تعميم الرنا الميكروي الكمي باستخدام الحمض النووي ملزم صبغ الكيمياء والقطرة PCR الرقمية

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

تعميم (من خالية من الخلايا) الرنا الميكروية (miRNAs) تم إصدارها من الخلايا في مجرى الدم. وقد تم ربط كمية من microRNAs محددة في الدورة الدموية إلى حالة المرض ولديه القدرة على أن تستخدم العلامات البيولوجية المرض. تم تطوير طريقة حساسة ودقيقة لتعميم الرنا الميكروي الكمي باستخدام الكيمياء قائم على الأصباغ وقطيرة تكنولوجيا PCR الرقمية مؤخرا. على وجه التحديد، وذلك باستخدام مغلق الأحماض النووية (LNA) المستندة الاشعال ميرنا معين مع الفلورسنت صبغة الحمض النووي ملزم الأخضر في قطرات نظام PCR الرقمية متوافق أنه من الممكن الحصول على تقدير المطلق للmiRNAs محددة. هنا، نحن تصف كيفية أداء هذه التقنية لتقييم كمية ميرنا في السوائل البيولوجية، مثل البلازما والمصل، على حد سواء مجدية وفعالة.

Protocol

عزل الرنا الميكروي من البلازما أو مصل

ملاحظة: البلازما وإعداد المصل هو خطوة ذات الصلة في تعميم ميرنا الكمي. لا يوجد أي إجراء المفضل لالبلازما وإعداد المصل. الشيء الوحيد المهم للنظر هو أن جميع العينات من نفس التجربة يجب معالجتها باستخدام بالضبط نفس العمل. نبدأ من المصل 200 ميكرولتر أو البلازما. الحمض النووي الريبي مجموع يمكن عزله عن المصل أو البلازما باستخدام مجموعات متاحة تجاريا.

1. بروتوكول لإجمالي RNA (بما في ذلك ميرنا) عزل

  1. عينات المصل / البلازما ذوبان الجليد على الجليد.
  2. إضافة 1 مل من تحلل الكاشف (على سبيل المثال، QIAzol) إلى 200 ميكرولتر المصل / البلازما.
  3. مزيج من قبل vortexing ووضع الأنبوب الذي يحتوي على جناسة على مقاعد البدلاء في RT لمدة 5 دقائق.
  4. إضافة 3 ميكرولتر من حل نانومتر 4.16 من الاصطناعية ميرنا سل-مير 39-3p من C. ايليجانس.
  5. إضافة 200 ميكرولتر من كلوروفورم. هز أنبوب بقوة لمدة 15 ثانية. المركز الرابعأنبوب الإلكترونية على مقاعد البدلاء في RT لمدة 2 دقيقة.
  6. أجهزة الطرد المركزي لمدة 15 دقيقة في 12000 x ج في 4 درجات مئوية للحصول على فصل مراحل: المرحلة المائية العليا تحتوي على الحمض النووي الريبي.
  7. نقل المرحلة المائية لأنبوب جديد، نحو 700 ميكرولتر، وتجنب نقل أي مواد البيني البيضاء.
  8. إضافة 1 مل من الإيثانول بنسبة 100٪ ومزيج من قبل انقلاب.
  9. الماصة حتى 700 ميكرولتر من العينة في عمود الدوران مصغرة وضعت على أنبوب جمع 2 مل. إغلاق الغطاء وأجهزة الطرد المركزي في 12000 x ج لمدة 15 ثانية. تجاهل التدفق من خلال.
  10. كرر هذه الخطوة باستخدام عينة المتبقية.
  11. إضافة 700 ميكرولتر العازلة RWT إلى عمود الدوران مصغرة، إغلاق الغطاء وأجهزة الطرد المركزي لمدة 15 ثانية في 12000 x ج لغسل العمود. تجاهل التدفق من خلال.
  12. الماصة 500 ميكرولتر العازلة RPE في عمود الدوران مصغرة. إغلاق الغطاء وأجهزة الطرد المركزي لمدة 15 ثانية في 12000 دورة في الدقيقة. تجاهل التدفق من خلال. كرر هذه الخطوة مرة أخرى.
  13. أجهزة الطرد المركزي لعمود الدوران مصغرة بأقصى سرعة لمدة 2 دقيقة حتى يجف عمود الدورانغشاء من الايثانول المتبقية.
  14. نقل عمود الدوران مصغرة لأنبوب 1.5 مل مجموعة جديدة والماصة 35 ميكرولتر المياه خالية من ريبونوكلياز على الغشاء العمود.
  15. أجهزة الطرد المركزي لمدة 1 دقيقة في 12000 x ج لأزل الحمض النووي الريبي.
  16. تخزين الحمض النووي الريبي في -80 درجة مئوية.
    ملاحظة: منذ تركيز الحمض النووي الريبي لا يمكن تحديده بدقة، استخدام وحدات التخزين الثابتة كمقياس للكمية المدخلات.

2. الرنا الميكروي النسخ العكسي

  1. ذوبان الجليد في النسخ العكسي (RT) مكونات المزيج كاشف: 5X عازلة رد فعل، nuclease خالية من المياه. مزيج عكس بلطف الأنابيب ومكان على الجليد. مباشرة قبل الاستعمال، وإزالة مزيج انزيم من الثلاجة ووضعها على الجليد. تدور باستمرار كل الكواشف.
  2. تحضير مزيج كاشف RT على الجليد كما هو موضح في الجدول رقم 1. إعداد لا يقل عن 10٪ مزيج تزيد.
  3. خلط رد فعل من قبل pipetting، ثم تدور إلى أسفل.
  4. احتضان لمدة 60 دقيقة في 42 ج.
  5. للحرارة إبطال نشاط ترحد ذاته الناسخ لمدة 5 دقائق في 95 ج.
  6. على الفور بارد إلى 4 درجات مئوية.
  7. تخزين كدنا] في -20 درجة مئوية.

3. [كدنا التخفيف

  1. تخفيف كمية من قالب [كدنا حاجة لردود الفعل ddPCR المخطط لها في المياه الحرة نوكلياز. تمييع رد فعل [كدنا بين 01:50 و 1: 500 في الماء، وتعتمد على الهدف ميرنا وفرة. تخزين [كدنا المخفف في -20 درجة مئوية. أثبت كدنا] المخففة لتكون مستقرة لمدة 3 أشهر على الأقل عند درجة حرارة -20 درجة مئوية.

4. الجيل الرذاذ وPCR

ملاحظة: يجب أن يتم تنفيذ الجيل الحبرية في 8 عينات في وقت واحد. ليس مطلوبا من مكررات التقنية، ويرجع ذلك إلى استنساخ عالية من هذه التكنولوجيا يجب تشغيل 12،15 .A لا تحكم قالب (NTC) عينة في كل لوحة ولكل حالة ddPCR مختلفة.

  1. ذوبان الجليد وتتوازن مزيج الرئيسي (على سبيل المثال، EvaGreen ميكس ماجستير)، الرنا الميكروي مجموعة التمهيدي وكدنا] في RT.
  2. مزيج الموافق ميكس ماجستيرoroughly التي كتبها قلب الأنبوب عدة مرات. تدور أسفل كل الكواشف.
  3. تحضير مزيج ddPCR كما هو موضح في الجدول رقم (2). وعندما يتم تنفيذ ردود الفعل ddPCR متعددة، وإعداد ddPCR مزيج عمل-حل. إعداد لا يقل عن 10٪ مزيج تزيد.
  4. تجميعها مرة واحدة، تخلط جيدا وتدور باستمرار مزيج ddPCR.
  5. الاستغناء عن 12 ميكرولتر من ddPCR مزيج إلى 96 جيدا لوحة PCR أو أنابيب PCR.
  6. إضافة 8 ميكرولتر من قالب [كدنا المخفف إلى كل أنبوب / جيد.
  7. أدخل خرطوشة قطرة مولد في حامل.
  8. نقل 20 ميكرولتر من كل عينة على استعداد لآبار العينة (الصف الأوسط) من خرطوشة قطرة مولد بعناية مع تجنب فقاعات الهواء في أسفل البئر.
  9. ملء كل بئر النفط (الصف السفلي) مع 70 ميكرولتر من النفط قطرة المولد.
  10. ربط طوقا على حامل خرطوشة وإدراجه في مولد قطرة.
  11. إغلاق الغطاء لبدء توليد الحبر بما يتوافق والعلاقات العامة الشركة المصنعةotocol. عندما انتهى جيل قطرة، فتح الغطاء، وإزالة حشية المتاح. أعلى آبار خرطوشة تحتوي على قطرات.
  12. الماصة ببطء وسلاسة 40 ميكرولتر من محتويات ثمانية آبار العليا (قطرات) في عمود واحد من لوحة 96-جيدا PCR.
  13. ختم لوحة PCR مع احباط مباشرة بعد نقل قطرات لتجنب التبخر. استخدام pierceable الأختام احباط لوحة التي تتوافق مع الإبر في القارئ قطرة.
  14. تبدأ الدراجات الحرارية (PCR) في غضون 30 دقيقة من ختم اللوحة.
  15. أداء بروتوكول الدراجات وفقا للجدول 3.

5. القطرة القراءة

  1. السلطة على القارئ قطرة.
  2. نقل لوحة من cycler الحرارية للقارئ قطرة.
  3. وضع لوحة 96-جيدا PCR يحتوي على-PCR بعد قطرات في قاعدة حامل اللوحة.
  4. ضع الجزء العلوي من حامل لوحة على لوحة PCR. اضغط بحزم كل من علامات التبويب الإفراجوصولا الى تأمين لوحة PCR في حامل.
  5. بدء تشغيل البرنامج من جهاز الكمبيوتر نظام.
    1. انقر فوق إعداد لتعريف التجربة (الكمي المطلق) ثم انقر فوق تشغيل لبدء القراءة الحبرية.
    2. عندما قطرة قراءة كاملة، انقر على "تحليل" الزر لفتح وتحليل البيانات.
    3. استخدام السعة مؤامرة 2D في برامج التحليل لتحديد قطرات الإيجابية (أداة لاسو) (الشكل 1B).
    4. استخدم علامة التبويب الأحداث للتحقق من عدد من قطرات الإيجابية والشاملة. وحققت 21،000 قطرات عادة مع probeless ddPCR - مجموع عدد 18000.
    5. مرة واحدة ويتم اختيار قطرات إيجابية، تصدير قيم تركيز ميرنا باستخدام الخيار تصدير بتنسيق csv من علامة التبويب التركيز.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

القيمة المطلقة من miRNAs محددة لكل مل من البلازما أو مصل يمكن تحديد باستخدام صبغة الفلورسنت الحمض النووي ملزم الأخضر وقطيرة تكنولوجيا PCR الرقمية الشكل 1 يعرض عملية إيجابية-قطرات الاختيار، والذي يحدد تركيز ميرنا النهائي (نسخ / ميكرولتر ) في رد فعل التضخيم وتحسب على أساس برامج التحليل. قيمة كل ميرنا في الدم هو مختلف جدا، ويجري بعض الأنواع ميرنا أكثر وفرة من غيرها. باستخدام [كدنا المخفف 01:50 في رد فعل ddPCR فمن الممكن الحصول على عدد كاف من قطرات الإيجابية والسلبية. في حالة ايجابية التشبع قطرة (على سبيل المثال، لا قطرات السلبية المتبقية)، يمكن لتخفيف مزيد من العينات [كدنا تكون ضرورية.

ينبغي أن يكون الأمثل لكل مجموعة التمهيدي LNA للعمل بشكل صحيح على النظام PCR الرقمي بالقطيرات. عملية التحسين لمير 181a-5P هيممثلة في الشكل 2 على وجه التحديد، وتغيير كمية من التمهيدي (عادة في نطاق ،25-1 ميكرولتر في رد الفعل ddPCR). ودرجة الحرارة الصلب (عادة في حدود 56-60 درجة مئوية)، فمن الممكن لتحديد مزيج هو الذي يحدد أفضل فصل بين قطرات الإيجابية والسلبية. في حالة مير 181a-5P، 60 درجة مئوية درجة حرارة الصلب وكلا كميات ميكرولتر التمهيدي 0.5 و 1 توفير نتائج أفضل من حيث السعة قطرة.

ويمكن أن يحدث ذلك مجموعة التمهيدي يعطي بعض التضخيم غير محددة، ربما يرجع إلى التمهيدي dimers تشكيل. عند العمل مع تعميم miRNAs، يمكن للإشارة إيجابية من عينات تكون منخفضة جدا، وبالتالي مشابه لإشارة غير محددة. إذا كانت "سحابة" من ​​التضخيم الهدف غير محددة لا تتداخل مع الإشارة الحقيقية (الشكل 1C)، يمكن أن ميرنا لا يزال يكون كميا اختيار فقط صحيح قطرات إيجابية. في هذه الحالة، عينة المجلس الوطني الانتقالي أمر ضروري لاختيار الحبرية. تحتاج إلى معالجتها باستخدام نفس المنهجية وحالة ddPCR متطابقة جميع العينات ليتم تضمينها في نفس التحليل.

شكل 1
الشكل 1. قطرات إيجابي التحديد. ويتم اختيار قطرات إيجابية يدويا أثناء التحليل باستخدام عتبة فوق قطرات السلبية في 1D مؤامرة (A) أو أداء دائرة حول السحابة قطرات إيجابية في 2D مؤامرة (B). وإذا كان بعض مجموعة التمهيدي يعطي التضخيم غير محددة، ويتضح ذلك من خلال سحابة الثانية من قطرات الإيجابية التي تظهر في سيطرة سلبية (لا تحكم قالب، NTC) عينة (C). لا يزال من الممكن اختيار ايجابيات "الحقيقية" باستثناء إشارة غير محددة في 2D المؤامرة.e.jpg من "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. التمهيدي الأمثل مجانا خلية ميرنا الكمي مع Probeless ddPCR لوحة العلوي:. الكمي لمير 181a-5P في عينتين البلازما (S1 و S2) باستخدام 4 شروط ddPCR مختلفة. مير-181a-5P تركيز LNA التمهيدي (0.5 و 1 ميكرولتر) ودرجة الحرارة الصلب (58 و 60 درجة مئوية) يؤثر على اتساع الإيجابي (الأزرق) و (أسود) قطرات السلبية في والإقحام الحمض النووي صبغ ddPCR. فصل وأفضل لهذه ميرنا ويمكن الحصول على أداء PCR في 60 درجة مئوية وباستخدام إما 0.5 أو 1 ميكرولتر التمهيدي. العينة الضابطة (NTC، لا تحكم قالب) لا يوجد لديه قطرات إيجابية، كما هو متوقع. لوحة المركزية: تركيز النهائي من مير 181-5p في الظروف المذكورة أعلاه. يتم عرض النتائج على هيئة نسخ لكل ميكروليتر في AMPLI رد فعل fication. تمثل أشرطة الخطأ بواسون فاصل الثقة 95٪. اللوحة السفلى: عدد قطرات إيجابية (الأزرق) على عدد من قطرات (الأخضر) الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

كاشف الحجم (ميكرولتر)
عازلة رد الفعل 5X 4
nuclease خالية من المياه 11
مزيج انزيم 2
الحمض النووي الريبي مجموع قالب 3
الحجم الكلي 20

الجدول 1 - النسخ العكسي الكاشف مكونات مزيج

العمر = "1">
كاشف الحجم (ميكرولتر)
صبغ SUPERMIX 2X الحمض النووي ملزم 10
LNA مجموعة التمهيدي متغير (0.5 - 1) *
nuclease خالية من المياه متغير
قالب [كدنا المخفف 8
الحجم الكلي 20
* يجب أن يكون أول رد فعل ddPCR أداء مع بعض العينات لتحديد كمية أفضل العمل من التمهيدي

الجدول 2 - ddPCR الكاشف مكونات مزيج

الخطوة الدراجات درجة الحرارة مرة التعلية السعر دورات
تنشيط انزيم 95 ° C 5 دقائق ~ 2 ° C / ثانية 1
تمسخ 95 ° C 30 ثانية 40
الصلب / تمديد 60 ° C 1 دقيقة
استقرار إشارة 4 ° C 5 دقائق 1
90 ° C 5 دقائق 1
عقد (اختياري) 4 ° C غير محدود 1
استخدام غطاء ساخنة لتعيين 105 درجة مئوية، وضبط حجم العينة إلى 40 ميكرولتر.

ف together.within الصفحات = "1"> الجدول 3 - شروط ركوب الدراجات الحرارية لالقطرة PCR الرقمية

Subscription Required. Please recommend JoVE to your librarian.

Discussion

miRNAs تعميم موجودة في الدم بتركيزات منخفضة للغاية وكمية من الحمض النووي الريبي التي يمكن استخلاصها من عينات البلازما والمصل منخفضة. لهذا السبب، فإن من الصعب تحديد مع تقنيات أخرى مثل ميكروأري وتسلسل الحمض النووي الريبي. وعلاوة على ذلك، هناك نقص معمم الاتفاق على تطبيع البيانات ووجود miRNAs الذاتية "المرجعية" في الدم. في هذا السياق، وهو تكنولوجيا حساسة مثل قطرة PCR الرقمي، قادرة على إحصاء عدد النسخ ميرنا لكل مليلتر من الدم أو البلازما حتى لو منخفض جدا، جذابة جدا. نحن تقرن هذه التكنولوجيا مع نظام كدنا] عالمي عكس يدون كل miRNAs المتداولة في رد فعل واحد وبالتالي توفير الوقت والأهم، مادة الحمض النووي الريبي. في نهجنا، خصوصية هي ملازمة لاستخدام بادئات حالات الغدد، التي كان أداؤها جيدا جدا في ميرنا الكمي بالمقارنة مع الحلول الأخرى 16.

قطيرةالرقمية PCR هو فحص نقطة النهاية التي تسمح للحساب الجينات المستهدفة التركيز المطلق. على عكس PCR الكمي، وعدم كفاية الكفاءة التضخيم لا تؤثر على القياس الكمي ddPCR النهائي. لذلك، بالنظر إلى كمية من مثبطات PCR الحالية على سبيل المثال في عينات الدم، يوفر ddPCR أداة قوية لتعميم تقييم الأحماض النووي.

نظرا لحساسية عالية، وتوفر التكنولوجيا وتقدير كاف أيضا من miRNAs أقل وفرة، حتى مع كمية محدودة من بدء المادية. وبالإضافة إلى ذلك، على افتراض أن كل جزيء ميرنا وكتب الاتجاه المعاكس في جزيء [كدنا]، يمكننا حساب النسخ المطلقة في 1 ميكرولتر بلازما / مصل ضرب تركيز حصلت في قيمة رد فعل ddPCR لعامل التخفيف (145.83).

سير العمل المقدمة يمكن أداؤها بسهولة على 8-96 العينات في وقت واحد، مما يوفر أداة موثوقة وفعالة الوقت لتقدير الرنا الميكروي في الإكلينيكيةعينات لتر. قطرة PCR الرقمية لديها القدرة على أن تصبح أداة أساسية للأحماض النووية المؤشرات الحيوية التقييم في وضع التشخيص، ليصل بذلك إجمالي خزعة السائل من على مقاعد البدلاء إلى السرير.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

بدعم من تمويل من الاتحاد الإيطالي لأبحاث السرطان (جنة العلاقات الصناعية الاسترالية) لMF (MFAG 11676) وMN (برنامج الجزيئية الخاصة الأورام السريري - 5 بالألف ن 9980، 2010/15) ومن الوزارة الإيطالية للتعليم والجامعات و البحث FIRB 2011 إلى MN (مشروع RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics