Di circolazione MicroRNA Quantificazione Utilizzando DNA-binding Dye Chimica e di gocce Digital PCR

Bioengineering

GE Global Research must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Di circolazione (di cell-free) microRNA (miRNA) vengono rilasciati dalle cellule nel flusso sanguigno. La quantità di microRNA specifici in circolazione è stato collegato a uno stato di malattia e ha il potenziale per essere utilizzato come biomarker della malattia. Un metodo sensibile e preciso per circolazione microRNA quantificazione utilizzando una chimica a base di colorante e di gocce tecnologia PCR digitale è stato recentemente sviluppato. In particolare, utilizzando Locked Nucleic Acid (LNA) a base di primer specifici miRNA con un colorante legante il DNA fluorescente verde in un sistema PCR compatibile gocciolina digitale, è possibile avere la quantificazione assoluta di miRNA specifici. Qui, descriviamo come l'esecuzione di questa tecnica per valutare la quantità di miRNA nei fluidi biologici, come il plasma e il siero, è sia fattibile ed efficace.

Protocol

MicroRNA Isolamento da plasma o siero

Nota: Plasma e la preparazione del siero è un passo rilevante in circolazione miRNA quantificazione. Non esiste una procedura preferita per il plasma e preparazione del siero. L'unica cosa importante da considerare è che tutti i campioni dello stesso esperimento devono essere elaborati usando esattamente lo stesso flusso di lavoro. Inizia dal siero 200 ml o plasma. RNA totale può essere isolato dal siero o plasma utilizzando kit disponibili in commercio.

1. Protocollo per RNA totale (compresi i miRNA) Isolamento

  1. campioni di siero / plasma Scongelare su ghiaccio.
  2. Aggiungere 1 ml di Reagente di Lisi (ad es., QIAzol) a 200 ml di siero / plasma.
  3. Mescolare nel vortex e posizionare il tubo contenente l'omogeneizzato in panchina a temperatura ambiente per 5 min.
  4. Aggiungere 3 ml di una soluzione 4.16 nM del sintetico miRNA cel-miR-39-3p da C. elegans.
  5. Aggiungere 200 ml di cloroformio. Agitare la provetta con forza per 15 sec. ° postoe tubo in panchina a temperatura ambiente per 2 minuti.
  6. Centrifugare per 15 min a 12.000 xga 4 ° C per ottenere la separazione fasi: la fase acquosa superiore contiene RNA.
  7. Trasferire la fase acquosa in una nuova provetta, circa 700 ml, evitare il trasferimento di qualsiasi materiale interfase bianco.
  8. Aggiungere 1 ml di etanolo al 100% e miscelare per inversione.
  9. Pipettare su 700 ml di campione in una colonna di mini rotazione collocato su un tubo di raccolta da 2 ml. Chiudere il coperchio e centrifugare a 12.000 xg per 15 sec. Gettare il flow-through.
  10. Ripetere questa operazione con il campione rimanente.
  11. Aggiungere 700 microlitri di buffer RWT alla colonna mini rotazione, chiudere il coperchio e centrifugare per 15 secondi a 12.000 xg per lavare la colonna. Gettare il flow-through.
  12. Dispensare 500 microlitri Buffer RPE nella colonna mini rotazione. Chiudere il coperchio e centrifugare per 15 sec a 12.000 rpm. Gettare il flow-through. Ripetere questo passaggio.
  13. Centrifugare la colonna di spin mini a tutta velocità per 2 minuti per asciugare la colonna di spinmembrana da etanolo residuo.
  14. Trasferire la colonna mini centrifuga in una nuova provetta da 1,5 ml raccolta e acqua priva di RNasi pipetta 35 microlitri sulla membrana della colonna.
  15. Centrifugare per 1 min a 12.000 xg per eluire l'RNA.
  16. Conservare l'RNA a -80 ° C.
    Nota: Dal momento che la concentrazione di RNA non può essere determinata con precisione, utilizzare volumi fissi come misura per la quantità di input.

2. MicroRNA trascrizione inversa

  1. Scongelare la trascrizione inversa (RT) Componenti miscela reagente: tampone di reazione 5x, acqua priva di nucleasi. Mescolare capovolgendo delicatamente i tubi e posto sul ghiaccio. Immediatamente prima dell'uso, rimuovere la miscela enzimatica dal congelatore e disporli sul ghiaccio. Spin giù tutti i reagenti.
  2. Preparare la miscela reagente RT su ghiaccio come descritto nella Tabella 1. Preparare almeno il 10% della miscela superiore.
  3. Mescolare la reazione pipettando, e poi spin down.
  4. Incubare per 60 min a 42 ° C.
  5. Heat-inattivare i reverSE trascrittasi per 5 minuti a 95 ° C.
  6. Immediatamente raffreddare a 4 ° C.
  7. Conservare il cDNA a -20 ° C.

3. cDNA diluizione

  1. Diluire la quantità di cDNA necessari per le reazioni ddPCR previste in acqua priva di nucleasi. Diluire la reazione cDNA tra 1:50 e 1: 500 in acqua, a seconda bersaglio miRNA abbondanza. Conservare il cDNA diluito a -20 ° C. Il cDNA diluito dimostrato di essere stabile per almeno 3 mesi a -20 ° C.

4. Droplet generazione e PCR

Nota: generazione gocciolina deve essere eseguita su 8 campioni per volta. Repliche tecniche non sono tenuti, a causa della elevata riproducibilità di questa tecnologia 12,15 .A No Control Template (NTC) campione deve essere eseguito in ogni piatto e per ogni diversa condizione ddPCR.

  1. Scongelare ed equilibrare il mix master (ad es., EvaGreen Master Mix), microRNA Primer set e cDNA a temperatura ambiente.
  2. Mescolare il Master Mix °oroughly invertendo la provetta diverse volte. Spin giù tutti i reagenti.
  3. Preparare il mix ddPCR come descritto nella Tabella 2. Quando si eseguono più reazioni ddPCR, preparano una ddPCR mix di lavoro-soluzione. Preparare almeno il 10% superiore a miscela.
  4. Una volta assemblato, mescolare bene e spin down mix ddPCR.
  5. Dispensare 12 ml di ddPCR mescolano in un pozzo-96 piastra PCR o provette PCR.
  6. Aggiungere 8 ml di cDNA diluito in ogni provetta / bene.
  7. Inserire la cartuccia generatore di gocce nel supporto.
  8. Trasferire 20 microlitri di ciascun campione preparato ai pozzetti del campione (fila centrale) della cartuccia generatore gocciolina accuratamente evitando bolle d'aria nella parte inferiore del pozzo.
  9. Riempire ogni pozzo di petrolio (riga in basso) con 70 ml di olio di generatore di goccioline.
  10. Agganciare la guarnizione sopra il supporto della cartuccia e inserire nel generatore di goccioline.
  11. Chiudere il coperchio per avviare la generazione delle gocce in base al pr del produttoreotocol. Quando la generazione delle gocce è terminata, aprire il coperchio, rimuovere la guarnizione usa e getta. I primi pozzetti della cartuccia contengono le goccioline.
  12. Pipettare lentamente ed uniformemente 40 ml di contenuto degli otto migliori pozzetti (le goccioline) in un'unica colonna di una piastra a 96 pozzetti PCR.
  13. Sigillare la piastra PCR con un foglio subito dopo il trasferimento gocce per evitare l'evaporazione. Utilizzare piastra del foil perforabili che sono compatibili con gli aghi nel lettore gocciolina.
  14. Iniziare cicli termici (PCR) entro 30 minuti dalla chiusura ermetica del piatto.
  15. Eseguire il protocollo di ciclismo secondo la Tabella 3.

5. Droplet Reading

  1. Accendere il lettore goccia.
  2. Spostare la piastra dal termociclatore al lettore goccia.
  3. Posizionare la piastra a 96 pozzetti PCR contenente le goccioline post-PCR nella base del supporto piastra.
  4. Posizionare la parte superiore del portatarga sulla piastra PCR. Premere con forza entrambe le linguette di rilascioper fissare la piastra PCR nel supporto.
  5. Avviare il software dal PC sistema.
    1. Fare clic su Imposta per definire l'esperimento (quantificazione assoluta) quindi fare clic su Esegui per avviare la lettura delle gocce.
    2. Quando la lettura delle gocce è completo, fare clic sul pulsante per aprire e analizzare i dati "Analizza".
    3. Utilizzare la trama di ampiezza 2D nel software di analisi per selezionare le goccioline positivi (lazo) (Figura 1B).
    4. Utilizzare la scheda Eventi per verificare il numero di goccioline positivi e totali. Un totale di 18.000 - 21.000 goccioline è di solito realizzato con senza sonda ddPCR.
    5. Una volta che le goccioline positivi sono selezionati, esportare i valori di concentrazione miRNA utilizzando l'opzione di esportazione CSV dalla scheda di concentramento.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La quantità assoluta di miRNA specifici per ml di plasma o siero può essere determinato utilizzando un colorante legame al DNA fluorescente verde e di gocce tecnologia PCR digitale. La figura 1 mostra il processo di selezione positiva-goccioline, che determina la concentrazione finale miRNA (copie / ml ) nella reazione di amplificazione calcolata dal software di analisi. L'importo di ciascuna miRNA nel sangue è molto diversa, essendo alcune specie miRNA più abbondante rispetto ad altri. Utilizzando una 01:50 cDNA diluito in reazione ddPCR è possibile avere un numero adeguato di goccioline positivi e negativi. In caso di saturazione gocciolina positiva (ad es., Senza gocce rimanenti negativo), una ulteriore diluizione dei campioni di cDNA può essere necessario.

Ogni set di primer LNA deve essere ottimizzata per funzionare correttamente sul sistema PCR digitale goccia. Il processo di ottimizzazione per il miR-181a-5p èrappresentata nella figura 2 In particolare, modificando la quantità di primer (di solito nella gamma di 0,25 - 1 ml per reazione ddPCR). e la temperatura di ricottura (solitamente nella gamma del 56 - 60 ° C), è possibile selezionare la combinazione che determina una migliore separazione tra goccioline positivi e negativi. Nel caso di miR-181a-5p, 60 ° C di temperatura di ricottura e sia 0,5 e 1 ml di primer importi fornire il miglior risultato in termini di ampiezza gocciolina.

Potrebbe accadere che un insieme di primer dà qualche amplificazione non specifica, probabilmente a causa di primer dimeri formazione. Quando si lavora con circolazione miRNA, il segnale positivo da campioni potrebbe essere molto bassa e quindi simile al segnale non specifico. Se la "nuvola" di non specifica l'amplificazione di destinazione non si sovrappone con il vero segnale (Figura 1C), il miRNA può ancora essere quantificato selezionando solo il vero goccioline positivi. In questo caso, il campione NTC è essenziale per la selezione gocciolina. Tutti i campioni devono essere inclusi nella stessa analisi devono essere trattati con la stessa metodologia e identiche condizioni ddPCR.

Figura 1
Figura 1. goccioline positivi di selezione. Goccioline positivi vengono selezionati manualmente durante l'analisi utilizzando una soglia al di sopra le goccioline negativi in 1D plot (A) o l'esecuzione di un cerchio intorno la nube di goccioline positivo nella trama 2D (B). Se alcuni set di primer dà una amplificazione non specifico, questo è dimostrato da una seconda nube di goccioline positivi che appare nel controllo negativo (nessun controllo Template, NTC) del campione (C). Gli aspetti positivi "veri" possono ancora essere selezionati escludendo il segnale non specifico nella trama 2D.e.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. Ottimizzazione Primer per cell-free miRNA Quantificazione con senza sonda ddPCR Pannello superiore:. Quantificazione di miR-181-5p in due campioni di plasma (S1 e S2) con 4 diverse condizioni ddPCR. Mir-181-5p concentrazione LNA iniettore (0,5 e 1 ml) e la temperatura di ricottura (58 e 60 ° C) influenzano l'ampiezza dei risultati positivi (blu) e gocce (nero) negativo nel colorante DNA intercalanti ddPCR. Una migliore separazione per questo miRNA può essere ottenuta eseguendo la PCR a 60 ° C ed utilizzando 0,5 o 1 ml primer. Il campione di controllo (NTC, nessun controllo modello) non ha goccioline positivi, come previsto. Pannello centrale: concentrazione finale di miR-181-5p nelle condizioni sopra citate. I risultati sono presentati come copie per microlitro nel amplireazione zione. Le barre di errore rappresentano il Poisson 95% intervallo di confidenza. Pannello inferiore:. Numero di goccioline positivi (blu) sul numero totale di gocce (verde) Si prega di cliccare qui per vedere una versione più grande di questa figura.

Reagente Volume (ml)
tampone di reazione 5x 4
acqua priva di nucleasi 11
mix Enzyme 2
RNA totale Template 3
Volume totale 20

Tabella 1 - trascrizione inversa reagenti Componenti Mix

Reagente Volume (ml)
2x DNA-binding dye Supermix 10
primer LNA variabile (0,5 - 1) *
acqua priva di nucleasi variabile
cDNA diluito 8
Volume totale 20
* Una prima reazione ddPCR dovrebbe essere esibirsi con alcuni campioni per stabilire la quantità migliore lavorazione di primer

Tabella 2 - ddPCR reagenti Componenti Mix

Ciclismo Passo Temperatura Tempo ramping Tasso cicli
attivazione di enzimi 95 ° C 5 minuti ~ 2 ° C / sec 1
Denaturazione 95 ° C 30 sec 40
Ricottura / estensione 60 ° C 1 minuto
stabilizzazione del segnale 4 ° C 5 minuti 1
90 ° C 5 minuti 1
Hold (opzionale) 4 ° C infinito 1
Utilizzare un coperchio riscaldato impostato a 105 ° C e impostare il volume del campione di 40 ml.

Tabella 3 - riciclaggio termico Condizioni di Droplet digitale PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

miRNA circolanti sono presenti nel sangue a concentrazioni estremamente basse e la quantità di RNA che può essere estratto da campioni di plasma e siero è basso. Per questo motivo, sono difficili da quantificare con altre tecniche come microarray e RNA sequencing. Inoltre, vi è una generalizzata mancanza di accordo sulla normalizzazione dei dati e la presenza di endogene miRNA "di riferimento" nel sangue. In questo contesto, una tecnologia sensibile come gocciolina PCR digitale, in grado di contare il numero di copie miRNA per ml di siero o plasma, anche se molto bassa, è molto interessante. Abbiamo abbinato questa tecnologia con un sistema di cDNA universale che invertire-trascrive tutti i miRNA che circolano in una reazione quindi risparmio di tempo e, più importante, materiali RNA. Nel nostro approccio, la specificità è inerente l'uso di primer LNA, che eseguite molto bene in miRNA quantificazione rispetto ad altre soluzioni 16.

Gocciolinadigitale PCR è un test end-point che consente il calcolo di geni bersaglio concentrazione assoluta. A differenza di PCR quantitativa, l'efficienza di amplificazione inadeguate non influenzano la quantificazione finale ddPCR. Pertanto, considerando la quantità di inibitori della PCR presenti per esempio in campioni di sangue, ddPCR fornisce uno strumento robusto per circolazione valutazione acidi nucleici.

Grazie alla sua elevata sensibilità, la tecnologia fornisce una quantificazione adeguata anche dei miRNA meno abbondanti, anche con quantità limitata di materiale di partenza. Inoltre, partendo dal presupposto che ogni molecola miRNA è inverso trascritto in una molecola di cDNA, possiamo calcolare le copie assoluto in 1 ml di plasma / siero ottenuto moltiplicando la concentrazione di valore reazione ddPCR per un fattore di diluizione (145.83).

Il flusso di lavoro presentato può essere facilmente eseguita su 8-96 campioni alla volta, fornendo così un efficace strumento affidabile e il tempo per microRNA quantificazione in clinical campioni. Droplet PCR digitale ha il potenziale per diventare uno strumento essenziale per gli acidi nucleici Biomarkers valutazione in un ambiente diagnostico, portando così la biopsia liquido dalla panchina al capezzale.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Sostenuto da un finanziamento dell'Associazione Italiana per la Ricerca sul Cancro (AIRC) a MF (MFAG 11676) e di MN (Programma Speciale Oncologia Molecolare Clinica -. 5 per mille 9980 n, 2010/15) e dal Ministero Italiano dell'Istruzione, dell'Università e della La ricerca FIRB 2011 al MN (Progetto RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics