במחזור כימות MicroRNA שימוש DNA מחייבת כימיה דיי PCR דיגיטלי אגל

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

במחזור (של תא-חינם) מיקרו-רנ"א (miRNAs) משתחררים מתאי לתוך זרם הדם. סכום של מיקרו-רנ"א ספציפי במחזור נקשר למצב המחלה ויש לו פוטנציאל לשמש סמן ביולוגי למחלה. שיטה רגישה ומדויקת עבור מחזורי כימות microRNA באמצעות כימיה מבוססת לצבוע צַחצוֹחִית טכנולוגית PCR דיגיטלית פותחה לאחרונה. באופן ספציפי, באמצעות נעול חומצות גרעין (LNA) מבוססות פריימרים ספציפי מירנה עם צבע DNA מחייבת פלואורסצנטי ירוק במערכת PCR דיגיטלית תואמת אגל אפשר להשיג כימות המוחלטת של miRNAs הספציפי. כאן אנו מתארים כיצד לבצע בטכניקה זו כדי להעריך כמות מירנה נוזלים ביולוגיים, כגון פלזמה ו בסרום, הוא גם ריאלי אפקטיבי.

Protocol

בידוד MicroRNA מ פלזמה או סרום

הערה: פלזמה והכנה בסרום הוא צעד רלוונטי במחזור כימות מירנה. לא מקיים הליך מועדף עבור פלזמה והכנה בסרום. הדבר היחיד שחשוב לקחת בחשבון הוא כי כל הדגימות מאותו הניסוי חייבות להיות מעובד באמצעות העבודה בדיוק. התחל 200 μl בסרום או פלזמה. RNA סה"כ יכול להיות מבודד סרום או פלזמה באמצעות ערכות זמינות מסחרי.

1. ניתוק פרוטוקול RNA (כולל מירנה)

  1. דגימות סרום / פלזמה להפשיר על הקרח.
  2. הוסף 1 מ"ל של מגיב תמוגה (למשל., QIAzol) 200 μl בסרום / פלזמה.
  3. מערבבים על ידי vortexing ומניחים את שפופרת המכילה את homogenate על הספסל ב RT במשך 5 דקות.
  4. הוסף 3 μl של פתרון 4.16 ננומטר של cel-miR-39-3p מירנה הסינטטי ג elegans.
  5. הוסף 200 μl של כלורופורם. לנער את הצינור במרץ למשך 15 שניות. ה מקוםצינור דואר על הספסל ב RT במשך 2 דקות.
  6. צנטריפוגה במשך 15 דקות ב XG 12,000 ב 4 ° C כדי להשיג הפרדת שלבים: השלב מהימי העליון מכיל RNA.
  7. מעביר את השלב המימי לצינור חדש, כ -700 μl, למנוע העברה של כל חומר ביניים לבן.
  8. הוסף 1 מ"ל של 100% אתנול ומערבבים על ידי היפוך.
  9. Pipet למעלה 700 μl של המדגם לתוך עמוד ספין מיני דגש על צינור איסוף 2 מ"ל. סגור את המכסה צנטריפוגות ב XG 12,000 במשך 15 שניות. מחק את הזרימה דרך.
  10. חזור על שלב זה באמצעות המדגם הנותר.
  11. הוסף 700 μl מאגר RWT לעמודת הספין המיני, לסגור את המכסה ו צנטריפוגות במשך 15 שניות ב XG 12,000 לשטוף את העמודה. מחק את הזרימה דרך.
  12. Pipet 500 μl הצפת רשתית לתוך טור הספין המיני. סגור את המכסה ו צנטריפוגות במשך 15 שניות ב -12,000 סל"ד. מחק את הזרימה דרך. חזור על פעולה זו שוב.
  13. צנטריפוגה עמודת הספין המינית במלוא מהירות למשך 2 דקות כדי לייבש את טור הספיןקרום מ אתנול שיורית.
  14. מעביר את טור הספין המיני לצינור 1.5 מיליליטר אוסף חדש ומי RNase ללא pipet 35 μl על הממברנה של הטור.
  15. צנטריפוגה 1 דקות ב XG 12,000 כדי elute רנ"א.
  16. אחסן את RNA ב -80 ° C.
    הערה: מאז ריכוז RNA לא ניתן לקבוע במדויק, משתמשים באמצעי אחסון קבוע כאמצעי עבור סכום קלט.

2. שעתוק לאחור MicroRNA

  1. להפשיר את השעתוק לאחור תערובת מגיבה (RT) מרכיבים: חיץ תגובת 5x, nuclease ללא מים. מערבבים בעדינות היפוך הצינורות ומניחים על קרח. מיד לפני השימוש, להסיר את תמהיל האנזים מהמקפיא ומניחים על קרח. ספין למטה כל חומרים כימיים.
  2. מכינים את תערובת מגיב RT על הקרח כמתואר בטבלה 1. הכן לפחות לערבב 10% מעבר.
  3. מערבבים את התגובה על ידי pipetting, ולאחר מכן ספין למטה.
  4. דגירה של 60 דקות ב 42 ג.
  5. מחממים להשבית reverse transcriptase במשך 5 דקות ב 95 ג.
  6. מיד לצנן עד 4 מעלות צלזיוס.
  7. אחסן את cDNA ב -20 ° C.

3. cDNA דילול

  1. לדלל את כמות תבנית cDNA דרושי תגובות ddPCR המתוכננות במים חינם nuclease. לדלל את התגובה cDNA בין 01:50 ו -1: 500 במים, תלוי שפע מירנה היעד. אחסן את cDNA מדולל ב -20 ° C. את cDNA בדילול הוכיח להיות יציב במשך 3 חודשים לפחות ב -20 ° C.

דור אגל 4. PCR

הערה: דור אגל צריך להתבצע ב -8 דגימות בכל פעם. משכפל טכני אינו נדרש, בשל השחזור הגבוה של טכנולוגיה זו 12,15 .א אין שליטת תבנית (NTC) מדגם צריך לרוץ בכל צלחת עבור כל תנאי ddPCR שונים.

  1. להפשיר לאזן את תערובת מאסטר (למשל., מיקס מאסטר EvaGreen), סט פריימר microRNA ו cDNA ב RT.
  2. מערבבים את ה מיקס מאסטרoroughly על ידי היפוך הצינור מספר פעמים. ספין למטה כל חומרים כימיים.
  3. מכינים את תערובת ddPCR כמתואר בטבלה 2. כאשר התגובות ddPCR מרובים מבוצעות, להכין ddPCR לערבב-פתרון עובד. הכן לפחות 10% בתמהיל יעלה.
  4. לאחר ההרכבה, ומערבבים היטב ומסובב תמהיל ddPCR.
  5. לוותר 12 μl של ddPCR לערבב לתוך צלחת 96-היטב PCR או צינורות PCR.
  6. הוסף 8 μl של תבנית cDNA מדולל על צינור אחד / היטב.
  7. הכנס את המחסנית גנרטור אגל לתוך מחזיק.
  8. העביר 20 μl של כל דגימה מוכנה בארות המדגם (בשורה אמצעית) של מחסנית גנרטור אגל בזהירות תוך הימנעות בועות אוויר בתחתית הבאר.
  9. ממלאים כל באר נפט (בשורה התחתונה) עם 70 μl של שמן גנרטור רביב.
  10. הוק אטם על בעל מחסנית ולהכניס לתוך הגנרטור רביב.
  11. סגור את המכסה כדי להתחיל דור אגל על ​​פי יחסי הציבור של היצרןotocol. כאשר דור אגל סיים, לפתוח את המכסה, הסר את האטם הפנוי. הבארות העליונות של המחסנית להכיל את הטיפין.
  12. Pipet לאט חלקה 40 μl של התוכן שמונה הבארות העליונות (הטיפין) לתוך עמודה אחת של צלחת 96-היטב PCR.
  13. חותם את הצלחת PCR ברדיד מיד לאחר העברת טיפות כדי למנוע אידוי. השתמש חותמות צלחת רדיד לנקבה התואמות את המחטים בקורא רביב.
  14. בגין רכיבת תרמית (PCR) בתוך 30 דקות של איטום הצלחת.
  15. בצע את פרוטוקול האופניים לפי טבלה 3.

5. קריאה אגל

  1. כוח על הקורא רביב.
  2. הזז את הצלחת מן Cycler התרמית לקורא רביב.
  3. מניחים את הצלחת ה- PCR 96-היטב המכיל את טיפות שלאחר PCR לתוך הבסיס של בעל צלחת.
  4. הנח את החלק העליון של בעל צלחת על צלחת PCR. קש הוא לשוניות השחרור היטבמטה כדי לאבטח את הצלחת ה- PCR במחזיק.
  5. הפעל את התוכנה ממחשב המערכת.
    1. לחץ על הגדרה כדי להגדיר את הניסוי (כימותים מוחלטים) ולאחר מכן לחץ על הפעל כדי להתחיל בקריאת רביב.
    2. כאשר קריאת האגל הושלמה, לחץ על "נתח" כפתור כדי לפתוח ולנתח את הנתונים.
    3. השתמש העלילה משרעת 2D בתוכנת הניתוח כדי לבחור את הטיפין החיוביות (כלי הלאסו) (איור 1 ב).
    4. השתמש בכרטיסיית האירועים כדי לבדוק את מספר טיפות חיוביות ומוחלטות. מספר כולל של 18,000 - 21,000 טיפות מושג בדרך כלל עם probeless ddPCR.
    5. לאחר הטיפין החיוביות נבחרות, לייצא את ערכי ריכוז מירנה באמצעות אפשרות .csv היצוא מכרטיסיית הריכוז.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

הסכום המוחלט של miRNAs ספציפי לכל מיליליטר של פלזמה או בסרום ניתן לקבוע באמצעות צבע DNA מחייבת ניאון ירוק אַגְלִיל הטכנולוגיה PCR דיגיטלי. איור 1 מציג את התהליך של סלקציה חיובית-טיפות, אשר קובע את הריכוז מירנה הסופי (עותקים / μl ) ב תגובת ההגברה מחושבת על ידי תוכנת הניתוח. הסכום של כל מירנה בדם שונה מאוד, להיות כמה מיני מירנה שופעים יותר מאחרים. באמצעות cDNA 01:50 מדולל התגובה ddPCR אפשר להשיג מספר מספיק של טיפות חיוביות ושליליות. במקרה של רווית אגל חיובית (למשל., לא טיפות שליליות הנותרים), דילול נוסף של דגימות cDNA יכול להיות הכרחי.

כל LNA סט פריימר צריך להיות מותאם על מנת לעבוד כמו שצריך על מערכת PCR הדיגיטלית רביב. תהליך האופטימיזציה עבור miR-181a-5P הואמיוצג באיור 2 באופן ספציפי, שינוי כמות פריימר (בדרך כלל בטווח של 0.25 - 1 μl לכל תגובה ddPCR). ואת הטמפרטורה חישול (בדרך כלל בטווח של 56 - 60 ° C), אפשר לבחור את השילוב הקובע הפרדה טובה יותר בין טיפות חיוביות ושליליות. במקרה של miR-181a-5P, 60 ° C הטמפרטורה חישול ושניהם כמויות פריימר μl 0.5 ו -1 לספק תוצאה טובה יותר מבחינת משרעת רביב.

זה יכול לקרות כי יש לקבוע פריימר נותן כמה הגברה הלא ספציפית, ככל הנראה בשל פריימר הדימרים היווצרות. כשעובד עם מחזורי miRNAs, האיתות החיובית ממדגמים יכולה להיות נמוכה מאוד ולכן דומה האות הלא הספציפית. אם "הענן" של הגברת היעד הלא ספציפית אינו חופף עם האות האמיתי (התרשים 1C), מירנה עדיין ניתן לכמת בחירה רק את האמת טיפות חיוביות. במקרה זה, מדגם NTC חיוני מבחר רביב. כל הדגימות להיכלל באותו ניתוח צריכות להיות מעובד תוך שימוש באותה מתודולוגיה ומצבו ddPCR הזהה.

איור 1
איור 1. חיובי טיפות בחירה. טיפות חיוביות נבחרו באופן ידני במהלך הניתוח באמצעות סף מעל הטיפין שהליליות עלילת 1D (א) או ביצוע עיגול סביב ענן האגל החיובי עלילת 2D (B). אם קבוצה מסוימת פריימר נותנת הגברה ספציפית, זה בא לידי ביטוי על ידי ענן שני של טיפות חיוביות המופיע בקרה השלילית (אין שליטת תבנית, NTC) מדגם (C). התוצאות החיוביות "הנכונה" עדיין ניתן לבחור למעט האות הספציפי במזימת 2D.e.jpg "target =" _ blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
אופטימיזציה פריימר איור 2. ללא סלולרי כימות מירנה עם Probeless ddPCR הפאנל העליון:. כימות miR-181a-5P בשתי דגימות פלסמה (S1 ו- S2) באמצעות 4 התנאים ddPCR שונים. מיר-181a-5P ריכוז פריימר LNA (0.5 ו 1 μl) ואת הטמפרטורה חישול (58 ו -60 מעלות צלזיוס) להשפיע על משרעת של (כחול) חיוביות ושליליות (שחור) טיפות ddPCR לצבוע intercalating-DNA. הפרדה טובה יותר עבור מירנה זה ניתן להשיג ביצוע PCR ב 60 ° C ושימוש משני 0.5 או 1 פריימר μl. מדגם שליטה (NTC, בקרת תבנית אין) אין טיפות חיוביות, כצפוי. פנל מרכזי: ריכוז סופי של miR-181-5p בתנאים הנ"ל. תוצאות מוצגים עותקים לכל מיקרוליטר של ampli תגובת fication. ברי שגיאה מייצגים את 95% פואסון. תחתון פנל:. מספר טיפות חיוביות (כחול) על המספר הכולל של טיפות (ירוק) אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

מֵגִיב נפח (μl)
מאגר התגובה 5x 4
nuclease ללא מים 11
תמהיל האנזים 2
RNA הכולל תבנית 3
נפח כולל 20

טבלה 1 - הפוך תמלול מגיב רכיבים Mix

גיל = "1">
מֵגִיב נפח (μl)
2x DNA מחייבת לצבוע Supermix 10
סט פריימר LNA השתנה (0.5 - 1) *
nuclease ללא מים מִשְׁתַנֶה
תבנית cDNA מדולל 8
נפח כולל 20
* תגובת ddPCR ראשונה צריכה להיות לבצע עם כמה דוגמאות כדי להקים את הכמות אופטימלי עבודה של פריימר

טבלה 2 - ddPCR מגיב רכיבים Mix

שלב רכיבה על אופניים טֶמפֶּרָטוּרָה זְמַן דרג ramping מחזורים
הפעלת אנזים 95 ° C 5 דקות ~ 2 ° C / sec 1
denaturation 95 ° C 30 שניות 40
רחבת חישול / 60 ° C דקה 1
ייצוב איתותים 4 ° C 5 דקות 1
90 ° C 5 דקות 1
המתנה (אופציונלי) 4 ° C אֵינְסוֹף 1
השתמש מכסה מחומם מוגדר 105 מעלות צלזיוס, להגדיר את נפח דגימה 40 μl.

p-together.within-page = "1"> לוח 3 - תנאי רכיבה על אופניים תרמי אגל דיגיטלי PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

miRNAs במחזור הנוכחים בדם בריכוזים נמוכים מאוד וכמות רנ"א שיכול להיות מופקת דגימות פלזמת בדם היא נמוכה. מסיבה זו, הם קשה לכמת עם טכניקות אחרות כגון microarray וסדר RNA. יתר על כן, קיימת חוסר כללי של הסכם על נורמליזצית נתונים ואת הנוכחות של miRNAs "ייחוס" אנדוגני בדם. בהקשר זה, טכנולוגיה רגישה כמו אגל דיגיטלי PCR, מסוגל לספור את מספר העותקים מירנה לכל מ"ל של סרום או פלזמה גם אם נמוך מאוד, הוא מאוד אטרקטיבי. אנחנו לזווג טכנולוגיה זו עם מערכת cDNA אוניברסלית הפוכות מעתיקות כל miRNAs במחזור תגובה אחת ולכן חוסכים זמן, רוב החומר חשוב, RNA. בגישתנו, וספציפיות הטמון בשימוש של פריימרים LNA, ביצועים טובים מאוד כימות מירנה בהשוואה לפתרונות אחרים 16.

אֵגֶלדיגיטלי PCR הוא assay סוף נקודות המאפשר חישוב של גני מטרה ריכוז מוחלט. בניגוד PCR כמותי, יעילות הגברה לקוי אינן משפיעות על כימות ddPCR הסופי. לכן, בהתחשב בכמות של מעכבי ה- PCR נוכחיים למשל בדגימות דם, ddPCR מספק כלי חזק במחזור הערכת חומצות גרעין.

בשל הרגישות הגבוהה שלו, הטכנולוגיה מספקת כימות נאותה גם של miRNAs פחות בשפע, אפילו עם כמות מוגבלת של חומר מוצא. בנוסף, בהנחה שכל מולקולת מירנה הוא עבד הופך במולקולת cDNA, נוכל לחשב את העותקים המוחלטים בסרום פלזמת 1 μl / הכפלת הריכוז המתקבל בשווי תגובת ddPCR עבור גורם לדילול (145.83).

זרימת העבודה הציגה יכולה להתבצע בקלות על 8-96 דגימות בכל פעם, ובכך לספק כלי יעיל אמין זמן כימות microRNA ב Clinicaדגימות l. אגל הדיגיטלי PCR יש את הפוטנציאל להיות כלי חיוני עבור חומצות גרעין Biomarkers הערכה בסביבת אבחון, ובכך להביא ביופסיה נוזלית מהספסל אל מיטת החולה.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

בתמיכה כספית של האגודה האיטלקית לחקר הסרטן (AIRC) כדי MF (MFAG 11,676) וכדי MN (לאונקולוגיה קלינית מולקולרית תכנית מיוחדת -. 5 לכל n mille 9980, 2010/15) ומהמשרד של הוראה האיטלקית, האוניברסיטה מחקר FIRB 2011 MN (פרויקט RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics