Циркулирующие микроРНК Количественное Использование ДНК-связывающих Dye Химия и дроплет Digital PCR

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Циркулирующие (бесклеточных) микроРНК (миРНК) освобождаются из клеток в кровоток. Количество специфических микроРНК в обращении было связано с болезненным состоянием и имеет потенциал для использования в качестве биомаркеров заболеваний. Чувствительный и точный метод циркулирующих микроРНК количественной оценки с использованием химии на основе красителя и капелька цифровые технологии ПЦР была недавно разработана. В частности, с использованием Закрытые нуклеиновых кислот (LNA) основе микроРНК специфических праймеров, с зеленым флуоресцентным ДНК-связывающего красителя в совместимой капельной системе цифровой ПЦР, то можно получить абсолютное количественное определение специфических микроРНК. Здесь мы опишем, как выполнять эту технику, чтобы оценить количество микроРНК в биологических жидкостях, таких как плазма и сыворотки, является возможным и эффективным.

Protocol

МикроРНК Изоляция от плазмы или сыворотки

Примечание: плазменная панель и подготовка сыворотки является важным шагом в распространении микроРНК количественной оценки. Там нет предпочтительного процедура для плазмы и сыворотки крови препарата. Единственная важная вещь, чтобы рассмотреть, что все образцы из того же эксперимента должны быть обработаны с использованием точно такой же рабочий процесс. Начать с 200 мкл сыворотки или плазмы. Общую РНК может быть выделена из сыворотки или плазмы крови с использованием коммерчески доступных наборов.

1. Протокол Общую РНК (включая микроРНК) Изоляция

  1. Оттепель образцы сыворотки / плазмы на льду.
  2. Добавляют 1 мл лизирующего реагента (например., QIAzol) до 200 мкл сыворотки / плазмы.
  3. Смешайте встряхиванием и поместите пробирку, содержащую гомогената на скамье при комнатной температуре в течение 5 мин.
  4. Добавьте 3 мкл 4,16 нМ раствора синтетического микроРНК Cel-MIR-39-3p из C. Элеганс.
  5. Добавить 200 мкл хлороформа. Встряхнуть пробирку энергично в течение 15 сек. Место йе трубки на скамье при комнатной температуре в течение 2 мин.
  6. Центрифуга в течение 15 мин при 12000 х г при 4 ° С для получения разделения фаз: верхняя водная фаза содержит РНК.
  7. Передача водной фазы в новую пробирку, около 700 мкл, избежать переноса любого белого межфазного материала.
  8. Добавьте 1 мл 100% этанола и перемешать с помощью инверсии.
  9. Пипеткой до 700 мкл образца в мини-ротационную колонку помещают на пробирку 2 мл. Закройте крышку и центрифуге при 12000 мкг в течение 15 сек. Выбросьте проточные.
  10. Повторите этот шаг, используя оставшуюся пробу.
  11. Добавить 700 мкл буфера RWT в мини-ротационную колонку, закройте крышку и центрифуги в течение 15 сек при 12000 мкг для промывки колонки. Выбросьте проточные.
  12. Пипеткой 500 мкл буфера RPE в мини-ротационную колонку. Закройте крышку и центрифуге в течение 15 секунд при 12000 оборотов в минуту. Выбросьте проточные. Повторите этот шаг еще раз.
  13. Центрифуга мини-колонки спина на полной скорости в течение 2 мин, чтобы высушить колонку отжимаМембрана из остаточного этанола.
  14. Перенести мини-колонки спиновый на новый 1,5 мл пробирку для сбора и пипетка 35 мкл РНКазы без воды на мембране колонны.
  15. Центрифуга в течение 1 мин при 12000 х г, чтобы элюировать РНК.
  16. Хранить РНК при температуре -80 ° С.
    Примечание: Поскольку концентрация РНК не может быть определена точно, использование фиксированных объемов в качестве меры внесенной суммы.

2. микроРНК с обратной транскрипцией

  1. Растаяйте обратной транскрипции (RT) компонентов смеси реагентов: 5х реакционного буфера, нуклеазы без воды. Смешайте аккуратно перевернув пробирки и место на льду. Непосредственно перед использованием, удалите смесь фермента из морозилки и поместить на лед. Спин вниз все реагенты.
  2. Приготовьте смесь реагентов RT на льду , как описано в таблице 1. Подготовьте по крайней мере , на 10% превышающую смеси.
  3. Смешайте реакцию пипеткой, а затем спином вниз.
  4. Инкубировать в течение 60 мин при 42 ° С.
  5. Тепло-инактивировать REVERС. Е. транскриптазы в течение 5 мин при 95 ° С.
  6. Остудите до 4 ° C.
  7. Хранить кДНК при -20 ° С.

3. кДНК Разбавление

  1. Развести количество матрицы кДНК, необходимой для запланированных реакций ddPCR в нуклеазы свободной воды. Разбавляют реакционную смесь кДНК между 1:50 и 1: 500 в воде, в зависимости от целевой микроРНК изобилия. Хранить разбавленный кДНК при -20 & deg; С. Разбавленный кДНК оказалась стабильной в течение по крайней мере 3 месяцев при -20 ° С.

4. Капелька Генерация и ПЦР

Примечание: Капелька поколение должно быть выполнено на 8 образцов одновременно. Технические повторности не требуется, в связи с высокой воспроизводимостью этой технологии 12,15 .A Нет Шаблон управления (НТК) образец должен быть запущен в каждой пластине и для каждого различного состояния ddPCR.

  1. Оттепель и уравновешивания основной смеси (например., EvaGreen Master Mix), набор праймеров микроРНК и кДНК при комнатной температуре.
  2. Смешайте ю Master Mixoroughly путем переворачивания пробирки несколько раз. Спин вниз все реагенты.
  3. Приготовьте смесь ddPCR , как описано в таблице 2. Когда несколько реакций ddPCR выполняются, подготовить ddPCR смешивать рабочее-решение. Подготовьте по крайней мере, на 10% превышающую смеси.
  4. После сборки, тщательно перемешать и спин вниз смесь ddPCR.
  5. Налейте 12 мкл ddPCR перемешивать в 96-луночный планшет для ПЦР или ПЦР-пробирки.
  6. Добавить 8 мкл разведенного матрицы кДНК в каждую пробирку / лунку.
  7. Вставьте картридж генератора капель в держатель.
  8. Передача 20 мкл каждого подготовленного образца к образцу скважин (средний ряд) картриджа генератора капель осторожно, избегая при этом воздушные пузырьки на дне колодца.
  9. Заполните каждую нефтяную скважину (нижний ряд) с 70 мкл генератора капель масла.
  10. Крючок прокладку над держателя картриджа и вставьте в генератор капель.
  11. Закройте крышку, чтобы начать капельной поколения в соответствии с пр производителяotocol. Когда поколение капелька закончена, откройте крышку, снимите одноразовую прокладку. Верхние скважины картриджа содержат капли.
  12. Пипеткой медленно и плавно 40 мкл содержимого восьми верхних лунок (капель) в одну колонку пластины 96-луночного ПЦР.
  13. Уплотнение пластины ПЦР с фольгой сразу после переноса капель, чтобы избежать испарения. Используйте прокалыванию уплотнения плиты фольги, которые совместимы с иглами в считывающее капельным.
  14. Начинают Амплифицируйте (ПЦР) в течение 30 мин после герметизации пластины.
  15. Выполнение протокола велосипедный в соответствии с таблицей 3.

5. Капелька Чтение

  1. Мощность на читателя капель.
  2. Переместить пластинку из термоциклеру к читателю капельным.
  3. Поместите 96-луночный ПЦР планшет, содержащий пост-ПЦР капель в основание держателя пластин.
  4. Поместите верхнюю часть держателя пластины на пластине ПЦР. Твердо нажмите обе защелкивниз, чтобы закрепить пластину ПЦР в держателе.
  5. Запустите программу из системы ПК.
    1. Нажмите Setup, чтобы определить эксперимент (абсолютная количественная оценка) нажмите кнопку Выполнить, чтобы начать чтение капель.
    2. При чтении капелька будет завершена, нажмите кнопку "Анализ" кнопку, чтобы открыть и анализировать данные.
    3. Используйте амплитудной участок 2D в программное обеспечение для анализа , чтобы выбрать положительные капли (лассо) (рис 1б).
    4. Используйте вкладку События, чтобы проверить количество положительных и полных капель. Общее количество 18.000 - 21000 капель обычно достигается с probeless ddPCR.
    5. После того, как положительные капли выбраны, экспортировать значения концентрации микроРНК с использованием экспортных .csv опции на вкладке концентрации.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Абсолютное количество специфических микроРНК на мл плазмы или сыворотки крови может быть определена с использованием зеленого флуоресцентного ДНК-связывающий краситель и капелька цифровые технологии PCR. На рисунке 1 представлен процесс положительного-капельным отбора, который определяет конечную концентрацию микроРНК (копий / мкл ) в реакции амплификации, рассчитанной с помощью программного обеспечения для анализа. Сумма каждого микроРНК в крови сильно отличается, будучи некоторые виды микроРНК более многочисленны, чем другие. Использование 1:50 разбавленный кДНК в реакции ddPCR можно получить достаточное количество положительных и отрицательных капель. В случае положительного насыщения капельным (например., Не содержащие отрицательных капель), дальнейшее разбавление образцов кДНК может быть необходимым.

Каждый набор праймеров МШУ должен быть оптимизирован для правильной работы на капельной системе цифровой ПЦР. Процесс оптимизации для MIR-181A-5p являетсяпредставлена ​​на рисунке 2 В частности, изменяя количество праймера ( как правило , в диапазоне от 0,25 - 1 мкл на реакцию ddPCR). и температура отжига (обычно в диапазоне от 56 - 60 ° С), можно выбрать комбинацию что определяет лучшее разделение между положительными и отрицательными капельками. В случае MIR-181A-5p, 60 ° C температуры отжига и обоих количеств мкл праймера 0,5 и 1 обеспечивают лучший результат с точки зрения амплитуды капель.

Может случиться так, что набор праймеров дает некоторую неспецифической амплификации, вероятно, из-за праймер-димеров образование. При работе с циркулирующим микроРНК, положительный сигнал из образцов может быть очень низким, и, следовательно, похож на неспецифического сигнала. Если "облако" неспецифической амплификации мишени не перекрывается с истинного сигнала (рис 1C), миРНК до сих пор может быть определена количественно выбрать только истинный положительные капли. В этом случае, НТК образец имеет важное значение для выбора капельным. Все образцы, которые будут включены в том же анализе должны быть обработаны с использованием той же методики и идентичные условия ddPCR.

Рисунок 1
Рисунок 1. Выбор Положительные Капельки. Положительные капли выбраны вручную в ходе анализа с использованием порогового уровня выше отрицательных капель в 1D участке (A) или выполняя круг вокруг положительного облака капель в 2D участке (B). Если какой - либо набор праймеров дает неспецифической амплификации, об этом свидетельствует второе облако положительных капель , который появляется в отрицательном контроле (отсутствие управления шаблонами NTC) образца (С). "Истинное" позитивы все еще может быть выбран без учета неспецифического сигнала в 2D сюжет.e.jpg "целевых =" _blank "> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Праймер Оптимизация для бесклеточной микроРНК Количественное с Probeless ddPCR Верхняя панель:. Количественное MIR-181A-5p в двух образцах плазмы (S1 и S2) , используя 4 различных условий ddPCR. Концентрация MIR-181a-5p МШУ праймера (0,5 и 1 мкл) и температуры отжига (58 и 60 ° C) влияют на амплитуду положительной (синий) и отрицательные (черные) капли в ДНК-интеркаляции красителя ddPCR. Лучшее разделение для этого микроРНК может быть получена выполнением ПЦР при 60 ° С и с использованием либо 0,5 или 1 мкл праймера. Контрольный образец (NTC, No Template Control) не имеет положительных капель, как и ожидалось. Центральная панель: Конечная концентрация MIR-181-5p в указанных выше условиях. Результаты представлены в виде копий на микролитр в AMPLIфикации реакция. Столбики ошибок обозначают Пуассона 95% доверительный интервал. Нижняя панель:. Количество положительных капель (синий) на общее количество капель (зеленый цвет) Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

реактив Объем (мкл)
Буфер реакции 5x 4
Нуклеазы без воды 11
Фермент смесь 2
Тотальную матричную РНК 3
Общий объем 20

Таблица 1 - с обратной транскрипцией Реагент компонентов смеси

реактив Объем (мкл)
2x ДНК-связывающий краситель Supermix 10
Набор праймеров МШУ переменная (0,5 - 1) *
Нуклеазы без воды переменная
Разведенные шаблон кДНК 8
Общий объем 20
* Первая реакция ddPCR должна выполнять с несколькими образцами, чтобы установить наиболее рабочее количество праймера

Таблица 2 - ddPCR Реагент компонентов смеси

Велоспорт Шаг температура Время Ramping Оценить циклы
Фермент активации 95 ° C 5 мин ~ 2 ° С / сек 1
денатурация 95 ° C 30 сек 40
Отжиг / расширение 60 ° C 1 мин
стабилизация сигнала 4 ° C 5 мин 1
90 ° C 5 мин 1
Удержание (по желанию) 4 ° C бесконечный 1
Используйте подогреваемый крышку установить до 105 ° C и установить объем образца 40 мкл.

Таблица 3 - Амплифицируйте Условия для дроплета Digital PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Циркулирующие микроРНК присутствуют в крови при очень низких концентрациях, и количество РНК, которые могут быть извлечены из плазмы и сыворотки крови низка. По этой причине, их трудно количественно с другими методами, такими как микрочипов и РНК-последовательности. Кроме того, существует общее отсутствие соглашения о нормализации данных и наличие эндогенных "эталонных" микроРНК в крови. В этом контексте, чувствительная технология, как капельной цифровой ПЦР, способный подсчета количества микроРНК копий на мл сыворотки или плазмы, даже если очень низкой, очень привлекателен. Мы в паре эту технологию с универсальной системой кДНК, что реверс-транскрибирует все циркулирующие микроРНК в одной реакции, поэтому экономия времени и, самое главное, РНК материала. В нашем подходе специфика присуща использованию LNA праймеров, которые выполняются очень хорошо в микроРНК количественной оценке по сравнению с другими решениями 16.

Капелькацифровой ПЦР представляет собой анализ конечных точек, что позволяет рассчитать генов-мишеней абсолютной концентрации. В отличие от количественной ПЦР, недостаточная эффективность амплификации не влияют на конечный ddPCR количественной оценки. Поэтому, принимая во внимание количество ингибиторов ПЦР, присутствующих, например, в образцах крови, ddPCR обеспечивает надежный инструмент для циркулирующих нуклеиновых кислот оценки.

Благодаря своей высокой чувствительности, технология обеспечивает адекватную количественную оценку также и менее обильными микроРНК, даже с ограниченным количеством исходного материала. Кроме того, если предположить, что каждая молекула микроРНК является обратной транскрипции в молекуле кДНК, мы можем вычислить абсолютные копии в 1 мкл плазмы / сыворотки умножая полученную концентрацию в величины реакции ddPCR для коэффициента разбавления (145.83).

Представленный рабочий процесс может быть легко выполнена на 8-96 образцах, в то время, обеспечивая тем самым надежную и времени эффективный инструмент для микроРНК квантификации в Clinicaл пробы. Капелька цифровой ПЦР имеет потенциал, чтобы стать важным инструментом для нуклеиновых кислот биомаркеров оценки в диагностической установке, тем самым вовлекая жидкость биопсию со скамейки к постели больного.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

При поддержке финансирования из итальянской ассоциации по исследованию рака (AIRC) к MF (MFAG 11676) и MN (Специальная программа молекулярной клинической онкологии. - 5 промилле п 9980, 2010/15) и от итальянского Министерства обучения, университет и Исследования FIRB 2011 для MN (Project RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics