Zirkulierende MicroRNA Quantifizierung der Basis von DNA-bindenden Farbstoff Chemie und Droplet Digital-PCR

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Zirkulierende (zellfreier) microRNAs (miRNAs) von Zellen in den Blutstrom freigesetzt. Die Menge der spezifischen mikroRNAs im Zirkulations wurde einem Krankheitszustand verbunden und hat das Potential als Krankheits Biomarkers verwendet werden. A sensitive und genaue Methode MikroRNA Quantifizierung zum Zirkulieren eines farbstoffbasierte Chemie und digitalen PCR Technologie Tröpfchens wurde vor kurzem entwickelt. Insbesondere Locked unter Verwendung Nukleinsäure (LNA) miRNA-spezifische Primer mit einem grünen fluoreszierenden DNA-bindenden Farbstoff in einem kompatiblen digital Tröpfchen PCR System -basierte es ist möglich, die absolute Quantifizierung von spezifischen miRNAs zu erhalten. Hier beschreiben wir, wie diese Technik darstellende miRNA Menge in biologischen Flüssigkeiten, zu beurteilen, wie Plasma und Serum, ist sowohl möglich als auch effektiv.

Protocol

MicroRNA Isolierung von Plasma oder Serum

Hinweis: Plasma und Serum Vorbereitung ist ein bedeutender Schritt in zirkulierenden miRNA Quantifizierung. Es gibt keine bevorzugte Verfahren für Plasma und Serumpräparat. Die einzige wichtige Sache zu prüfen ist, dass alle Proben aus dem gleichen Experiment muss genau den gleichen Workflow verarbeitet werden. Starten von 200 & mgr; l Serum oder Plasma. Gesamt-RNA kann aus Serum oder Plasma unter Verwendung von kommerziell erhältlichen Kits isoliert werden.

1. Das Protokoll für Gesamt-RNA (einschließlich miRNA) Isolierung

  1. Thaw Serum / Plasma-Proben auf Eis.
  2. 1 ml Lysis Reagent (z. B. QIAzol) bis 200 & mgr; l Serum / Plasma.
  3. Mix von Verwirbelung und legen Sie den Schlauch des Homogenats auf der Bank bei RT für 5 min enthält.
  4. In 3 ul einer 4,16 nM Lösung des synthetischen miRNA Cel-miR-39-3p von C. elegans.
  5. In 200 ul Chloroform. Das Röhrchen wird kräftig für 15 Sekunden. Platz the Rohr auf der Bank bei RT für 2 min.
  6. Zentrifuge für 15 min bei 12000 xg bei 4ºC Phasen Trennung zu erhalten: Die obere wässrige Phase enthält RNA.
  7. Übertragen Sie die wässrige Phase in ein neues Röhrchen, etwa 700 & mgr; l, vermeiden Übertragung eines weißen Zwischenschichtmaterial.
  8. 1 ml 100% Ethanol und mischen durch Umdrehen.
  9. Pipettieren bis 700 & mgr; l der Probe in einen Mini spin column auf einer 2 ml Sammelröhrchen gegeben. Schließen Sie den Deckel und Zentrifuge bei 12.000 g für 15 Sekunden. Verwerfen Sie den Durchfluss durch.
  10. Wiederholen Sie diesen Schritt, um die restliche Probe verwendet wird.
  11. In 700 & mgr; l Puffer RWT an den Mini-Spin-Säule, den Deckel schließen und Zentrifuge für 15 Sekunden bei 12.000 xg um die Säule zu waschen. Verwerfen Sie den Durchfluss durch.
  12. Pipettieren 500 ul Puffer RPE in die Mini-Spin-Säule. Schließen Sie den Deckel und Zentrifuge für 15 Sekunden bei 12.000 Umdrehungen pro Minute. Verwerfen Sie den Durchfluss durch. Wiederholen Sie es noch einmal.
  13. Zentrifugieren Sie die Mini-Spin-Säule mit voller Geschwindigkeit für 2 min, um die Spin-Säule zum TrocknenMembran aus restliche Ethanol.
  14. Übertragen Sie die Mini-Spin-Säule in ein neues 1,5 ml Sammelröhrchen und Pipette 35 ul RNase-freies Wasser auf die Membran der Säule.
  15. Zentrifugieren für 1 min bei 12000 xg um die RNA zu eluieren.
  16. Lagern Sie die RNA bei -80 ° C.
    Hinweis: Da RNA-Konzentration nicht genau bestimmt werden kann, als Maß für Fixvolumen Eingangsgrße verwenden.

2. MicroRNA Reverse Transkription

  1. Tauen die reverse Transkription (RT) Reagenzienmix Komponenten: 5x Reaktionspuffer, Nuklease-freies Wasser. Mix Umdrehen sanft die Rohre und auf Eis. Unmittelbar vor dem Gebrauch zu entfernen aus dem Gefrierschrank und auf Eis, das Enzym-Mix. Spin down alle Reagenzien.
  2. Bereiten Sie die RT Reagenzienmix auf Eis , wie in Tabelle 1 beschrieben. Bereiten Sie mindestens 10% größer als Mischung.
  3. Mischen Sie die Reaktion durch Pipettieren, und dann drehen nach unten.
  4. Inkubieren für 60 min bei 42 ° C.
  5. Hitze-Inaktivierung die Reverse Transkriptase für 5 min bei 95 ° C.
  6. Sofort kühlen auf 4 ° C.
  7. Lagern Sie die cDNA bei -20 ° C.

3. cDNA Verdünnung

  1. Verdünnen Sie die Menge an cDNA-Matrize, die für die geplanten ddPCR Reaktionen in nukleasefreiem Wasser. Verdünnen Sie die cDNA-Reaktion zwischen 1:50 und 1: 500 in Wasser, abhängig von Ziel-miRNA Hülle und Fülle. Die verdünnte cDNA bei -20 ° C. Die verdünnte cDNA nachgewiesen für mindestens 3 Monate bei -20 ° C stabil.

4. Tröpfchenerzeugung und PCR

Hinweis: Tröpfchenerzeugung sollte auf 8 Proben gleichzeitig durchgeführt werden. Technische Replikate sind nicht erforderlich, aufgrund der hohen Reproduzierbarkeit dieser Technologie 12,15 .A Leerwert -Kontrolle (NTC) Probe in jeder Platte ausgeführt werden soll und für jede unterschiedliche ddPCR Zustand.

  1. Auftauen und den Master - Mix ins Gleichgewicht (z. B. EvaGreen Master Mix), microRNA - Primer - Set und cDNA bei RT.
  2. Mischen Sie den Master Mix thoroughly durch das Rohr mehrmals umgekehrt wird. Spin down alle Reagenzien.
  3. Bereiten Sie die ddPCR Mischung wie in Tabelle 2 beschrieben. Wenn mehrere ddPCR Reaktionen durchgeführt werden, bereiten eine ddPCR Arbeits-Lösung mischen. Bereiten Sie mindestens 10% größer als Mischung.
  4. Nach dem Zusammenbau gründlich ddPCR Mix mischen und Spin-down.
  5. Dispense 12 ul ddPCR mischen in eine 96-Well-PCR-Platte oder PCR-Röhrchen.
  6. In 8 ul der verdünnten cDNA-Matrize in jedes Röhrchen / Vertiefung.
  7. Legen Sie die Tröpfchengeneratorpatrone in die Halterung.
  8. Transfer 20 ul jeder hergestellten Probe zu den Probenvertiefungen (mittlere Reihe) der Tröpfchengeneratorpatrone vorsichtig, während Luft am Boden des Bohrlochs Blasen zu vermeiden.
  9. Füllen Sie jedes Öl gut (untere Reihe) mit 70 & mgr; l Tropfengenerator Öl.
  10. Haken Sie die Dichtung über den Patronenhalter und legen Sie in den Tröpfchengenerator.
  11. Schließen Sie den Deckel Tropfenerzeugung zu beginnen nach Hersteller protocol. Wenn Tröpfchenerzeugung abgeschlossen ist, öffnen Sie den Deckel, die Einweg-Dichtung entfernen. Die oberen Vertiefungen der Patrone enthalten die Tröpfchen.
  12. Pipettieren langsam und gleichmäßig 40 ul die Inhalte der acht Top-Brunnen (die Tröpfchen) in eine einzige Säule einer 96-Well-PCR-Platte.
  13. Verschließen Sie die PCR-Platte mit Folie unmittelbar nach dem Tröpfchen übertragen Verdunstung zu vermeiden. Verwenden Sie durchstechbaren Folienplatte Dichtungen, die mit den Nadeln in der Tröpfchen Leser kompatibel sind.
  14. Beginnen thermischen Zyklen (PCR) innerhalb von 30 Minuten von der Platte abdichten.
  15. Führen Sie die Rad - Protokoll gemäß Tabelle 3.

5. Droplet Lese

  1. Schalten Sie den Tropfen Leser.
  2. Bewegen Sie die Platte aus dem Thermocycler zum Tröpfchen Leser.
  3. Legen Sie die 96-Well-PCR-Platte, die die Post-PCR-Tröpfchen in die Basis des Plattenhalters enthält.
  4. Die Oberkante des Plattenhalters auf der PCR-Platte. Drücken Sie mit beiden FreigabezungenSie die PCR-Platte in der Halterung zu befestigen.
  5. Starten Sie die Software aus dem System PC.
    1. Klicken Sie auf Setup, um das Experiment (Absolute Quantifizierung) dann auf Ausführen zu definieren klicken Sie auf die Tröpfchen Lesen zu beginnen.
    2. Wenn Tröpfchen Lesen abgeschlossen ist, klicken Sie auf "Analysieren", um die Daten zu öffnen und zu analysieren.
    3. Verwenden Sie die 2D - Amplitude Grundstück in der Analyse - Software , die positiven Tröpfchen (Lasso - Werkzeug) (Abbildung 1B) zu wählen.
    4. Verwenden Sie die Registerkarte Ereignisse die Anzahl der positiven und insgesamt Tröpfchen zu überprüfen. Eine Gesamtzahl von 18.000 - 21.000 Tröpfchen wird in der Regel mit ddPCR ohne Sonden erreicht.
    5. Sobald die positive Tröpfchen ausgewählt werden, exportieren die Konzentrationswerte miRNA der Export CSV-Option aus dem Konzentrations Reiter.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Die absolute Menge an spezifischen miRNAs pro ml Plasma oder Serum können mit einem grün fluoreszierenden DNA-bindenden Farbstoff und Tröpfchen digitale PCR - Technologie bestimmt werden. Abbildung 1 den Prozess der positiven Tröpfchen Auswahl präsentiert, die die endgültige miRNA - Konzentration bestimmt (Kopien / ul ) in der Amplifikationsreaktion durch die Analysesoftware berechnet. Die Menge jeder miRNA im Blut ist ganz anders, als andere einige miRNA-Arten häufiger zu sein. Verwendung eines 01.50 verdünnten cDNA in ddPCR Reaktion ist es möglich, eine ausreichende Anzahl von positiven und negativen Tröpfchen zu erhalten. Bei positiver Tröpfchen Sättigung (z. B. keine verbleibenden negativen Tröpfchen), könnte eine weitere Verdünnung der cDNA - Proben erforderlich sein.

Jeder LNA-Primer-Set sollte ordnungsgemäß auf dem Tröpfchen digitale PCR-System zu arbeiten, optimiert werden. Der Optimierungsprozess für miR-181a-5P ist( in der Regel im Bereich von 0,25 bis 1 & mgr; l pro ddPCR Reaktions) dargestellt in Abbildung 2 Insbesondere die Menge des Primers verändert. und die Temper - Temperatur (üblicherweise im Bereich von 56 - 60 ° C) ist es möglich , die Kombination auszuwählen , die bestimmt, um eine bessere Trennung zwischen den positiven und negativen Tröpfchen. Im Falle von miR-181a-5p, 60 ° C Annealingtemperatur und beide 0,5 und 1 & mgr; l Primer-Mengen liefern das bessere Ergebnis in Bezug auf die Tröpfchenamplitude.

Es könnte passieren, dass ein Primer-Set eine unspezifische Amplifikation gibt, wahrscheinlich aufgrund der Primer-Dimere Bildung. Wenn mit zirkulierender miRNAs, das positive Signal von Proben arbeiten könnte sehr gering sein und daher ähnlich dem unspezifischen Signal. Wenn die "Wolke" von nicht-spezifischen Zielverstärkung ist nicht mit dem wahren Signal (1C) überlappen, kann die miRNA noch nur die wahre Auswahl quantifiziert werden positive Tröpfchen. In diesem Fall ist der NTC Probe zur Tropfenauswahl wesentlich. Alle Proben in der gleichen Analyse aufgenommen werden müssen verarbeitet werden, um die gleiche Methode mit identischem ddPCR Zustand.

Abbildung 1
Abbildung 1. Positive Droplets Auswahl. Positive Tröpfchen werden bei der Analyse unter Verwendung einer Schwelle , über die negativen Tröpfchen in 1D Plot (A) oder die Durchführung einen Kreis um die positive Tröpfchenwolke in 2D Plot (B) manuell ausgewählt. Wenn einige Primer - Set eine unspezifische Amplifikation gibt, wird dies durch eine zweite Wolke von positiven Tröpfchen belegt, die in der Negativkontrolle (Leerwert -Kontrolle, NTC) Probe (C) erscheint. Die "wahre" Positives kann noch in 2D Plot mit Ausnahme des nicht-spezifische Signal ausgewählt werden.e.jpg "target =" _ blank "> Bitte hier klicken, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Primer - Optimierung für die zellfreie miRNA Quantifizierung mit ohne Sonden ddPCR Oberplatte:. Die Quantifizierung von miR-181a-5P in zwei Plasmaproben (S1 und S2) mit 4 verschiedenen ddPCR Bedingungen. MiR-181a-5P LNA Primerkonzentration (0,5 und 1 & mgr; l) und die Annealing-Temperatur (58 bis 60 ° C) beeinflussen die Amplitude der positiv (blau) und negativ (schwarz) Tröpfchen in DNA-interkalierenden Farbstoffes ddPCR. Eine bessere Trennung dieser miRNA kann bei 60 ° C erhalten werden, um die PCR durchführt und entweder 0,5 oder 1 & mgr; l Primer verwendet. Die Kontrollprobe (NTC, No Template Control) hat keine positive Tröpfchen, wie erwartet. Zentrale Platte: Endgültige Konzentration von miR-181-5p in den oben genannten Bedingungen. Die Ergebnisse werden als Kopien pro Mikroliter in der ampli präsentiertfizierung Reaktion. Fehlerbalken stellen die Poisson 95% Konfidenzintervall. Unteres Feld:. Anzahl der positiven Tröpfchen (blau) an der Gesamtzahl der Tröpfchen (grün) Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Reagens Volumen (ul)
5x Reaktionspuffer 4
Nuklease-freies Wasser 11
Enzym-Mix 2
Vorlage Gesamt-RNA 3
Volle Lautstärke 20

Tabelle 1 - Reverse Transkription Reagenzienmix Komponenten

Reagens Volumen (ul)
2x DNA-bindenden Farbstoff Supermix 10
LNA-Primer-Set Variable (0,5-1) *
Nuklease-freies Wasser Variable
Verwässertes cDNA-Matrize 8
Volle Lautstärke 20
* Ein erstes sollte ddPCR Reaktion mit wenigen Proben durchzuführen, die beste arbeitPrimerMenge zu etablieren

Tabelle 2 - ddPCR Reagenzienmix Komponenten

Radfahren Schritt Temperatur Zeit Ramping Rate Fahrräder
Enzymaktivierung 95 ° C 5 Minuten ~ 2 ° C / sec 1
Denaturierung 95 ° C 30 sec 40
Glüh- / Verlängerung 60 ° C 1 Minute
Signalstabilisierung 4 ° C 5 Minuten 1
90 ° C 5 Minuten 1
Hold (optional) 4 ° C unendlich 1
Verwenden Sie einen beheizten Deckel auf 105 ° C und stellen Sie das Probenvolumen auf 40 ul.

Tabelle 3 - Thermal Cycling Bedingungen für Droplet Digital - PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Zirkulieren miRNAs sind im Blut bei extrem niedrigen Konzentrationen und die Menge an RNA, die aus Plasma und Serumproben extrahiert werden kann, ist gering. Aus diesem Grund sind sie schwierig mit anderen Techniken wie Mikroarray und RNA-Sequenzierung zu quantifizieren. Darüber hinaus gibt es eine verallgemeinerte keine Einigung über die Datennormalisierung und die Anwesenheit von endogenen "Referenz" miRNAs im Blut. In diesem Zusammenhang ist eine sensible Technik wie Tröpfchen digitale PCR, der fähig ist, die Anzahl der miRNA-Kopien pro ml Serum oder Plasma, auch wenn sehr gering ist, zu zählen sehr attraktiv. Wir gepaart diese Technologie mit einem Universal-cDNA-System die Zeit und, am wichtigsten, RNA Material revers transkribiert alle zirkulierenden daher miRNAs in einem Reaktions speichern. In unserem Ansatz ist die Spezifität auf die Verwendung von LNA - Primer inhärent, die in miRNA Quantifizierung sehr gut durchgeführt , wenn im Vergleich zu anderen Lösungen 16.

Tröpfchendigitale PCR ist ein Endpunkt-Assay, der die Berechnung von Zielgenen absolute Konzentration ermöglicht. Anders als quantitative PCR, unzureichende Amplifikationseffizienzen haben keinen Einfluss auf die endgültige ddPCR Quantifizierung. Daher kann die Menge der PCR-Inhibitoren vorhanden beispielsweise in Blutproben unter Berücksichtigung, bietet ddPCR ein robustes Werkzeug für Nukleinsäuren Beurteilung zirkulieren.

Aufgrund seiner hohen Empfindlichkeit liefert die Technik eine adäquate Quantifizierung auch der weniger reichlich miRNAs, auch mit begrenzten Menge des Ausgangsmaterials. Darüber hinaus unter der Annahme, dass jedes miRNA-Molekül umgekehrt in einem cDNA-Molekül transkribiert wird, können wir die absolute Kopien in 1 ul Plasma / Serum berechnen die erhaltene Konzentration im ddPCR Reaktionswert für einen Verdünnungsfaktor multipliziert (145,83).

Die vorgestellte Workflow kann leicht auf 8-96 Proben zu einem Zeitpunkt durchgeführt werden, so dass eine zuverlässige und zeit effektives Werkzeug für die microRNA Quantifizierung in Clinica Bereitstellungl Proben. Droplet digitale PCR das Potenzial hat, ein wichtiges Instrument für Nukleinsäuren zu werden Biomarker Beurteilung in einem diagnostischen Einstellung, wodurch Flüssigkeit Biopsie von der Bank auf dem Bett zu bringen.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Unterstützt von der italienischen Vereinigung der Finanzierung für Krebsforschung (AIRC) zu MF (MFAG 11676) und MN (Special Program Molecular Clinical Oncology -. 5 Promille n 9980, 2010/15) und aus dem italienischen Ministerium für Unterricht, Universitäten und Forschung FIRB 2011 MN (Projekt RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics