Cirkulerende MicroRNA Kvantificering Brug DNA-bindende Dye Kemi og Droplet Digital PCR

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Cirkulerende (af cellefrie) microRNA (miRNA) frigives fra cellerne ind i blodbanen. Mængden af ​​specifikke microRNA i kredsløbet er blevet knyttet til en sygdomstilstand og har potentiale til at blive brugt som sygdom biomarkør. En følsom og præcis metode til cirkulerende microRNA kvantificering ved hjælp af en dye-baserede kemi og dråbe digital PCR-teknologi er for nylig blevet udviklet. Specifikt hjælp Locked Nucleic Acid (LNA) -baseret miRNA-specifikke primere med en grønt fluorescerende DNA-bindende farvestof i en kompatibel dråbe digital PCR-system er det muligt at opnå den absolutte kvantificering af specifikke miRNA. Her beskriver vi, hvordan udfører denne teknik til at vurdere miRNA beløb i biologiske væsker, såsom plasma og serum, er både mulig og effektiv.

Protocol

MicroRNA Isolering fra plasma eller serum

Bemærk: plasma og serum forberedelse er et relevant skridt i cirkulerende miRNA kvantificering. Der er ingen foretrukken procedure for plasma og serum forberedelse. Det eneste vigtige ting at overveje, er, at alle prøver fra samme eksperiment skal behandles ved hjælp præcis den samme arbejdsgang. Start fra 200 pi serum eller plasma. Total RNA kan isoleres fra serum eller plasma under anvendelse af kommercielt tilgængelige kits.

1. Protokol for Total RNA (herunder miRNA) Isolering

  1. Optø serum / plasma prøver på is.
  2. Der tilsættes 1 ml Lysis Reagent (f.eks., QIAzol) til 200 pi serum / plasma.
  3. Vortexes og placere røret med homogenatet på bænken ved stuetemperatur i 5 min.
  4. Tilsæt 3 pi af en 4,16 nM opløsning af det syntetiske miRNA cel-MIR-39-3p fra C. elegans.
  5. Tilsæt 200 pi chloroform. Ryst røret kraftigt i 15 sek. Place the rør på bænken ved stuetemperatur i 2 min.
  6. Centrifuger i 15 minutter ved 12.000 xg ved 4 ° C til opnåelse faser separation: den øvre vandige fase indeholder RNA.
  7. Overfør den vandige fase til et nyt rør, omkring 700 pi, undgå overførsel af alle hvide interfase materiale.
  8. Tilsæt 1 ml 100% ethanol og bland ved at vende.
  9. Pipette up 700 pi af prøven i en mini rotationskolonne anbragt på en 2 ml opsamlingsrør. Luk låget og der centrifugeres ved 12.000 xg i 15 sek. Kassér gennemløbet.
  10. Gentag dette trin ved hjælp af resterende prøve.
  11. Tilføj 700 pi Buffer RWT til mini spin-kolonnen, luk låget og centrifuger i 15 sek ved 12.000 xg at vaske kolonnen. Kassér gennemløbet.
  12. Pipetter 500 pi Buffer RPE i mini spinsøjle. Luk låget og centrifugeres i 15 sekunder ved 12.000 rpm. Kassér gennemløbet. Gentag dette trin igen.
  13. Centrifugeres mini spinkolonne ved fuld hastighed i 2 min for at tørre spin-søjlemembran fra tilbageværende ethanol.
  14. Overfør mini spinkolonne i et nyt 1,5 ml opsamlingsrør og pipette 35 pi RNase-frit vand på membranen af ​​søjlen.
  15. Centrifugeres i 1 min ved 12.000 xg til eluering af RNA.
  16. Opbevar RNA ved -80 ° C.
    Bemærk: Da RNA-koncentrationen ikke kan bestemmes præcist, bruge faste mængder som et mål for input beløb.

2. MicroRNA Reverse Transcription

  1. Optø revers transkription (RT) reagensblanding komponenter: 5x reaktionsbuffer, nuclease-frit vand. Bland forsigtigt at vende rørene og sted på is. Umiddelbart før brug fjernes enzymet mix fra fryseren og læg på is. Spin ned alle reagenser.
  2. Forbered RT reagensblanding på is som beskrevet i tabel 1. Laves mindst 10% overstiger mix.
  3. Bland reaktionen ved pipettering, og derefter vågeblus.
  4. Inkuber i 60 minutter ved 42 ° C.
  5. Heat-inaktivere reverSE transkriptase i 5 minutter ved 95 ° C.
  6. Umiddelbart køligt til 4 ° C.
  7. Opbevar cDNA ved -20 ° C.

3. cDNA Fortynding

  1. Fortynd mængden af ​​cDNA template nødvendig for de planlagte ddPCR reaktioner i nuklease frit vand. Fortynd cDNA reaktionen mellem 1:50 og 1: 500 i vand, afhængig af target miRNA overflod. Opbevar fortyndede cDNA ved -20 ° C. Den fortyndede cDNA viste sig at være stabil i mindst 3 måneder ved -20 ° C.

4. Droplet Generation og PCR

Bemærk: Droplet generation skal udføres på 8 prøver ad gangen. Tekniske replikater er ikke påkrævet, på grund af den høje reproducerbarhed af denne teknologi 12,15 .A nr Template kontrol (NTC) prøve bør køres i hver plade og for hver forskellig ddPCR tilstand.

  1. Optø og tempereres master mix (f.eks., EvaGreen Master Mix), microRNA primer sæt og cDNA ved RT.
  2. Bland Master Mix thoroughly ved at vende røret flere gange. Spin ned alle reagenser.
  3. Forbered ddPCR mix som beskrevet i tabel 2. Når flere ddPCR reaktioner udføres, udarbejde en ddPCR mix arbejderklassen løsning. Fremstilles mindst 10% overstiger mix.
  4. Når samlet, blandes grundigt og spin ned ddPCR mix.
  5. Dispensere 12 pi ddPCR blandes i en 96-brønds PCR-plade eller PCR-rør.
  6. Tilsæt 8 pi fortyndet cDNA-skabelon til hvert rør / brønd.
  7. Sæt dråben generator patronen ind i holderen.
  8. Transfer 20 pi af hver forberedt prøve til prøvebrøndene (midterste række) af dråben generator patronen forsigtigt samtidig undgå luftbobler ved bunden af ​​brønden.
  9. Fyld hver oliebrønd (nederste række) med 70 pi dråbe generator olie.
  10. Hook pakningen løbet patronholderen og indsætte i dråben generator.
  11. Luk låget for at starte dråbe generation ifølge producentens protocol. Når generation dråbe er færdig, skal du åbne låget, tag engangs pakning. De øverste brønde i patronen indeholder dråberne.
  12. Pipetter langsomt og jævnt 40 pi af indholdet af de øverste otte brønde (dråberne) i en enkelt kolonne med en 96-brønds PCR-plade.
  13. Forsegl PCR-plade med folie straks efter overførsel smådråber for at undgå fordampning. Brug gennembrydelige folie plade sæler, der er kompatible med nålene i dråben læseren.
  14. Begynd termisk cykling (PCR) inden for 30 min til fuldstændig lukning af pladen.
  15. Udfør cyklus-forløb ifølge tabel 3.

5. Droplet Reading

  1. Tænd dråben læseren.
  2. Flyt pladen fra termiske cykler til dråben læseren.
  3. Placer 96-brønds PCR-plade indeholdende Post-PCR dråber ind i bunden af ​​holderen pladen.
  4. Placer toppen af ​​pladen holderen på PCR-plade. Pres begge faner releasened for at fastgøre PCR-plade i holderen.
  5. Start softwaren fra systemet PC.
    1. Klik på Opsætning for at definere eksperimentet (Absolute kvantificering) og klik derefter på Kør for at starte læsning dråbe.
    2. Når dråbe læsning er færdig, klik på "Analyser" knappen for at åbne og analysere dataene.
    3. Brug 2D amplitude plot i analysen software til at vælge de positive dråber (lasso tool) (Figur 1B).
    4. Brug fanen Hændelser for at kontrollere antallet af positive og samlede dråber. Der er i alt 18.000 - 21.000 dråber opnås normalt med probeless ddPCR.
    5. Når de positive dråber er valgt, eksportere miRNA koncentrationsværdier hjælp eksporten .csv indstilling fra fanen Koncentration.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Den absolutte mængde af specifikke miRNA pr ml plasma eller serum kan bestemmes under anvendelse af et grønt fluorescerende DNA-bindende farvestof og dråbe digital PCR-teknologi. Figur 1 viser processen med positiv-dråber markering, som bestemmer den endelige miRNA fusion (kopier / pl ) i amplifikationsreaktionen beregnes af analyseprogrammet. Mængden af ​​hver miRNA i blodet er meget anderledes, at være nogle miRNA arter mere rigelige end andre. Ved hjælp af en 1:50 fortyndet cDNA i ddPCR reaktionen er det muligt at opnå et tilstrækkeligt antal positive og negative dråber. I tilfælde af positiv dråbe mætning (f.eks., Ingen tilbageværende negative dråber), kunne en yderligere fortynding af cDNA prøver være nødvendig.

Hver LNA primer sæt bør optimeres til at fungere ordentligt på dråben digitale PCR-system. Optimeringsprocessen for miR-181a-5p errepræsenteret i figur 2 Specifikt ændre mængden af primer (sædvanligvis i området fra 0,25 - 1 pi pr ddPCR reaktion). og annealing temperatur (sædvanligvis i området på 56 - 60 ° C), er det muligt at vælge kombinationen som bestemmer en bedre adskillelse mellem positive og negative dråber. I tilfælde af MIR-181a-5p, 60 ° C annealingstemperatur og begge 0,5 og 1 pi primer beløb give bedre resultat i form af små dråber amplitude.

Det kunne ske, at en primer sæt giver nogle ikke-specifik amplifikation, sandsynligvis på grund af primer-dimerer formation. Når man arbejder med cirkulerende miRNA, kan det positive signal fra prøver være meget lav, og derfor ligner den ikke-specifikke signal. Hvis "sky" af ikke-specifikt mål amplifikationen ikke overlapper det sande signal (figur 1C), kan miRNA stadig kvantificeres vælge kun den sande positive dråber. I dette tilfælde er NTC prøve er afgørende for udvælgelse af dråber. Alle prøver, der skal indgå i den samme analyse skal behandles ved hjælp af samme metode og identisk ddPCR tilstand.

figur 1
Figur 1. Positive Dråber Selection. Positive dråber valgt manuelt under analysen ved hjælp af en tærskel, over de negative dråber i 1D plot (A) eller udfører en cirkel omkring den positive dråbe sky i 2D plot (B). Hvis nogle primersæt giver en ikke-specifik amplifikation, dette fremgår af en anden sky af positive dråber, der vises i den negative kontrol (nr Template Control NTC) prøve (C). De "ægte" positiver kan stadig vælges eksklusive uspecifikke signal i 2D plot.e.jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Primer optimering til Cellefri miRNA Kvantificering med Probeless ddPCR Overpanel:. Kvantificering af miR-181a-5p i to plasmaprøver (S1 og S2) ved hjælp af 4 forskellige ddPCR betingelser. MIR-181a-5p LNA primerkoncentration (0,5 og 1 pi) og annealing temperatur (58 og 60 ° C) påvirker amplituden af ​​positive (blå) og negative (sorte) smådråber i DNA-interkalerende farvestof ddPCR. Der kan opnås en bedre adskillelse til denne miRNA udføre PCR ved 60 ° C og under anvendelse af enten 0,5 eller 1 pi primer. Kontrolprøven (NTC, nr Template Control) har ingen positive dråber, som forventet. Centrale panel: Slutkoncentration af MIR-181-5p i de ovennævnte betingelser. Resultaterne præsenteres som kopier pr mikroliter i forstærkerfikation reaktion. Fejlsøjler repræsenterer Poisson 95% konfidensinterval. Lavere panel:. Antal positive dråber (blå) på det samlede antal dråber (grøn) Klik her for at se en større version af dette tal.

Reagens Volumen (pi)
5x Reaction buffer 4
Nuklease-frit vand 11
enzymblanding 2
Skabelon total RNA 3
totalvolumen 20

Tabel 1 - revers transkription reagensblanding Components

Reagens Volumen (pi)
2x DNA-bindende farvestof Supermix 10
LNA primersæt variabel (0,5 - 1) *
Nuklease-frit vand variabel
Fortyndet cDNA skabelon 8
totalvolumen 20
* En første ddPCR reaktion bør være udføre med få prøver at etablere den bedst arbejder mængde primer

Tabel 2 - ddPCR reagensblanding Components

Cykling Step Temperatur Tid ramping Rate Cykler
enzymaktivering 95 ° C 5 min ~ 2 ° C / sekund 1
denaturering 95 ° C 30 sek 40
Hydraulik / udvidelse 60 ° C 1 min
Signal stabilisering 4 ° C 5 min 1
90 ° C 5 min 1
Hold (valgfrit) 4 ° C uendelig 1
Brug en opvarmet låg indstillet til 105 ° C og indstil prøvevolumen til 40 pi.

Tabel 3 - Termiske Cykling Betingelser for Droplet Digital PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Cirkulerende miRNA er til stede i blod ved ekstremt lave koncentrationer, og mængden af ​​RNA, som kan ekstraheres fra plasma og serumprøver er lav. Af denne grund, er de vanskelige at kvantificere med andre teknikker, såsom mikroarray og RNA-sekventering. Desuden er der en generel mangel på enighed om data normalisering og tilstedeværelsen af ​​endogene "Reference" miRNA i blodet. I denne sammenhæng er en følsom teknologi som dråber digital PCR, i stand til at tælle antallet af miRNA kopier pr ml serum eller plasma, selvom meget lav, er meget attraktiv. Vi parret denne teknologi med et universelt cDNA system, reverse-transskriberer alle de cirkulerende miRNA i en reaktion derfor sparer tid og, vigtigst, RNA materiale. I vores tilgang, specificiteten er uløseligt forbundet med brugen af LNA primere, som udføres meget godt i miRNA kvantificering i forhold til andre løsninger 16.

Dropletdigital PCR er en end-point analyse, der giver mulighed for beregning af målgener absolut koncentration. I modsætning til kvantitativ PCR, behøver utilstrækkelige amplifikationseffektiviteter ikke påvirke den endelige ddPCR kvantificering. Derfor overvejer mængden af ​​PCR-inhibitorer stede for eksempel i blodprøver, ddPCR giver en robust værktøj til cirkulering nukleinsyrer vurdering.

På grund af sin høje følsomhed, teknologien giver en passende kvantificering også af de mindre rigelige miRNA, selv med begrænset mængde udgangsmateriale. Desuden antager, at hver miRNA molekyle revers transkriberes i et cDNA-molekyle, kan vi beregne de absolutte eksemplarer 1 pi plasma / serum multiplicere den opnåede koncentration i ddPCR reaktion værdi for en fortyndingsfaktor (145,83).

Den præsenterede arbejdsgang kan let udføres på 8-96 prøver ad gangen, hvilket giver en pålidelig og tid effektivt værktøj til microRNA kvantificering i Clinical prøver. Droplet digital PCR har potentiale til at blive et vigtigt redskab for nukleinsyrer biomarkører vurdering i en diagnostisk indstilling, og derved bringe væske biopsi fra bænken til sengekanten.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Støttet af midler fra den italienske sammenslutning for Cancer Research (AIRC) til MF (MFAG 11676) og MN (Special Program Molekylær Klinisk Onkologi -. 5 promille n 9980, 2010/15), og fra det italienske ministerium for undervisning, universitet og Forskning FIRB 2011 til MN (Project RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics