परिसंचारी MicroRNA मात्रा डीएनए बाध्यकारी डाई रसायन विज्ञान और छोटी बूंद डिजिटल पीसीआर का उपयोग

Bioengineering

GE Global Research must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

microRNAs (miRNAs) (सेल मुक्त का) परिसंचारी रक्त प्रवाह में कोशिकाओं से जारी कर रहे हैं। संचलन में विशिष्ट microRNAs की राशि एक रोग राज्य से जोड़ा गया है और संभावित रोग बायोमार्कर के रूप में इस्तेमाल किया जाना है। microRNA मात्रा का ठहराव घूम एक डाई आधारित रसायन विज्ञान का उपयोग और डिजिटल पीसीआर प्रौद्योगिकी छोटी बूंद के लिए एक संवेदनशील और सटीक विधि हाल ही में विकसित किया गया है। विशेष रूप से, बंद का उपयोग न्यूक्लिक एसिड (LNA) एक संगत छोटी बूंद डिजिटल पीसीआर प्रणाली यह विशिष्ट miRNAs की पूर्ण मात्रा का ठहराव प्राप्त करने के लिए संभव है में एक हरी फ्लोरोसेंट डीएनए बाध्यकारी डाई के साथ miRNA विशिष्ट प्राइमरों आधारित। यहाँ, हम वर्णन कैसे इस तकनीक का प्रदर्शन ऐसे प्लाज्मा और सीरम के रूप में जैविक तरल पदार्थ, में miRNA राशि का आकलन करने के लिए, दोनों व्यावहारिक और प्रभावी है।

Protocol

प्लाज्मा या सीरम से MicroRNA अलगाव

नोट: प्लाज्मा और सीरम तैयारी miRNA मात्रा का ठहराव घूम में एक प्रासंगिक कदम है। वहाँ प्लाज्मा और सीरम तैयारी के लिए कोई पसंदीदा प्रक्रिया है। केवल महत्वपूर्ण बात पर विचार करना है कि एक ही प्रयोग से सभी नमूनों में बिल्कुल वैसा ही कार्यप्रवाह का उपयोग संसाधित किया जाना चाहिए। 200 μl सीरम या प्लाज्मा से शुरू करें। कुल शाही सेना व्यावसायिक रूप से उपलब्ध किट का उपयोग कर सीरम या प्लाज्मा से अलग किया जा सकता है।

1. कुल शाही सेना (miRNA सहित) के लिए प्रोटोकॉल अलगाव

  1. बर्फ पर पिघलना सीरम / प्लाज्मा नमूने हैं।
  2. 200 μl सीरम / प्लाज्मा को Lysis अभिकर्मक (जैसे।, QIAzol) के 1 मिलीलीटर जोड़ें।
  3. vortexing द्वारा मिक्स और 5 मिनट के लिए आरटी पर बेंच पर homogenate युक्त ट्यूब जगह है।
  4. सी से सिंथेटिक miRNA सेल-मीर 39-3p की एक 4.16 एनएम समाधान के 3 μl जोड़े एलिगेंस।
  5. क्लोरोफॉर्म के 200 μl जोड़ें। 15 सेकंड के लिए सख्ती ट्यूब हिला। प्लेस वें2 मिनट के लिए आरटी पर बेंच पर ई ट्यूब।
  6. 4 डिग्री सेल्सियस पर 12,000 XG पर 15 मिनट के लिए अपकेंद्रित्र के चरण जुदाई प्राप्त करने के लिए ऊपरी जलीय चरण में शामिल आरएनए।
  7. एक नया ट्यूब जलीय चरण स्थानांतरण, के बारे में 700 μl, किसी भी सफेद अंतरावस्था सामग्री के हस्तांतरण से बचें।
  8. 100% इथेनॉल के 1 मिलीलीटर जोड़ें और उलटा द्वारा मिश्रण।
  9. Pipet को एक मिनी स्पिन स्तंभ में नमूना के 700 μl एक 2 मिलीलीटर संग्रह ट्यूब पर रखा। 15 सेकंड के लिए 12,000 XG पर ढक्कन और सेंट्रीफ्यूज को बंद करें। प्रवाह के माध्यम से त्यागें।
  10. इस कदम के शेष नमूना का उपयोग कर दोहराएँ।
  11. मिनी स्पिन स्तंभ के लिए 700 μl बफर RWT जोड़ें, स्तंभ धोने के लिए 12,000 XG पर 15 सेकंड के लिए ढक्कन और सेंट्रीफ्यूज को बंद करें। प्रवाह के माध्यम से त्यागें।
  12. मिनी स्पिन स्तंभ में Pipet 500 μl बफर RPE। 12,000 rpm पर 15 सेकंड के लिए ढक्कन और सेंट्रीफ्यूज को बंद करें। प्रवाह के माध्यम से त्यागें। इस कदम फिर से दोहराएँ।
  13. 2 मिनट के लिए पूरी गति से मिनी स्पिन स्तंभ अपकेंद्रित्र स्पिन स्तंभ सुखाने के लिएअवशिष्ट इथेनॉल से झिल्ली।
  14. स्तंभ की झिल्ली पर एक नया 1.5 मिलीलीटर संग्रह ट्यूब और pipet 35 μl RNase मुक्त पानी के लिए मिनी स्पिन स्तंभ स्थानांतरण।
  15. 12,000 XG पर 1 मिनट के लिए अपकेंद्रित्र आरएनए elute करने के लिए।
  16. -80 डिग्री सेल्सियस पर शाही सेना को स्टोर।
    नोट: चूंकि आरएनए एकाग्रता सही निर्धारित नहीं किया जा सकता, इनपुट राशि के लिए एक उपाय के रूप में तय की मात्रा का उपयोग करें।

2. MicroRNA रिवर्स प्रतिलेखन

  1. 5x प्रतिक्रिया बफर, nuclease मुक्त पानी: रिवर्स प्रतिलेखन (आरटी) अभिकर्मक मिश्रण घटकों गला लें। मिक्स धीरे बर्फ पर ट्यूब और जगह inverting। तुरंत उपयोग करने से पहले, फ्रीजर से एंजाइम मिश्रण को हटाने और बर्फ पर जगह है। सभी अभिकर्मकों स्पिन।
  2. तालिका 1 में वर्णित के रूप में बर्फ पर आरटी अभिकर्मक मिश्रण तैयार करें। कम से कम 10% से अधिक मिश्रण तैयार करें।
  3. pipetting द्वारा प्रतिक्रिया मिश्रण है, और फिर नीचे स्पिन।
  4. 42 सेल्सियस पर 60 मिनट के लिए सेते हैं।
  5. लौ गर्मी निष्क्रिय95 सेल्सियस पर 5 मिनट के लिए एसई ट्रांसक्रिप्टेज।
  6. इसके तत्काल बाद 4 डिग्री सेल्सियस तक शांत।
  7. -20 डिग्री सेल्सियस पर सीडीएनए स्टोर।

3. सीडीएनए कमजोर पड़ने

  1. सीडीएनए nuclease मुफ्त पानी में योजना बनाई ddPCR प्रतिक्रियाओं के लिए आवश्यक टेम्पलेट की राशि पतला। पानी में 500, लक्ष्य miRNA बहुतायत पर निर्भर: पतला 1:50 और 1 के बीच सीडीएनए प्रतिक्रिया। -20 डिग्री सेल्सियस पर पतला सीडीएनए स्टोर। पतला सीडीएनए -20 डिग्री सेल्सियस पर कम से कम 3 महीने के लिए स्थिर साबित हुई।

4. छोटी बूंद पीढ़ी और पीसीआर

नोट: छोटी बूंद पीढ़ी एक समय में 8 नमूने पर प्रदर्शन किया जाना चाहिए। तकनीकी प्रतिकृति के लिए आवश्यक नहीं कर रहे हैं, इस तकनीक 12,15 ए कोई टेम्पलेट नियंत्रण (एनटीसी) नमूना हर थाली में चलाया जाना चाहिए की उच्च reproducibility के कारण और प्रत्येक अलग ddPCR हालत के लिए।

  1. गला लें और मास्टर मिश्रण संतुलित करना (जैसे।, EvaGreen मास्टर मिक्स), microRNA प्राइमर सेट और सीडीएनए आरटी पर।
  2. मिक्स मास्टर मिक्स वेंoroughly ट्यूब कई बार inverting द्वारा। सभी अभिकर्मकों स्पिन।
  3. तालिका 2 में वर्णित के रूप ddPCR मिश्रण तैयार करें। जब एकाधिक ddPCR प्रतिक्रियाओं प्रदर्शन कर रहे हैं, एक ddPCR मिश्रण काम समाधान तैयार है। कम से कम 10% से अधिक मिश्रण तैयार करें।
  4. एक बार इकट्ठे, अच्छी तरह मिक्स और ddPCR मिश्रण नीचे स्पिन।
  5. बांटना ddPCR के 12 μl एक 96 अच्छी तरह से पीसीआर थाली या पीसीआर ट्यूबों में मिला लें।
  6. अच्छी तरह से प्रत्येक ट्यूब पतला सीडीएनए टेम्पलेट के 8 μl जोड़ें /।
  7. धारक में छोटी बूंद जनरेटर कारतूस डालें।
  8. स्थानांतरण छोटी बूंद जनरेटर कारतूस ध्यान से परहेज करते हुए हवा अच्छी तरह से नीचे बुलबुले का नमूना कुओं (मध्य पंक्ति) के लिए प्रत्येक तैयार नमूना के 20 μl।
  9. छोटी बूंद जनरेटर के तेल के 70 μl के साथ एक तेल अच्छी तरह से नीचे (पंक्ति) भरें।
  10. कारतूस धारक के ऊपर गैसकेट हुक और छोटी बूंद जनरेटर में डालें।
  11. निर्माता के जनसंपर्क के लिए छोटी बूंद पीढ़ी अनुसार शुरू करने के लिए ढक्कन बंदotocol। जब छोटी बूंद पीढ़ी समाप्त हो गया है, ढक्कन खोलने के डिस्पोजेबल गैसकेट को हटा दें। कारतूस के शीर्ष कुओं बूंदों होते हैं।
  12. एक 96 अच्छी तरह से पीसीआर थाली का एकल स्तंभ में आठ शीर्ष कुओं (बूंदों) की सामग्री की Pipet धीरे से और आसानी 40 μl।
  13. तुरंत बूंदों स्थानांतरित वाष्पीकरण से बचने के बाद पन्नी के साथ पीसीआर थाली सील। pierceable पन्नी प्लेट जवानों कि छोटी बूंद रीडर में सुइयों के साथ संगत कर रहे हैं का प्रयोग करें।
  14. प्लेट सीलिंग के 30 मिनट के भीतर थर्मल साइकिल (पीसीआर) शुरू करते हैं।
  15. 3 टेबल के अनुसार साइकल चलाना प्रोटोकॉल प्रदर्शन करना।

5. छोटी बूंद पढ़ना

  1. छोटी बूंद पाठक पर पावर।
  2. छोटी बूंद पाठक को थर्मल साइक्लर से थाली ले जाएँ।
  3. 96 अच्छी तरह से पीसीआर प्लेट प्लेट धारक के आधार में बाद पीसीआर बूंदों से युक्त रखें।
  4. पीसीआर प्लेट पर थाली धारक के शीर्ष रखें। मजबूती से दोनों रिहाई टैब प्रेसनीचे धारक में पीसीआर थाली सुरक्षित करने के लिए।
  5. प्रणाली पीसी से सॉफ्टवेयर शुरू करो।
    1. क्लिक करें प्रयोग (निरपेक्ष मात्रा का ठहराव) को परिभाषित करने के लिए सेटअप फिर क्लिक करें चलाएँ छोटी बूंद पढ़ने शुरू करने के लिए।
    2. छोटी बूंद पढ़ने पूरा हो गया है, क्लिक करें खोलने के लिए और डेटा का विश्लेषण करने के लिए बटन "विश्लेषण"।
    3. सकारात्मक बूंदों (कमंद उपकरण) (चित्रा 1 बी) का चयन करने के लिए विश्लेषण सॉफ्टवेयर में 2 डी आयाम साजिश का प्रयोग करें।
    4. सकारात्मक और कुल बूंदों की संख्या की जांच करने के लिए घटना टैब का प्रयोग करें। 18,000 की कुल संख्या - 21,000 बूंदों आमतौर पर probeless ddPCR के साथ हासिल की है।
    5. एक बार सकारात्मक बूंदों चयन कर रहे हैं, miRNA एकाग्रता एकाग्रता टैब से निर्यात .csv विकल्प का उपयोग कर मूल्यों निर्यात।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

प्लाज्मा या सीरम की मिलीलीटर प्रति विशिष्ट miRNAs की पूर्ण राशि एक हरी फ्लोरोसेंट डीएनए बाध्यकारी डाई का उपयोग और डिजिटल पीसीआर प्रौद्योगिकी छोटी बूंद निर्धारित किया जा सकता है। चित्रा 1 जो अंतिम miRNA एकाग्रता निर्धारित करता है सकारात्मक-बूंदों चयन की प्रक्रिया, प्रस्तुत करता है (प्रतियां / μl ) प्रवर्धन प्रतिक्रिया विश्लेषण सॉफ्टवेयर द्वारा गणना में। रक्त में प्रत्येक miRNA की राशि बहुत अलग है, दूसरों की तुलना में कुछ miRNA प्रजातियों अधिक प्रचुर मात्रा में किया जा रहा है। ddPCR प्रतिक्रिया में एक 1:50 पतला सीडीएनए का उपयोग करते हुए इसे सकारात्मक और नकारात्मक बूंदों की एक पर्याप्त संख्या प्राप्त करने के लिए संभव है। सकारात्मक छोटी बूंद संतृप्ति (जैसे।, कोई शेष नकारात्मक बूंदों) के मामले में, सीडीएनए नमूने का एक और कमजोर पड़ने के लिए आवश्यक हो सकता है।

हर LNA प्राइमर सेट छोटी बूंद डिजिटल पीसीआर प्रणाली पर ठीक से काम करने के लिए अनुकूलित किया जाना चाहिए। मीर 181a-5p के लिए अनुकूलन की प्रक्रिया हैचित्रा 2 में प्रतिनिधित्व विशेष रूप से, (आमतौर पर 0.25 की रेंज में - ddPCR प्रतिक्रिया प्रति 1 μl) प्राइमर की राशि बदल रहा है। और annealing तापमान (आमतौर पर 56 की रेंज में - 60 डिग्री सेल्सियस), यह संयोजन का चयन करने के लिए संभव है कि सकारात्मक और नकारात्मक बूंदों के बीच एक बेहतर जुदाई निर्धारित करता है। मीर 181a-5p, 60 डिग्री सेल्सियस तापमान annealing और दोनों 0.5 और 1 μl प्राइमर मात्रा के मामले में छोटी बूंद आयाम के मामले में बेहतर परिणाम प्रदान करते हैं।

यह हो सकता है कि एक प्राइमर सेट कुछ गैर विशिष्ट प्रवर्धन, शायद प्राइमर dimers करने के गठन के कारण देता है। जब miRNAs घूम साथ काम करना, नमूनों से सकारात्मक संकेत बहुत कम है और इसलिए गैर विशिष्ट संकेत के समान हो सकता है। गैर विशिष्ट लक्ष्य प्रवर्धन की "बादल" सच संकेत (चित्रा 1 सी) के साथ अतिव्यापी नहीं है, तो miRNA अभी भी केवल सच का चयन मात्रा निर्धारित किया जा सकता है सकारात्मक बूंदों। इस मामले में, एनटीसी नमूना छोटी बूंद चयन के लिए आवश्यक है। सभी नमूनों ही विश्लेषण में शामिल होने के लिए एक ही पद्धति और समान ddPCR हालत का उपयोग कर कार्रवाई किए जाने की जरूरत है।

आकृति 1
चित्रा 1. सकारात्मक बूंदों चयन। सकारात्मक बूंदों मैन्युअल -1 डी साजिश (ए) या ​​2 डी साजिश (बी) में सकारात्मक छोटी बूंद बादल चारों ओर एक घेरे प्रदर्शन में नकारात्मक बूंदों के ऊपर एक सीमा का उपयोग कर विश्लेषण के दौरान चुने गए हैं। कुछ प्राइमर सेट एक अविशिष्ट प्रवर्धन देता है, यह है कि नकारात्मक नियंत्रण (कोई खाका नियंत्रण, एनटीसी) नमूना (सी) में प्रकट होता है सकारात्मक बूंदों के एक दूसरे बादल इसका सबूत है। "सच" सकारात्मक अभी भी 2 डी साजिश में अविशिष्ट संकेत छोड़कर चुना जा सकता है।e.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. Probeless ddPCR साथ सेल मुक्त miRNA मात्रा के लिए प्राइमर अनुकूलन ऊपरी पैनल:। दो प्लाज्मा के नमूने (एस 1 और एस 2) 4 अलग ddPCR की स्थिति का उपयोग करने में मीर 181a-5p की मात्रा। मीर-181a-5p LNA प्राइमर एकाग्रता (0.5 और 1 μl) और annealing तापमान (58 और 60 डिग्री सेल्सियस) डीएनए intercalating डाई ddPCR में सकारात्मक (नीला) के आयाम और नकारात्मक (काला) बूंदों प्रभावित करते हैं। इस miRNA के लिए एक बेहतर जुदाई 60 डिग्री सेल्सियस पर पीसीआर प्रदर्शन और या तो 0.5 या 1 μl प्राइमर का उपयोग कर प्राप्त किया जा सकता है। उम्मीद के रूप में नियंत्रण नमूना (एनटीसी, कोई टेम्पलेट नियंत्रण), कोई सकारात्मक बूंदों है। केंद्रीय पैनल: उपर्युक्त परिस्थितियों में मीर 181-5p के अंतिम एकाग्रता। परिणाम ampli में microliter प्रति प्रतियां के रूप में प्रस्तुत कर रहे हैंदिखाएं प्रतिक्रिया। त्रुटि सलाखों पॉसों 95% विश्वास अंतराल प्रतिनिधित्व करते हैं। लोअर पैनल:। बूंदों (हरा) की कुल संख्या पर सकारात्मक बूंदों (नीला) की संख्या कृपया यहाँ यह आंकड़ा का एक बड़ा संस्करण देखने के लिए क्लिक करें।

अभिकर्मक मात्रा (μl)
5x प्रतिक्रिया बफर 4
Nuclease मुक्त पानी 1 1
एंजाइम मिश्रण 2
खाका कुल शाही सेना 3
कुल मात्रा 20

तालिका 1 - रिवर्स प्रतिलेखन अभिकर्मक मिक्स अवयव

अभिकर्मक मात्रा (μl)
2x डीएनए बाध्यकारी डाई Supermix 10
LNA प्राइमर सेट चर (0.5 - 1) *
Nuclease मुक्त पानी परिवर्तनशील
पतला सीडीएनए टेम्पलेट 8
कुल मात्रा 20
* पहली बार एक ddPCR प्रतिक्रिया प्राइमर का सबसे अच्छा काम कर रहे राशि की स्थापना के लिए कुछ नमूने के साथ प्रदर्शन किया जाना चाहिए

तालिका 2 - ddPCR अभिकर्मक मिक्स अवयव

साइकल चलाना चरण तापमान पहर ramping दर साइकिल
एनजाइम सक्रियण 95 डिग्री सेल्सियस 5 मिनट ~ 2 डिग्री सेल्सियस / सेकंड 1
विकृतीकरण 95 डिग्री सेल्सियस 30 सेकंड 40
एनीलिंग / विस्तार 60 डिग्री सेल्सियस 1 मिनट
सिग्नल स्थिरीकरण 4 डिग्री सेल्सियस 5 मिनट 1
90 डिग्री सेल्सियस 5 मिनट 1
पकड़ो (वैकल्पिक) 4 डिग्री सेल्सियस अनंत 1
एक गर्म ढक्कन 105 डिग्री सेल्सियस के लिए सेट का उपयोग और 40 μl के लिए नमूना मात्रा निर्धारित किया है।

3 टेबल - थर्मल सायक्लिंग बूंद डिजिटल पीसीआर के लिए शर्तें

Subscription Required. Please recommend JoVE to your librarian.

Discussion

परिसंचारी miRNAs बहुत कम मात्रा में रक्त में मौजूद हैं और शाही सेना की राशि है कि प्लाज्मा और सीरम नमूनों से निकाला जा सकता है कम है। इस कारण से, वे इस तरह के माइक्रोएरे और आरएनए अनुक्रमण के रूप में अन्य तकनीकों के साथ अंदाजा लगाना मुश्किल कर रहे हैं। इसके अलावा, वहाँ डेटा सामान्य बनाने पर समझौते की एक सामान्यीकृत कमी और रक्त में अंतर्जात "संदर्भ" miRNAs की उपस्थिति है। इस संदर्भ में, छोटी बूंद डिजिटल पीसीआर जैसे संवेदनशील प्रौद्योगिकी, सीरम या प्लाज्मा भले ही बहुत कम मिलीलीटर प्रति miRNA प्रतियों की संख्या की गणना करने में सक्षम है, बहुत ही आकर्षक है। हम एक सार्वभौमिक सीडीएनए प्रणाली रिवर्स transcribes कि एक प्रतिक्रिया में सब घूम miRNAs इसलिए समय की बचत और, सबसे महत्वपूर्ण, आरएनए सामग्री के साथ इस प्रौद्योगिकी बनती। हमारे दृष्टिकोण में, विशिष्टता LNA प्राइमरों, जो miRNA मात्रा का ठहराव में बहुत अच्छा प्रदर्शन किया जब अन्य समाधान 16 की तुलना के उपयोग के लिए निहित है।

छोटी बूंदडिजिटल पीसीआर एक अंत बिंदु परख है कि पूर्ण एकाग्रता लक्ष्य जीन की गणना की अनुमति देता है। मात्रात्मक पीसीआर के विपरीत, अपर्याप्त प्रवर्धन क्षमता अंतिम ddPCR मात्रा का ठहराव को प्रभावित नहीं करते। इसलिए, पीसीआर अवरोधकों रक्त के नमूनों में उदाहरण के लिए वर्तमान की राशि पर विचार, ddPCR न्यूक्लिक एसिड आकलन घूम के लिए एक मजबूत उपकरण प्रदान करता है।

इसकी उच्च संवेदनशीलता के कारण, प्रौद्योगिकी भी सामग्री शुरू की सीमित मात्रा के साथ, एक पर्याप्त मात्रा का ठहराव कम प्रचुर मात्रा में miRNAs की भी प्रदान करता है। इसके अलावा, यह सोचते हैं कि प्रत्येक miRNA अणु रिवर्स एक सीडीएनए अणु में लिखित है, हम एक कमजोर पड़ने कारक (145.83) के लिए ddPCR प्रतिक्रिया मूल्य में प्राप्त एकाग्रता गुणा 1 μl प्लाज्मा / सीरम में पूर्ण प्रतियां गणना कर सकते हैं।

प्रस्तुत कार्यप्रवाह आसानी से एक समय में 8-96 नमूनों पर प्रदर्शन किया जा सकता है, इस प्रकार Clinica में microRNA मात्रा का ठहराव के लिए एक विश्वसनीय और समय प्रभावी उपकरण उपलब्ध करानेएल नमूने हैं। छोटी बूंद डिजिटल पीसीआर संभावित न्यूक्लिक एसिड के लिए एक अनिवार्य उपकरण एक नैदानिक ​​सेटिंग में मूल्यांकन बायोमार्कर, जिससे बिस्तर के लिए बेंच से तरल बायोप्सी लाने बनने की क्षमता है।

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

इतालवी (AIRC) म्यूचुअल फंड (MFAG 11676) के कैंसर रिसर्च के लिए एसोसिएशन से और एम.एन. को धन के द्वारा समर्थित (विशेष कार्यक्रम आण्विक नैदानिक ​​कैंसर विज्ञान -। प्रति सहस्र N 5 9980, 2010/15) और निर्देश के इतालवी मंत्रालय, विश्वविद्यालय और से अनुसंधान FIRB 2011 एम.एन. करने के लिए (परियोजना RBAPIIBYNP)।

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics