflaten av skanneren.
  10. I "Channels" -delen av "Acquire" -kategorien, velger du kanalen tilsvarer bølgelengden av fluoroforen koden på oligo. I "Scanner" klikker "preview" for å få en forhåndsvisning skanning lav kvalitet. Juster skanneområdet ved å dra den blå boksen rundt kjøpt forhåndsvisningsbildet ned til den delen av gelen som skal avbildes.
    Merk: For eksempel, hvis du bruker oligos merket med en 700 nm fluorophore, pass på at "700 nm" kanal er valgt før skanning.
  11. I "Scan Controls" delen velger du "84 mikrometer" oppløsning alternativ og "Medium" kvalitet alternativet. Satt fokus til forskyvning til halvparten av tykkelsen av gelen. Merk: For eksempel vil en 1 mm gel bruker en 0,5 mm fokus utlignet.
  12. I "Scanner" klikker "Start" for å beGIN skanningen.
    Merk: Under skanningen, kan lysstyrken, kontrasten og fargevalg ofte justeres manuelt avhengig av produsenten av skannesystemet.
  13. Etter at skanningen er fullført, velg "Image" og klikk "Roter eller Flip" i "Lag" for å korrigere retningen. Lagre bildefilen ved å klikke på "Export" i hovedmenyen og velg deretter "Single Image Utsikt."

4. DNA Affinity Rensing analyse (DAPA)

  1. Utarbeidelse av fem mikrometer Oligo Working lager.
    1. Hvis oligonukleotider ble bestilt i duplex, tine 100 mikrometer lager og fortynnet 1:20 i annealing buffer for å oppnå en 5 mikrometer arbeider lager.
    2. Hvis oligonukleotider ble bestilt enkeltrådet, tine 100 mikrometer aksjer og fortynnet 1:10 i annealing buffer for å oppnå 10 mikrometer arbeider aksjer. Kombiner 10 pl av 10 pM komplementære tråder med hverandre. Plasser i en varmeblokk ved 95 ° C i5 min. Slå av varmen blokken og tillater oligoer å sakte avkjøles til romtemperatur før bruk.
  2. Før start, varme bindingsbufferen, lav stringens vaskebuffer, høy stringens vaskebuffer, og eluering buffer til romtemperatur.
    Merk: En endelig konsentrasjon på 50 ng / ml poly d (IC) kan tilsettes til bindebuffer, lav stringens vaskebuffer, og høy stringens vaskbuffer for å redusere potensiell ikke-spesifikk binding av proteiner til oligoer.
  3. Forbered bindende blandinger for hver variant.
    1. Bland 1 volum av kjerne lysat med 2 volumdeler bindingsbuffer.
      Merk: Den nødvendige mengde av lysat må bestemmes eksperimentelt på grunn av varierende overflod av TFS. Ved hjelp av mellom 100 til 250 ug av kjerne lysat per kolonne er tilstrekkelig i de fleste tilfeller.
    2. Legg 1x fosfatase inhibitor, 1x proteasehemmer, og 1x bindende forsterker (valgfritt) og bland ved å flikke røret flere ganger.
      Merk: 100X bindendeenhancer består av 750 mM MgCl2 og 300 mM ZnCl2. Legg binding enhancer dersom binding av TF til DNA er avhengig av kofaktorer eller reduksjonsmidler. Hvis denne informasjonen ikke er kjent, legger bindingen enhancer.
    3. Tilsett 10 ul av 5 uM biotinylert fange DNA (50 pmol) av hver respektive bindingsblanding. Inkuber i 20 minutter ved romtemperatur.
      Merk: Inkubasjonstid, og temperaturen kan variere avhengig av TF. De optimale verdier må bestemmes eksperimentelt.
  4. Tilsett 100 ul streptavidin-mikroperler. Inkuber i 10 minutter ved romtemperatur.
  5. For hver oligo probe som testes, plasserer en bindende kolonne i magnetisk separator. Plassere et mikrosentrifugerør direkte under hver binding kolonne og anvende 100 ul av bindingsbuffer for å skylle kolonnen.
  6. Pipette innholdet i hver bindingsblandingen i separate kolonner og tillate væsken å strømme fullstendig gjennom kolonnen inn i mikrorøret før du fortsetter. Sørge for å merke kolonnene med den varianten oligo som ble anvendt i bindingsblandingen. Label gjennomstrømningsprøver og erstatte med nye mikrosentrifugerør å samle lav stringens vasker.
  7. Anvende 100 ul lav-stringens vaskebuffer til kolonnen; vente til kolonnen beholderen er tom. Gjenta vask 4x. Label lav stringens vaskeprøver og erstatte med nye mikrosentrifugerør å samle høy stringens vasker.
  8. Anvende 100 pl høy-stringens vask buffer til kolonnen; vente til kolonnen beholderen er tom. Gjenta vask 4x. Label høy stringens vaskeprøver og erstatte med nye mikrosentrifugerør å samle pre-eluering.
  9. Tilsett 30 ul innfødt elueringsbuffer til kolonnen og la stå i 5 min. Merke pre-elusjonstester prøver og erstatte med nye mikrosentrifugerør å samle eluering.
    Merk: Dette betyr ikke eluere bundet protein; det vasker de resterende høy stringensbuffer ut av kolonnen og erstatter den med elueringsbuffer for å maksimere effektiviteten av eluering.
  10. Legge til en ytterligere 50 ul innfødt elueringsbuffer for å eluere de bundne TFS. For et høyere utbytte, men mindre konsentrerte eluat, tilsett ytterligere 50 ul av opprinnelig elueringsbufferen og samle gjennomstrømnings.
    Merk: Analyser elusjonstester prøver gjennom massespektrometri for å fastslå identiteten til den bundne TFS 32. Etterpå verifisere proteomikk resultater gjennom natriumdodecylsulfat sulfitt polyakrylamidgelelektroforese (SDS-PAGE) etterfulgt av en Western blot 33. Hvis massespektrometri ikke er tilgjengelig, kjøre en sølvfarging ved hjelp av standard teknikk i stedet for en Western blot for å bestemme størrelsen av protein (er) som viser genotype-avhengige binding. Bruk denne informasjonen til å innskrenke listen over spådd TFS fra beregnings tilnærminger beskrevet i innledningen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I denne delen er representative resultatene av hva du kan forvente gitt når du utfører en EMSA eller DAPA, og variasjon med hensyn til kvaliteten på lysat er preget. For eksempel har det blitt foreslått at frysing og tining proteinprøver flere ganger kan resultere i denaturering. For å undersøke reproduserbarheten av EMSA analyse i forbindelse med disse "fryse-tine" sykluser, ble to 35 bp oligonukleotider forskjellige ved en genetisk variant inkubert med et enkelt parti av kjernefysisk lysat som ble tint og re-frosset for den angitte mengden . ganger Figur 2 viser at frysing og tining denne bestemte B-lymfocytt atom ekstrakt opp til 5 ganger, har de tilsynelatende ingen effekt på integriteten av proteinene; imidlertid stabiliteten av kjerneprotein varierer fra prøvene og bør derfor prøves på hver enkelt cellelinje som brukes. Det er også mulig å ha forskjellig variasjon fra sats preparasjon av atomlysatene. Hvorvidt denne varianten er på grunn av fasen av cellesyklusen før lysering, celle passasje nummer, eller andre faktorer, er det viktig å replikere EMSA resultater ved bruk av forskjellige partier av lysat for å sikre at virkelige resultater.

I tillegg er det viktig å optimere signal-til-støy-forholdet for det EMSA. En viktig variabel i denne er det oligo konsentrasjon. Mengden av oligo (5-300 fmol) ble titrert for å vurdere hvordan ulike mengder av oligonukleotider påvirke signalet (figur 3). En økning i intensiteten av båndet opp til 100 fmol av oligo ble observert. Etter dette tidspunkt signalet platåer som tyder på 100 fmol er den optimale oligo beløp for denne EMSA reaksjon.

Endelig er en representant figur fra en av våre publiserte studier med en del av strategien er beskrevet i dette manuskriptet levert (figur 4). i ther studien 34, viste vi at lupus-assosiert risiko allel av rs6590330 øker binding av STAT1, en ​​transkripsjonsfaktor som deltar i både synergistisk aktivering og hemming av genekspresjon nedstrøms av type 1 IFN reseptor kompleks 35. I dette eksempel ble STAT1 først identifisert av DAPA fulgt av proteomikk analyse ved hjelp av høy ytelse væskekromatografi koblet til tandem massespektroskopi (DAPA-MS). En DAPA-Western blot ble brukt til å bekrefte TF identifisert fra proteomikk analyse (STAT1) og bekrefter at fosforylert form av STAT1 ble binding til ikke-referanse (lupus-risiko) oligo. Denne figuren illustrerer hvordan de ulike analyser i denne strategien kan brukes til å identifisere differensial binding av transkripsjonsfaktoren til en ikke-kodende variant.

Figur 2
Figur 2: Analyse av reproduserbarhetog konsekvensene av fryse-tine-sykluser på EMSA resultater. oligoer som inneholdt referanse (R) eller ikke-referanse (NR) allel av en genetisk variant ble anvendt for å probe det samme preparatet av lysat etter flere sykluser med frysing og tining. (Lys: Lysate). Hver bane inneholder den frie proben ved bunnen av gelen (blå pil). Binding av TFS til oligo kan sees som et band i den øverste halvdelen av gelen (rød pil). Band som finnes i den nederste halvdelen av gel (se brakett) er uspesifikke. Klikk her for å se en større versjon av dette tallet.

Figur 3
Fig. 3: Vurdering av effekten av forskjellige konsentrasjoner av oligo Forskjellige konsentrasjoner av oligonukleotider ble anvendt for å probe et enkelt preparat av kjernefysisk lysat. Fluorescent signal øker med økende mengder oligo, noe som indikerer at oligo er den begrensende reagensen. Signal platåer ved 100-300 fmol baner, hvor mengden protein blir den begrensende reagens. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4: lupus risiko allel av rs6590330 øker STAT1 binding, som vurderes av DAPA-MS STAT1 og pSTAT1 utstillings høyere binding til oligos inneholder rs6590330 risiko allel i forhold til ikke-risiko allel.. Biotin-merkede oligonukleotidene ble inkubert med Epstein-Barr-virus-transformerte B-cell nuclear ekstrakt. Proteiner bundet til oligo ble tatt med DAPA. Proteiner ble deretter separert ved SDS-polyakrylamid-gel-elektroforese og påvist ved å bruke anti-pSTAT1(A) eller anti-STAT1 (B). M: Marker. NR: oligo inneholder ikke-risiko allel av rs6590330; R: oligo inneholder risiko allel av rs6590330; Mutant: oligo inneholder en forstyrret antatt STAT1 bindingssete nedstrøms rs6590330; Cellelysat: atom ekstrakt fra B-celler. De relative intensiteter av båndene er angitt under hvert bånd. Resultatene er representative for fire eksperimenter; mens alle eksperimentene demonstrerte øket STAT1 binding til probene med risiko allel, i 2/4 eksperimenter ikke STAT1 eller pSTAT1 ble detektert i immunpresipitatet fra den ikke-risiko oligo, mens begge ble detektert i immunpresipitatet fra risikoen oligo. Dette tallet har blitt modifisert fra referanse 34. Klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Selv om fremskritt i sekvensering og genotyping teknologi har kraftig forbedret vår evne til å identifisere genetiske varianter assosiert med sykdom, er vår evne til å forstå de funksjonelle mekanismer som påvirkes av disse variantene lagging. En hovedkilde til problemet er at mange sykdomsassosierte variantene er lokalisert i n on-kodende regioner av genomet, som sannsynligvis påvirke vanskeligere å forutsi mekanismene som kontrollerer genekspresjon. Her presenterer vi en protokoll basert på EMSA og DAPA teknikker, verdifulle molekylære verktøy for identifisering av genotype avhengig TF bindende hendelser som trolig bidrar til funksjonen av mange ikke-koding varianter. Selv om disse to teknikker er blitt brukt i stor utstrekning i det siste, de er bare nylig blitt tilpasset for genetisk variant analyse av TF-binding. Utover TFS, kan EMSA også brukes til å analysere effekten av genetiske varianter på RNA-bindende proteiner med kun mindre justeringer av protokollen 36.

ove_content "> Protokollen som presenteres her er enkel og lett å utføre,. likevel visse deler krever ytterligere betraktninger før eksperimentering det første er det viktig å skape en første liste over varianter for vurdering ved å gjennomføre strenge statistiske analyser en feil i dette trinnet. kan spore alle nedstrøms analyser, så mange varianter kan binde kjerne lysat differensielt uten at det medfører risiko for sykdom. i tillegg er avgjørende ved bruk av funksjonelle genomdata utføres i relevante celletyper, kan som irrelevante celletyper fører til genereringen av falske positive TF bindings spådommer. Foreløpig mest brukte funksjonelle ressurser genomiske inkluderer KODE 12 og veikart Epigenomics 17. Ytterligere informasjon om genuttrykk nivåer i celletyper som er relevante for en sykdom av interesse kan være hentet fra andre ressurser som ImmGen 37, BioGPS 38, 39, og SNPsea 20. For eksempel, slik resources kan brukes til å filtrere TF bindende forutsigelser til kun å gjelde de TFS som kommer til uttrykk i relevante celletyper.

Det er også viktig å vurdere begrensninger av in vitro eksperimenter som EMSA og DAPA. Spesielt er det nødvendig å gjenta forsøk med separate kjerne lysat-preparater for å redusere falske negativer. Videre kan en vellykket EMSA-supershift stede som en ytterligere forskyvning i EMSA-båndet, hvor antistoffet binder seg til TF, eller et tap av band, i hvilket antistoff blokkerer TF største DNA-bindende domene. I begge tilfeller, inkludert en isotype kontroll-antistoff og / eller et antistoff mot en annen TF er nyttig i å bekrefte spesifisiteten til supershift. Et annet hensyn ved gjennomføring av en supershift er om å inkludere DTT / polysorbat i reaksjonen. DTT / polysorbat stabiliserer lasting fargestoff som åpner for mer nøyaktig kvantifisering av ubundet DNA; Det kan imidlertid også redusere disulfidbindingene til antistoffer resultereing i svikt i EMSA-supershift. Det anbefales å prøve reaksjoner med og uten DTT / polysorbat når du forsøker å supershift et kompleks. Den optimale mengden av poly d (IC) og laksesperma DNA per reaksjon må bestemmes eksperimentelt ved titrering. Vanligvis titrering et område på 1-6 ug poly d (IC) og 50-500 ng laksesperm er tilstrekkelig. Et nyttig positiv kontroll for DAPA innebærer å bruke en konsensus sekvens for en TF med en godt karakterisert bindende motiv (hentet fra databaser som CIS-BP 23 eller Factorbook 40) og kjører en vestlig med et antistoff spesifikt for at TF. For begge analysene, kan en egge oligo brukes til å vise at enhver observert binding er spesifikke for oligonukleotider av interesse.

Både EMSA og DAPA teknikker har eksperimentelle begrensninger. For eksempel er bindingsaffiniteten mellom en TF og DNA påvirkes i stor grad av bufferbetingelsene. Ideelt sett bør bufferbetingelsene ligne den endogene conditions av kjernen for å tillate optimal binding. For EMSA, kan feilaktig buffer forhold resulterer i et svakt bånd eller tap av et band i sin helhet. For DAPA kan ikke-ideelle forhold bevirke at TF (e) som skal elueres under vasketrinnene. Derfor er hver analyse bare effektive for å identifisere TF-oligo-binding under visse bufferbetingelser. Den mest universelt nyttige bufferbetingelser er presentert i protokollen ovenfor. En annen begrensning er at de eksperimentelle resultatene fra EMSA og DAPA metoder gir lite informasjon om hvilke mekanismer gjennom hvilke TFS binder til oligos. TFS kunne binde seg til oligos direkte eller bli rekruttert av andre faktorer. Følgelig er det viktig å analysere oligo sekvensene beregningsmessig for å forutsi hvordan TF'er kunne binde til oligoer og bekrefte disse forutsigelsene eksperimentelt. For eksempel kan en spesifikk bindingssekvens bli mutert eller en bindingspartner kan eksperimentelt oppbrukt. Til slutt må mengden av ekstrakt som brukes til å bli titrert for hvert eksperiment to skaffe optimale resultater. For mye lysat kan mette TF-oligo bindende og utydelig differensial binding mellom risiko og ikke-risiko alleler. For ytterligere feilsøking, kan leseren referere til flere gode anmeldelser og metode manuskripter 30,41,42.

I tillegg til de analyser som er beskrevet her, er det en rekke av in vivo-analyser er tilgjengelige for ytterligere å studere rollen til variantene i levende celler (figur 1, nederst). Chromatin immunoprecipitation fulgt av allel-spesifikk kvantitativ polymerase kjedereaksjoner (Chip-qPCR) studiene kan gjennomføres for å finne ut om differensial binding observert i løpet av de in vitro analyser er kopiert i levende celler 34. For eksempel, hvis celler er heterozygote for en variant av interesse blir brukt, kan qPCR eksperimenter detektere forskjellen i anrikning mellom de to allelene i TF immunopresipitert kromatin. ChIP krever spesifikke ChIP-klasse antistoffer; however, hvis ChIP-grade TF antistoffer er utilgjengelig, trans celler med et flagg-merket TF er et effektivt alternativ 43. I tillegg kan effekten av differensial bindende mål genekspresjon bli undersøkt gjennom uttrykk kvantitativ egenskap loci (eQTL) analyse i relevante celletyper ved hjelp av lokalt innsamlede uttrykk data fra genotypet celler eller offentlig tilgjengelige ressurser slik som de utarbeidet av Genevar 44. Luciferaserapportørplasmid assays kan også bli brukt til å utforske den grad til hvilken differensial binding av proteinet som påvirker genekspresjon. Slike analyser kan bli modifisert til å arbeide uavhengig av om variantene er plassert i en promoter, enhancer, eller repressor region 45-47. Til slutt, genom-redigering teknologier som CRISPR / Cas9 48, kan brukes til å generere cellelinjer som skiller seg bare ved en enkelt variant, som er viktig for å bekrefte årsakssammenheng. Slike teknologier kan vesentlig redusere den eksperimentelle variansen observert between cellelinjer som stammer fra genetisk ulike fag, siden funksjonelle leselig analysere genuttrykk eller annen sykdom mellom fenotype kan utføres på den redigerte cellelinje, og sammenlignet med ikke-redigerte cellelinjer.

Den største fordelen med strategien som presenteres er at det muliggjør enkel og rask påvisning av genotype avhengige TF bindende. Ved å prioritere de viktigste genetiske varianter kan videre eksperimenter være konstruert for å identifisere deres biologiske effekt og demonstrere sin kausalitet. Spesielt, kan denne protokollen brukes til å undersøke noen sykdom eller fenotype assosiert variant identifisert fra GWAS eller fin-kartlegging. Et stort, voksende trove av genetisk informasjon og lister over statistisk tilhørende genetiske varianter er allerede tilgjengelig. I de fleste tilfeller, de biologiske mekanismene som driver statistisk sammenslutning av disse variantene er ikke klart. Strategien er skissert i dette forslaget gir mulighet for nøyaktig funksjonell tolkning av de mange ikke-kodende disease-tilknyttede varianter. Slik kunnskap er viktig for hele belyse de molekylære mekanismene som driver noen genetisk-baserte sykdom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noe å avsløre.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics