Эмпирическая, метагеномных и вычислительные методы освещают механизмы которых фунгициды компромисса Bee здравоохранения

Environment

Your institution must subscribe to JoVE's Environment section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Микробные консорциумов в ульях пчел шмелей обогатить и сохранить пыльцы для личинок пчел. С помощью следующего поколения последовательности, а также в лабораторных и полевых экспериментов, этот манускрипт описывает протоколы, используемые для проверки гипотезы, что фунгицида остатков изменить пыльцы микрофлора и население колонии, в конечном счете приводит к колонии потери.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Производители часто используют противогрибковые аэрозоли во время цветения для защиты сельскохозяйственных культур против болезней, который предоставляет пчелам фунгицид остатков. Хотя считается «пчела Сейф», есть больше свидетельств того, что остатки фунгицида в пыльце, связанные с пчела спад (для меда и шмелей пчелы видов). Хотя механизмы остаются неизвестными, исследователи предположили, что пчелы Микроб симбиозов участвуют. Микробы играют ключевую роль в сохранении и/или обработка пыльцы, который служит в качестве питания для личинок пчел. Изменяя микробных, вполне вероятно, что фунгициды нарушить эти услуги Микроб опосредованной и тем самым поставить под угрозу здоровье пчел. Эта рукопись описываются протоколы, используемые для расследования косвенные механизма(ов), по которому может быть причиной фунгициды колонии снижение. Кейдж эксперименты, подвергая пчел лечить противогрибковыми цветы уже представили первые свидетельства того, что фунгициды вызывают глубокое колонии потери в родной шмель (Bombus Недотрога). С помощью поля соответствующие дозы фунгицидов, серия экспериментов были разработаны для точного описания динамики микробных фунгицидом облученных пыльцы. Сдвиги в структурный состав грибковых и бактериальных скопления в пыльцы микрофлора расследуются секвенирование нового поколения и метагеномных анализа. Эксперименты, разработаны здесь была призвана обеспечить механистического понимания как фунгициды влияют на микрофлора пыльцы положений. В конечном счете эти выводы должны пролить свет на косвенные путь, через который Фунгициды могут быть причиной снижения колонии.

Introduction

Управляемые и видов диких пчел испытывают широкомасштабное уменьшение, с основными последствиями для обеих природных и сельскохозяйственных систем1. Несмотря на согласованные усилия, чтобы понять причины этой проблемы факторы, способствующие мед пчелы снижение все еще не хорошо понимали2,3,4. Для некоторых видов диких, родной пчел ситуация стала остро5,6. Если пчела населения не может быть устойчивой, когда они пересекаются с промышленного сельского хозяйства, их население будет продолжать падать, и культур, требующих опылителей (35% от мирового производства7) будет терпеть снижается урожай.

В то время как многие потенциальные факторы такие как пестицид выдержка, болезни и Хабитат потери1,4,8,9,10 были вовлечены в мед пчелы снижение, относительно мало известно о интерактивная влияние этих факторов стресса на родной пчел здоровья, в пределах или вблизи сельскохозяйственных систем. Многие текущие исследовательские усилия по-прежнему сосредоточиться на инсектицидов, (например, neonicotinoids11,12), хотя последние исследования показывают, что Фунгициды могут также играть роль в пчела спад на умаление формирования памяти, обонятельные прием13, гнездо признание14, активность ферментов и метаболические функции15,16,17. Глобально фунгициды продолжают применяться до цветения культур во время цветения. Недавние исследования документально, что пчелы обычно приносят фунгицида остатков обратно в улей18, действительно, исследования показали большое количество проверенных ульев содержится фунгицид остатков19,20. Дальнейшей работы показал, что фунгицид остатков ассоциируется с высоким уровнем мед пчелы личиночной смертности21,22,23 и присутствие «квеври пыльцы» в колониях, которые хотя нетоксичные, лишенный микробной активности и является питательной скомпрометированных24. Несмотря на тот факт, что фунгициды давно считается «пчела Сейф», теперь есть доказательства что воздействие только фунгицид может привести к тяжелой колонии потери в родной шмелей пчелы видов, Bombus Импатиенс25.

Для установления причинно-следственной связи между воздействием фунгицидом и колонии смертности, modus operandi этих химических веществ необходимо будет определить. Как подтверждается в почвах26, отложения27и28водной среды, ориентации грибов, фунгициды скорее изменить грибковых изобилия и разнообразия в рамках пыльцы положений, тем самым вызов основных сообщества сдвига может сильно пользу бактерий. Без грибковых конкурентов или антагонисты определенные патогенные бактерии могут размножаться относительно снят, содействие порчи пыльцы положений. Последние исследования продемонстрировал что микроорганизмов, особенно дрожжей и нитевидные грибов, служить питания симбионтами для пчел29,30,31, защиту от паразитов и патогенных32 ,33и обеспечивают долгосрочное сохранение пыльцы магазинов. Фунгициды, таким образом, может косвенно нанести вред незрелых пчел, нарушая микробной сообщества, которая необходима для предоставления таких услуг и/или путем повышения восприимчивости к условно-патогенных возбудителей и паразитов12. С ростом спроса на производство продовольствия, сельскохозяйственных культур во всем мире являются распыляется каждый год с фунгицидами во время цветения, подчеркнув необходимость понять масштабы таких фунгицидом индуцированные эффекты.

К Дата, основной пробелы, связанные с родной пчел микробной экологии могут быть представлены следующие вопросы: в какой степени фунгицид изменения микробной сообщества в рамках пчелиная пыльца положения? Вниз по течению воздействия потребления пыльцы с глубоко измененных микроорганизмов сообществом? В соответствии с этим экологически уместны вопросы, эксперименты были разработаны с основными целями выявления 1) что фунгицид остатков только может вызвать серьезные колонии снижение в родной пчел видов; 2) к которому микробных сообществ в пыльцы положения изменяются, фунгицидов и 3 степень) как пчелы здоровья зависит от сильно изменены микробиологические сообщества. Для решения вышеперечисленных вопросов, используя комбинацию на основе лабораторных и полевых экспериментов были определены экспериментальных целей. С помощью метагеномных искусства и молекулярных методов наряду с традиционными методами поля наблюдения, это исследование стремится собрать воедино потенциальные последствия фунгициды на здоровье пчел.

Первая цель этого исследования должна продемонстрировать, что фунгицид воздействие только может вызвать значительные колонии потери среди видов родной пчел. Исследование с участием большое поле клетки была использована для исследовать влияние фунгицида воздействия на рост колонии Bombus Недотрога, повсеместно, обильные родной пчел в США (рис. 1, рис. 2, рис. 3). Было предположить, что фунгицидом лечение крапивницы представит Нижняя фитнес и атипичные демографии, по сравнению с не подвергаются ульев. Данные, полученные из этого эксперимента поддержали эту гипотезу, демонстрируя, что остатки фунгицида в пыльцы может быть единственной причиной глубоких колонии потери в родной шмелей пчелы видов25. Вторая цель исследования — расследовать ответ микрофлора пыльцы на фунгицид воздействия. Можно предположить, что состав сообщества микробов в пыльцы положения подвергаются фунгициды будет отличается от необработанных пыльцы. Хотя грибковые изобилия и разнообразия, как ожидается, значительно сократится, бактерии или одной доминирующей плесневые будет скорее всего растут снят в отсутствие других конкурирующих грибов. Через серию испытаний в vivo эти сдвиги в состав микробных сообществ будут проанализированы с использованием метагеномики.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. изучить влияние фунгицида воздействия на шмелей пчелы колонии успех с помощью поля Кейдж экспериментов

  1. набор до десяти сетка клетки в поле посадили с овсом. Выкопать траншею вокруг каждой клетки и копать всех четырех краев сетки клетке в землю, чтобы обеспечить, что пчелы не может избежать. Складе клетки с горшках, цветковых растений, которые известны как привлекательны для пчел (например гречихи, огуречника, Бурачок, космос и подсолнухи) ( Рисунок 2).
  2. Дополнение клетки с одного лотка (36 x 42 см) из клевер Блум. Цветочные ресурсов в одном углу клетки, занимая пространство около 2,5 м x 1 м. прозябать оставшаяся площадь Кейдж, овес кластера.
  3. Случайным образом назначить Шмель колоний, каждый содержащий работников и одного королева, лечение (подарок/отсутствует фунгицида, N = 5 колоний за лечение, всего 10 колоний), затем поместить их в клетку поля (N = 1/Кейдж) на 29 дней (23 июня -21 июля 2014).
  4. Ориент колонии коробки что колонии ' s отверстия указывают на Юг предоставить оптимальные условия судоходства пчел. Субсидировать колоний с сахаром воду пузыри, внутри коробки куст в дополнение доступность нектара.
  5. Применить на основе хлороталонила фунгицидом на поле соответствующих уровне (20 г/Л) для цветущих растений в клетках лечение пяти фунгицид, используя руку провел пестицидов опрыскиватель, дважды во время исследования (день 0 и 13). Равномерно пальто цветы, таким образом, что без дальнейших жидкость придерживается цветочные поверхности ( рис. 3).
  6. По завершении исследования на местах по клетке вручную удалите B. Импатиенс колоний из клетки, прохладный ульев, поместив в морозильной камере -20 ° С 20 мин
  7. Удаление пчел с помощью стерильный пинцет и записывать количество личинок, куколок и взрослых самок (я. e. кормоуборочные комбайны) и взрослых мужчин. С помощью аналитического баланса запись сухой вес матери королевы, личинки, куколки, взрослых самок (то есть, кормоуборочные комбайны) и взрослых самцов.

2. Изучить влияние фунгицида воздействия на микробных сообществ в положениях пыльцы Bumble Bee гнезда с помощью лаборатории на основе исследований In Vivo

  1. смять коммерчески приобрели пыльцы в мелкий порошок, с помощью стандартного Лабораторная Мельница шаровая. Стерилизуйте сухой пыльцы путем замачивания в 70% этиловом спирте, позволяя ему на ночь испарится под УФ светом. Проверьте стерильность пыльцы, покрытие ~0.5 мг на общего назначения агар СМИ.
    1. Для сухой, стерилизованные пыльцы, с использованием стерилизованные пипетки, добавьте соответствующие поля дозировка фунгицидов: пропиконазол на 14,3%; азоксистробин на 22,9% для лечения (0.74 мкл и 0,65 мкл соответственно / день / куст). Смеси хорошо с использованием стерилизованные деревянные палочки.
  2. Место 6 экспериментальных ульи (n = 3 для контроля и лечения) в чистую, гигиенические лаборатории benchtop поддерживается при комнатной температуре. Каждый день весят 4.27 г пыльцы 34 , 35 смешанного с фунгицидами (для лечения) или стерильная вода (для контроля) внутри Худ, с использованием стандартной асептической техники.
    1. С помощью ловушки двери, представленные стороной картонную коробку, включающего ульев, ввести пыльцы внутри ульев. Дополнить кусты раствором сахара в стерилизованные каждую неделю. Продолжать кормление режим в течение четырех недель.
  3. В конце лабораторного исследования, прохладный ульев, поместив в морозильной камере-20 ° С 20 мин соскоба из пыльцы положения, содержащиеся в пределах выводок камеры с использованием стерилизованные щипцы и шпатели и место хранения стерильных трубок. Магазин-80 ° C. фото и запись вес рабочих и королева-мать в начале и в конце эксперимента (шаг 1.7).
  4. Изолировать ДНК из пыльцы предоставление образца, использование коммерчески доступных изоляции ДНК комплекты (см. таблицу материалов для деталей).
    1. Добавить 0,25 г пыльцы предоставление для извлечения трубки, кратко вихревой смешивать.
    2. Сделать 200 мг/мл лизоцима решение в дейонизированной дистиллированной воде, достаточно для 50 мкл/образца. Встряхнуть полностью форме решение.
    3. 50 мкл раствора лизоцима для извлечения труб с образцом в нем и смешайте хорошо переворачивать несколько раз. Инкубируйте трубки для 10 минут при 37 ° C на водяной бане. Если сформировалась преципитат, тепло раствора до 60 ° C до растворения перед использованием.
    4. Добавить 70 мкл водный лизис решения для извлечения трубки, безопасный горизонтально на вихрь pad планшетный с лентой, и вихрь на 10 мин центрифуги трубки на 10000 x g 30 s при комнатной температуре.
    5. Передачи супернатант чистого 2-мл пробирку коллекции. 250 мкл раствора осадков белок, и вихрь для 5 s. инкубировать на 4 ° C за 5 мин в ледяной бане.
      Примечание: Ожидаете между 400 мкл до 500 мкл супернатант. Супернатант еще может содержать некоторые частицы.
    6. Центрифуга труб при комнатной температуре в течение 1 мин на 10000 x g и передачи до 600 мкл супернатант чистого 2-мл пробирку коллекции. 200 мкл водный ингибитор удаления раствора, вихревой кратко, и инкубировать на 4 ° C за 5 мин центрифуги, трубы при комнатной температуре за 1 мин на 10000 x g. передачи до 750 мкл супернатант в чистой 2-мл пробирку коллекции и.
    7. Добавить 1200 мкл водный привязки решения супернатанта и вихрь 5 s. нагрузки примерно 675 мкл супернатант на спин фильтр и центрифуги на 10000 x g 1 мин при комнатной температуре. Отбросить через поток.
    8. Повторить 2.4.7. дважды.
      Примечание: В общей сложности три нагрузок для каждого образца, обработки требуются.
    9. Добавить 500 мкл этанола и центрифуги при комнатной температуре за 30 s на 10000 x g. отменить через поток и снова центрифуги при комнатной температуре за 1 мин на 10000 x g. место спин фильтр в чистой 2-мл пробирку коллекции.
    10. Добавить 100 мкл Элюирующий буфер к центру мембраны фильтра. Центрифуга при комнатной температуре за 30 s в 10000 x g. отменить фильтр спина. Хранилище собранных ДНК от-20 ° C-80 ° C
  5. использования изолированной ДНК для секвенирования.
    1. Quantify и нормализовать изолированной ДНК до 2 нг/мкл флуориметрический анализа.
      1. Подготовить реакции в трех экземплярах для каждого извлеченного образца для сравнения относительной суммы 28S (завод), анализировать ее (грибковые) и 16S (бактериальный) компонентов каждого пыльцы предоставление образца 36. Убедитесь, что каждый реакции содержит 10 нг всего ДНК, 2 x асимметричный цианиновые краска на основе мастер смеси и 2,5 мкл прямого и обратного грунтовки пар 28KJ/28В 37 для растений и ITS1/ITS5.8R для грибковых ДНК 38 .
    2. Усиливают ДНК, используя следующие параметры: 2 мин до Денатурация при 50 ° C, 2 мин первоначальный Денатурация при 95 ° C, 40 циклов (15 s на 98 ° C, 15 s на 58 ° C, 60 s при 72 ° C), а затем кривой расплава.
    3. Подготовить 2-шаг, вложенные протокол постановки ПЦР с использованием библиотеки виртуализации нового поколения, предназначенные 16S рРНК V3/V4 переменной региона и СТС / 5.8s рРНК распорку региона.
      1. Добавить 12,5 мкл ДНК до 5 пмоль каждого праймера и 2 x Мастер микс. Сделайте отдельный реакции для каждого региона (16S или ее; см. таблицу 1). Изменить регион конкретных грунтовки как 40 ранее описанных 39 , для добавления секвенсор конкретный адаптер навеса нуклеотидные последовательности ген специфического последовательностей.
      2. Выполнять первоначальные амплификации, используя следующие параметры: 3 мин первоначальный Денатурация при 95 ° C, 25 циклов (30 s при 95 ° C, 30 s при 55 ° C, 30 s при 72 ° C), окончательное расширение 5 мин в 72 ° C.
      3. Следующие первоначальные амплификации, проверить размер библиотеки и количество по электрофоретической подвижности и очистить с помощью 1 x объем твердой фазы реверсивные immБусы obilization для удаления остатков грунтовки и реагенты реакции. Бассейн 16S и его ампликонов количественно для создания единого ампликон пула для каждой выборки.
      4. Добавить конкретные адаптеры секвенсор и образцы конкретных двойной индексы, используя следующие грунтовки (см. таблицу 1). Мкл 2,5 амплифицированного ДНК до 5 пмоль каждого праймера и 2 x Мастер микс. Выполнение библиотеки амплификации, используя следующие параметры: 3 мин первоначальный Денатурация при 95 ° C, 8 циклов (30 s при 95 ° C, 30 s при 55 ° C, 30 s при 72 ° C), окончательное расширение 5 мин в 72 ° C.
    4. Следующие PCR, чистой готовых библиотек с помощью 1 x объем бусины реверсивные иммобилизации твердой фазы. Оценить качество и количество готовых библиотек, с использованием электрофоретическая подвижность и флюометрия, соответственно. Стандартизировать библиотеки 2 мкм и бассейн до последовательности.
    5. Выполнения виртуализации нового поколения на платформе аналогично адаптеры, добавил в вторичной PCR, с соответствующей длины для покрытия всего ампликон 41.
  6. Последовательность аннотацию и микробный состав анализа.
    1. Комбинат пара конец последовательности данных (R1 и R2) в единый Сахалинской для всех виртуализированных библиотек. После объединения файлов R1 и R2, производится один fasta файл для каждой из библиотек.
      Примечание: Этот шаг и процессов, описанных ниже (если не указано иное) выполняются в Mothur версии 1.38.0 38.
    2. Экран каждый файл fasta для удаления неоднозначной базы, неожиданные длинные последовательности и длинные гомополимеры.
      Примечание: Параметры для проверки и удаления последовательности являются maxambig = 0, maxlength = 600 и maxhomop = 8 для обоих генов. Удаление одинаковых последовательностей, но сохранить таблицу сопряженностью отдельно для всех библиотек (ака игр таблицы в Mothur).
    3. Выравнивание уникальных последовательностей гена 16S библиотеки против версии базы данных Силва 123, и ген ее библиотеки против объединить ее базы данных 42.
      Примечание: Последовательности должны отмечаться от Королевства уровня до уровня рода.
      1. Впоследствии, кластер выравнивание последовательностей с функции pre.cluster с помощью diff = 5 и удалить химер.
    4. Классифицировать последовательностей с использованием метода Ван 43 на основе Силва (для гена 16S) и объединить ее (для гена СТС) таксономии файлов (пороговое значение 80%).
    5. Загрузка в R 44 сопряженностью таблицы (по одному на ген) создается во время процесса классификации в Mothur. На каждом таксономическом уровне, получить относительное изобилие каждой библиотеки для дальнейшего анализа изменений микробных.
      Примечание: На каждом таксономическом уровне, объединение таксономических групп когда относительное изобилие составляет менее 2% для всех экспериментальных повторений.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Поле Кейджу учиться:

Данные, полученные из клетки эксперименты показали, что значительные ответ на фунгицид воздействия пчел шмелей. Фунгицид лечение крапивницы производится значительно меньше рабочих (12,2 ± 3.8, среднее ± SE) чем ульев управления (43,2 ± 11.2, F1,9= 6.8, p = 0,03) (Рисунок 4). Кроме того пчела биомассы фунгицидом лечение крапивницы (0,91 g ± 0,15) был значительно ниже, чем управления ульи (2,36 g ± 0,55; F 1,9 = 8,3, p = 0.02). Этот шаблон снижение биомассы в фунгицидом лечение крапивницы также наблюдалось среди матери королевы. Квинс фунгицидом лечение крапивницы, представлены значительно меньше биомассы (0,14 г ± 0,04) чем королевы управления ульи (0,27 g ± 0,01; Z = 2,5, p = 0.01). Однако фунгицид экспозиции не влияет на количество личинок, куколок и мужчины через лечения. Биомассы этапов дискретных жизни (личинки, куколки, рабочие и взрослых мужчин) и отдельных весов для личинок, куколок и работников не показывают каких-либо различий через фунгицидом лечение и контроль ульев.

На базе лаборатории исследования:

Данные, полученные на основе лабораторных экспериментов указал, что перед воздействием фунгицида, управления и фунгицидом лечение крапивницы статистически сопоставимых средний работник игр (контроль ульев = 28,0 ± 3,1; фунгицидом лечение крапивницы = 31.67 ± 2.0; n = 3 каждый) и королева вес (контроль ульев = 0.77 g ± 0,04; фунгицидом лечение крапивницы = 0,74 g ± 0,01). Однако, в конце исследования, количество работников был значительно выше в управления ульи (67.67 ± 4.3), по сравнению с фунгицидом лечение крапивницы (45.33 ± 3.8) (т4 = 3.89, p = 0.01). Работник численность населения увеличилась на ~ 150% в ульях управления по сравнению с ~ 45% в фунгицидом лечение крапивницы. Аналогично Окончательный вес королевы-матери оставались относительно неизменными в элементе управления, крапивница (0.76 г ± 0,02) по сравнению с ~ 35% снижение фунгицидом лечение крапивницы (0,49 г ± 0,16). Взятые вместе, эти результаты согласуются с ранее опубликованные результаты25 и указать фунгицид экспозиции пострадавших фитнес колонии, что подтверждается меньше числа работников и снижение веса королевы-матери (рис. 5).

Метагеномных анализ пыльцы положений указывается явные различия между микробных сообществ, собранных от фунгицидом лечить и контролировать ульи (рис. 6). Наблюдалось сокращение (> 95%) в относительное обилие часто изолированы Streptomycetales, Enterobacteriales в ульях фунгицидом лечение. Интересно, что обе эти группы известны их Противогрибковая активность и роль в пыльцы сохранение30,45 в пределах Шмель куст средах. Бактериальные членов ордена риккетсии, который включает в себя общие патогенов членистоногих46, показали гораздо больше изобилия в ульях фунгицида лечение. Фунгицид лечение крапивницы имел Нижняя обилие грибов, принадлежащих к приказу Eurotiales и грибы по алфавиту и большее количество заказов, Capnodiales и Ascosphaerales, по сравнению с управления ульи (рис. 7). Как и ожидалось, для бактерий и грибков, Шеннона индекс разнообразия (H) и равномерность (E) был ниже в фунгицидом лечение крапивницы, по сравнению с элементами управления, хотя эти различия не были статистически значимыми (бактерий: H Управление ульев =1,25 ± 0,3, Hфунгицидом лечение крапивницы = 0,82 ± 0,2, Eуправления ульев = 0,46 ± 0,1; Eлечение противогрибковыми ульев = 0,31 ± 0,1; Грибы: Hуправления ульев =0,99 ± 0,3, Hфунгицидом лечение крапивницы = 0.72 ± 0,4, Eуправления ульев = 0,57 ± 0,2; Eлечение противогрибковыми ульев = 0,42 ± 0,2). Хотя подробно метаболических и функциональные последствия такого сообщества сдвиги выходит за рамки настоящего исследования, в сочетании с колонии count и масса данных, эти результаты показывают, что фунгицид экспозиции может повлиять на снижение в колонии здоровья нарушая симбиоз между пчел и пыльцы микрофлора. Дальнейшее расследование роли отдельных микробных групп, затрагивающих личиночной выживания рекомендуется лучше оценить роль пыльцы микрофлора в поддержании здорового пчела населения.

Figure 1
Рисунок 1: внутри гнездо Шмель Недотрога . Изображения с высоким разрешением рабочих, стремящейся выводок клеток. Расплода ячейки могут содержать несколько яиц и личинок в любой момент времени. Развитие личинки питаются пыльцы положений периодически представил в камеру. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: большое поле клетки построен для размещения пчелосемей. Каждая клетка сетки (N = 10) была укомплектована одним коммерчески приобрели Bombus Импатиенс куст, а также в Блум растений видов известных для привлечения пчел. Цветы были снабжены в одном углу клетки, и оставшаяся область была растительностью с трава овса. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: фунгицид остаток на недавно распыляется подсолнечника. Поле соответствующие дозы фунгицид были распыляется на день 0 и 13 эксперимента. Использование пестицидов опрыскиватель, цветы были равномерно покрыты раствором фунгицида в сумерках/вечер, чтобы избежать прямого контакта с пчел-фуражиров. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: влияние фунгицида остаток на шмели в клетке эксперимент. Шмелей пчелиных семей, которые были подвержены фунгицид остатков на значительное снижение пыльцы выставлены в колонии размер (reductионы в изобилии взрослых женщин) в течение одного месяца. Планки погрешностей представляют ± 1SE; p < 0,05. Эта цифра была изменена из Бернауэр и др. 25. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: влияние фунгицида остаток на шмели в лабораторного эксперимента. Шмелей пчелиных семей, которые были подвержены лечить противогрибковыми пыльцы выставлены значительное снижение в колонии размер (сокращение численности взрослого работника) и снижение веса королевы-матери в течение одного месяца. Планки погрешностей представляют ± 1SE; p = 0,03. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: круговая диаграмма метагеномных классификации грибковых и бактериальных разнообразия на порядок ранг. Анализ основан на () 16S и (b) на основе его классификации образцов пыльцы предоставление собранных от контроля и фунгицидом лечение крапивницы. Управления ульев продемонстрировал выше разнообразия и ровность в микробной распределения. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 7
Рисунок 7: процентное изменение в порядок ранжирования относительное обилие бактерий и грибков в ответ на фунгицид экспозиции. На основе классификации метагеномных микробных сообществ с помощью () 16S и (b) ее праймеры пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Грунтовка пара Тип грунта Грунтовка последовательность
28KJ/28Б Завод GGC GGT AAA TTC CGT CC /
ВКТ CCG TGT TTC AAG ACG
ITS1 / ITS5.8 Грибковые TCC GTA GGT ГАА CCT ГКГ G /
КЛЯП УВД CGT TGT TGA AAG TT
16S вперед / обратный Вложенные бактериальные 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3'/
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3'
ITS1F грунт / ITS4 Вложенные грибковых 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCGTAGGTGAACCTGCGG - 3'
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC - 3'
Праймеры адаптер 5'-AATGATACGGCGACCACCGAGATCTACAC [55555555]
ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
5'-CAAGCAGAAGACGGCATACGAGAT [77777777]
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3 '

Таблица 1: список пар грунт и грунтовка последовательностей, используемых в амплификации ДНК. Увидеть текст для ссылки.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Расследование эффекты фунгициды на здоровье пчел остаются малоисследованный аспект стратегий управления вредителей. Наше исследование стремится преодолеть этот пробел в знаниях, используя набор дополнительных методов, которые явным образом изолировать потенциальных факторов снижения пчелы. Планирование, обоснование и визуализации этих экспериментов описаны ниже.

Важно допустить не пчел избежать сетки клетке экспериментов, поскольку это подорвет демографии анализа. Важно также, что искусственные гнезда имеют достаточную изоляцию для защиты от дождя и прямых солнечных лучей. Так что фунгицидов не распыляется непосредственно на гнездах следует соблюдать осторожность. Колонии должны быть обеспечены сахарной воды резервуары для дополнения собрали нектар и предотвратить обезвоживание.

Лаборатория создана на основе откорма судебных разбирательств, строгих асептических условий следует сохранить для предотвращения загрязнения, при приготовлении пищи пыльцы. Коммерчески приобретенных пыльцы должны пудры и УФ стерилизации перед использованием. Куст гигиены должны поддерживаться для предотвращения заражения от посторонних паразитов, таких как кладовая-бабочек и плотва. Жидкости баллоны должны дополняться стерилизованные сахаром решения для предотвращения обезвоживания организма. Для предварительной обработки переписи, следует позаботиться не стресс пчел, чрезмерной обработки и держать их вне hived для длительного периода.

Как ДНК доходность зависит от возраста и типа исходного материала, только хорошо замороженные или свежие образцы должны использоваться в экстракции ДНК и амплификации. Масса образца для экстракции ДНК не должна превышать 0,25 ГМ, как это снизит доходность ДНК. ДНК урожайности должны быть количественно с помощью электрофореза геля. Авансом электрофоретической количественная оценка изолированной ДНК важно прежде чем реакций ПЦР для обеспечения эффективного усиления47.

Для метагеномных анализа можно получить более полный анализ микробных динамических, ограничивая количество аннотированных последовательностях (, расслабляя фракция терпимый различия между последовательностями) и сокращение числа таксономических групп, как а также слияние тех, для которых относительное изобилие значительно низкой (< 2%).

Размер консервативной выборки (N = 5 для обоих фунгицида лечить и лечить клетка исследование ульев) можно надуть расхождений в данных, которая будет свернут в будущих исследованиях с использованием более репликации. Чтобы добавить большее разрешение и статистической мощности результаты, Пчелиные семьи будет слившихся и весил до и после воздействия фунгицидом. Запуск эксперимента клетки для более длительных периодов позволит производство новой королевы, которые могут служить в качестве дополнительного опадения. С этими изменениями к нынешнему Протоколу будущие исследования предоставит более подробную информацию о динамике населения улья.

Гидрофобная природа пыльцы, удерживает ее эффективного смешивания с водой. Измельчения и просеивания пыльцы гранулы в мелкий порошок, помогает в процессе перемешивания. Количество пыльцы порошка может быть скорректирована для достижения желаемой консистенции. Осторожность следует тщательно перемешать жидкость (воду или фунгицидом) для достижения равномерное распределение активных ингредиентов и даже доставка кормоуборочные комбайны.

Как избыток ДНК может ингибировать реакции PCR, рекомендуется, что образец не должен весить больше чем 0,25 г. чрезмерное vortexing следует избегать, поскольку это ножницы ДНК, снижение урожайности. ДНК низкой урожайности также может быть результатом длительного воздействия литического буфера. Бактериальные грунтовки должны быть выбраны предпочтительно из региона V7-V9 16S рРНК для сведения к минимуму неспецифической амплификации ДНК хлоропласта48. Кроме того последовательность генов, например генов рибосомной РНК 18S может обеспечить лучшее понимание микробного разнообразия в пыльце, а также изменения в составе населения после использования фунгицидов.

Учитывая количество библиотек для обработки с Mothur, вычисляя время может быть значительно высоким. Удаление Синглтоны при сравнении последовательностей друг против друга (если вычислительные ресурсы ограничены, удалите их перед Химера фильтрации) может значительно уменьшить необходимое время для вычисления оперативной таксономических единиц.

Кейдж эксперименты ограничить диапазон естественного полета пчел (в отличие от позволяя им корм широко через ландшафт), и неясно, степень которой такие ограничения могут повлиять ответа переменных. Хотя контроль и лечение клетки испытать тот же диапазон биотических и абиотических переменных, это технически невозможно контролировать микроокружения в каждой клетке.

Истинное значение микробных взаимодействий в рамках сообщества слишком сложных и запутанных реплицировать через экспериментальные испытания. Хотя наши данные скорее всего документа подмножеством общего микробного разнообразия в рамках пыльцы положений, это первый проницательность в интерактивные эффекты, которые могут превалировать между бактерий и грибков в присутствие/отсутствие фунгицидами.

Использование альтернативных баз данных для выравнивания последовательностей49 или прогнозирования функциональных метаболических государствами, основанных на пыльцу бактериальных разнообразия50 может предоставить шире микрофлора пыльцы. В конце концов лучше охарактеризовать метаболических и функциональной динамики микробных сообществ после применения фунгицидов, необходимо всего генома пыльцы микрофлора.

Кейдж эксперименты с использованием коммерчески приобретенных ульев предоставляют один из лучших структур для измерения реакции переменные в полу контролируемых условиях. Причинение минимального изменения для пчел естественной экологии (эффективность нагула, социальной структуры, потомство ухода), Кейдж эксперименты минимуму приспособление и стресс, представленный в искусственной среде и ручной обработки во время лабораторного эксперименты.

В меру наших знаний еще не было проведено не исследование для оценки воздействия фунгициды на динамике микробных в пыльцы предоставление Шмели. Подверженности Фунгициды могут исключить один или несколько чувствительных видов, нарушая экологической перемирие между грибков и бактерий. С помощью поля и на базе лаборатории испытания как тигле играть эти взаимодействия, это исследование призвана продемонстрировать, что истребление резидентов видов микроорганизмов могут извратить экологического баланса пыльцы микрофлора, которая в свою очередь может компромисс пчелы здоровья.

Культура зависимые методы, такие как разрежения и покрытий на стандартные носители записилишь небольшая часть микрофлоры из данной среды. Это может привести к валовой недопредставленности микробного разнообразия и unculturable микробы могут идти незамеченными51. Чтобы изучить спектр микроорганизмов, ученые должны полагаться на культуры независимые методы, которые более широкой и всеобъемлющей, например метагеномных анализа и секвенирование нового поколения. Рисование сильно от этих мощных молекулярных методов, это исследование стремится получить большее разрешение в пыльцы микрофлора, чем в традиционной культуре-методы на основе самостоятельно.

Результаты этого исследования выявили глубокое потерь в число работников в пределах пчел шмелей подвергается фунгицидом. Для шмелей пчелы колонии быть успешным работники должны предоставлять достаточные ресурсы и ухода для матери королевы и особенно для развивающихся личинок. В конечном счете цель колонии заключается в максимизации ресурсов захвата (пыльцы и нектара) таким образом, что столько дочь Королев максимально могут быть произведены в конце лета. Здоровую дочь Королев являются показателем пригодности для колонии. Затем, крупные сокращения работников, эффективно подрывает способность колонии производить Королев на следующий год. В этом исследовании не только значительно уменьшились работник чисел, но матери королевы с фунгицидом лечить сыпь с нижней биомассы, предположительно в результате недостаточного питания, кормоуборочные комбайны. Учитывая сложность микробных взаимодействий внутри пыльцы положения, трудно различить точное интерактивные эффекты между грибков и бактерий, способствуя эти шаблоны. Однако, результаты, полученные от репликации и неоднократные эксперименты как описано здесь, будет предоставлять жизненно понимание перенося симбиоз между этими двумя группами микробов (будь то конкурентоспособной, бесшёрстных или синантропных) в ответ на стресс ксенобиотиков, и его вниз по течению последствия микрофлора пыльцы.

С помощью мощных инструментов молекулярная экологическая сложности микрофлора пыльцы может быть лучше решена. Предварительные понимания раскрывает множество естественных бактерий и грибков, способствуя коллективно поддерживать колонии фитнес. В частности дрожжи, которые были изолированы от пыльцы положения известны нести бактерицидные и ферментативные свойства, оба из которых имеют решающее значение для развития личинок пчел. Такие экологические ассоциации свидетельствует о высокой степени симбиозе между пчел и их пыльца микрофлора. Пыльца положения, таким образом, представляют собой эмерджентных разнообразия эффект, в результате культивирования микробная сообщества состоит из ключевых функциональных ролей. В отсутствие этих ключевых симбионтами пыльца положение, как представляется, быть нарушена в неизвестной степени. Продолжение работы в этом направлении, будут, вероятно, объяснить функциональное разнообразие этих микробов и разоблачать их роль как пчела симбионтами.

Недавние исследования развенчан понятие фунгицидами как безопасен для пчел19,24,52,,5354. Цель этого исследования заключается в изолировать механизмы вождения фунгицида воздействие на пчел, тем самым освещение причинно следственные отношения между фунгицид использования и пчела спад. Центр гипотез вокруг концепции, что Би Микроб симбиозов являются изменяемыми значительно от остатков фунгицида в пыльце. В конечном счете эта работа будет повторно кадр как фунгициды Просмотрели и используется в сельском хозяйстве и городских условиях. В свете нынешнего кризиса глобальном опылителей предлагаемое исследование генерирует новые знания по экологии родной пчел, как она относится к практике сельскохозяйственного производства. Фунгициды остаются последней группы агрохимического эффективно быть освобожденными от нормы, ограничивающие приложениям культур во время цветения. В результате как управляемые, так и дикие пчелы последовательно подвергаются фунгицидами. Растущий объем литературы предполагает, что, хотя фунгицидов не смертельны для пчел на контакт, при повышенных дозах, воздействия довольно вредно, приводит к более высокой смертности личиночной21 и изменено поведение добытчик. Ожидается, что эта работа будет освещать механизма(ов), по которому фунгициды наносят вред опылителей. Кроме того это исследование будет основой политики управления мудрее Пешт и информировать фермеров наилучшей практики управления. Эта работа будет также важную роль в обеспечении руководящих принципов для улучшения пестицидов распыления, которые могут влиять на пестицидов законов и правил. Более широком смысле, эти выводы будут иметь отношение к любой управляемой экосистемы, в которой цветковых растений посещают сбора пыльцы насекомых. С глобальные оценки Би-конкретных, чрезвычайно высокой55,56, если эта работа может смягчить спад населения пчелы опыления, потенциального воздействия будет существенным.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Автора(ов) поблагодарить фонд университета Висконсин биотехнологии центр ДНК последовательности для обеспечения усиления и последовательности объектов и услуг, Кейтлин Карлсон, Дженнифер сноровки, Джейк Отто и Max Haase для оказания технической помощи с Молекулярный анализ. Эта работа была поддержана USDA-сельскохозяйственная исследовательская служба ассигнованных средств (текущие исследования информационной системы #3655-21220-001). Дальнейшая поддержка была оказана национальным фондом науки (под № Грант DEB-1442148), Доу Великих озер биоэнергетики исследовательский центр (DOE управление науки де Бер-РС02 07ER64494) и USDA национального института продовольствия и сельского хозяйства (Люк проекта 1003258). C.T.H. — Пью ученый в области биомедицинских наук и сотрудник факультета Альфред Toepfer, поддерживает благотворительные фонды Пью и Фонда Александра фон Гумбольдта, соответственно.

Materials

Name Company Catalog Number Comments
Natupol Beehive Koppert USRESM1 16 hives
Propiconazole 14.3 Quali-Ppro 60207-90-1 Propiconazole 14.3%
Abound Syngenta 4033540 Azoxystrobin 22.9%
Chlorothalonil Syngenta 3452 Fungicide used for trials
Pollen granules Bee rescued B004D5650C 3X 16oz bottles, pollen for trials
Bacterial strains for inoculation Currie Lab
Yeast strains for inoculation Hittinger lab
Primer pairs UW Biotech Center
DNA Isolation Kit Mo Bio 12830-50 Commercial DNA isolation kit
Qubit dsDNA HS Assay Kit Thermo Fisher Q32851 DNA quantification tool
Select Master Mix for CFX Thermo Fisher 4472952 Used to perform real-time PCR using SYBR GreenER dye.
Real-Time PCR Detection System Bio Rad 1855196 Instrument used for PCR amplification
PCR Clean-Up Kit, Axygen 10159-696 Used for efficient removal of unincorporated dNTPs, salts and enzymes
DNA 1000 Kit Agilent 5067-1504 Used for sizing and analysis of DNA fragments
MiSeq Sequencer Illumina Used for next-generation sequencing
Assorted glassware (beaker, flasks, pipettes, test tubes, repietters) VWR

DOWNLOAD MATERIALS LIST

References

  1. Potts, S. G., Biesmeijer, J. C., Kremen, C., Neumann, P., Schweiger, O., Kunin, W. E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evolut. 25, (6), 345-353 (2010).
  2. Vanengelsdorp, D., Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J Invertebr Pathol. 103, Suppl 1. S80-S95 (2010).
  3. Ellis, J. D., Evans, J. D., Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, (1), 134-136 (2010).
  4. Vanbergen, A. J. Insect Pollinators Initiative. Threats to an ecosystem service: pressures on pollinators. Front Ecol Environ. 11, (5), 251-259 (2013).
  5. Cameron, S. A., et al. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. U.S.A. 108, (2), 662-667 (2011).
  6. Szabo, N. D., Colla, S. R., Wagner, D. L., Gall, L. F., Kerr, J. T. Do pathogen spillover, pesticide use, or habitat loss explain recent North American bumblebee declines? Conser Lett. 5, (3), 232-239 (2012).
  7. Klein, A. -M., et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol]. 274, (1608), 303-313 (2007).
  8. Sánchez-Bayo, F., Goulson, D., Pennacchio, F., Nazzi, F., Goka, K., Desneux, N. Are bee diseases linked to pesticides? - A brief review. Environ Int. 89, 7-11 (2016).
  9. Kwong, W. K., Moran, N. A. Gut microbial communities of social bees. Nature Rev. Microbiol. 14, (6), 374-384 (2016).
  10. Engel, P., et al. The Bee Microbiome: Impact on Bee Health and Model for Evolution and Ecology of Host-Microbe Interactions. mBio. 7, (2), e02164-e02115 (2016).
  11. Henry, M., et al. A common pesticide decreases foraging success and survival in honey bees. Science. 336, (6079), New York, N.Y. 348-350 (2012).
  12. Pettis, J. S., vanEngelsdorp, D., Johnson, J., Dively, G. Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Die Naturwissenschaften. 99, (2), 153-158 (2012).
  13. Williamson, S. M., Wright, G. A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, (10), 1799-1807 (2013).
  14. Artz, D. R., Pitts-Singer, T. L. Effects of fungicide and adjuvant sprays on nesting behavior in two managed solitary bees, Osmia lignaria and Megachile rotundata. PLoS ONE. 10, (8), (2015).
  15. Johnson, R. M., Wen, Z., Schuler, M. A., Berenbaum, M. R. Mediation of Pyrethroid Insecticide Toxicity to Honey Bees (Hymenoptera: Apidae) by Cytochrome P450 Monooxygenases. J. Econ. Entomol. 99, (994), 1046-1050 (2006).
  16. Pilling, E. D., Bromleychallenor, K. A. C., Walker, C. H., Jepson, P. C. Mechanism of synergism between the pyrethroid insecticide lambda-cyhalothrin and the imidazole fungicide prochloraz, in the honeybee (Apis mellifera L). Pest Biochem Physiol. 51, (1), 1-11 (1995).
  17. Iwasa, T., Motoyama, N., Ambrose, J. T., Roe, R. M. Mechanism for the Differential Toxicity of Neonicotinoid Insecticides in the Honey Bee Mechanism for the differential toxicity of neonicotinoid insecticides in the honey bee, Apis mellifera. Crop Protection. (2016).
  18. Mullin, C. A., et al. High levels of miticides and agrochemicals in North American apiaries: implications for honey bee health. PLoS One. 5, (3), e9754 (2010).
  19. Pettis, J. S., Lichtenberg, E. M., Andree, M., Stitzinger, J., Rose, R., Vanengelsdorp, D. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS One. 8, (7), e70182 (2013).
  20. David, A., et al. Widespread contamination of wildflower and bee-collected pollen with complex mixtures of neonicotinoids and fungicides commonly applied to crops. Environ Int. 88, 169-178 (2016).
  21. Zhu, W., Schmehl, D. R., Mullin, C. A., Frazier, J. L. Four common pesticides, their mixtures and a formulation solvent in the hive environment have high oral toxicity to honey bee larvae. PLoS One. 9, (1), e77547 (2014).
  22. Simon-Delso, N., Martin, G. S., Bruneau, E., Minsart, L. A., Mouret, C., Hautier, L. Honeybee colony disorder in crop areas: The role of pesticides and viruses. PLoS ONE. 9, (7), (2014).
  23. Park, M. G., Blitzer, E. J., Gibbs, J., Losey, J. E., Danforth, B. N. Negative effects of pesticides on wild bee communities can be buffered by landscape context. Proc R Soc Lond [Biol]. 282, (1809), (2015).
  24. van Engelsdorp, D., et al. "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J Invertebr Pathol. 101, (2), 147-149 (2009).
  25. Bernauer, O. M., Gaines-Day, H. R., Steffan, S. A. Colonies of bumble bees (Bombus impatiens) produce fewer workers, less bee biomass, and have smaller mother queens following fungicide exposure. Insects. 6, (2), 478-488 (2015).
  26. Tu, C. M. Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Health B. 28, (B28), 67-80 (1993).
  27. Huang, C. -Y., Ho, C. -H., Lin, C. -J., Lo, C. -C. Exposure effect of fungicide kasugamycin on bacterial community in natural river sediment. J Environ Sci Health B. 45, (5), 485-491 (2010).
  28. Artigas, J., et al. Effects of the fungicide tebuconazole on microbial capacities for litter breakdown in streams. Aquat. Toxicol. 122, 197-205 (2012).
  29. Goerzen, D. W. Microflora associated with the alfalfa leafcutting bee, Megachile rotundata (Fab) (Hymenoptera: Megachilidae) in Saskatchewan, Canada. Apidologie. 22, (5), 553-561 (1991).
  30. Anderson, K. E., Sheehan, T. H., Eckholm, B. J., Mott, B. M., DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux. 58, (4), 431-444 (2011).
  31. Crotti, E., et al. Microbial symbionts of honeybees: a promising tool to improve honeybee health. N. Biotechnol. 30, (6), 716-722 (2013).
  32. Koch, H., Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. U.S.A. 108, (48), 19288-19292 (2011).
  33. Anderson, K. E., et al. Microbial ecology of the hive and pollination landscape: bacterial associates from floral nectar, the alimentary tract and stored food of honey bees (Apis mellifera). PloS One. 8, (12), e83125 (2013).
  34. Evans, E. C., Spivak, M. Effects of Honey Bee (Hymenoptera: Apidae) and Bumble Bee (Hymenoptera: Apidae) Presence on Cranberry (Ericales: Ericaceae) Pollination. J Econ Entomol. 99, (3), 614-620 (2006).
  35. Goulson, D., et al. Can alloethism in workers of the bumblebee, Bombus terrestris, be explained in terms of foraging efficiency? Anim. Behav. 64, (1), 123-130 (2002).
  36. ThermoFisher Scientific. User Guide: Qubit dsDNA HS Assay Kits. Available from: https://tools.thermofisher.com/content/sfs/manuals/Qubit_dsDNA_HS_Assay_UG.pdf 3-6 (2010).
  37. Khadempour, L., LeMay, V., Jack, D., Bohlmann, J., Breuil, C. The Relative Abundance of Mountain Pine Beetle Fungal Associates Through the Beetle Life Cycle in Pine Trees. Microbial Ecol. 64, (4), 909-917 (2012).
  38. Dorn-In, S., Hölzel, C. S., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J. PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products. Int J Food Microbiol. 162, (1), 71-81 (2013).
  39. Klindworth, A., et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, (1), (2013).
  40. White, T., Bruns, T., Lee, S., Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18, (1), 315-322 (1990).
  41. Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Available from: http://ngs.biodiv.tw/NGSCore/wp-content/uploads/Documents/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  42. Kõljalg, U., et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 22, (21), 5271-5277 (2013).
  43. Wang, Q., Garrity, G. M., Tiedje, J. M., Cole, J. R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 73, (16), 5261-5267 (2007).
  44. Team, R. C. R: A language and environment for statistical computing [Computer software]. R Foundation for Statistical Computing. Vienna, Austria. (2015).
  45. Kaltenpoth, M., Engl, T. Defensive microbial symbionts in Hymenoptera. Funct Ecol. 28, (2), 315-327 (2014).
  46. Gerth, M., Saeed, A., White, J. A., Bleidorn, C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 91, (6), (2015).
  47. Smith, C. J., Osborn, A. M. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 67, (1), 6-20 (2009).
  48. Kim, M., Morrison, M., Yu, Z. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods. 84, (1), 81-87 (2011).
  49. DeSantis, T. Z., et al. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, (7), 5069-5072 (2006).
  50. Langille, M. G. I., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature Biotechnol. 31, (9), 814-821 (2013).
  51. Malik, S., Beer, M., Megharaj, M., Naidu, R. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environ Int. 34, (2), 265-276 (2008).
  52. Ladurner, E., Bosch, J., Kemp, W. P., Maini, S. Assessing delayed and acute toxicity of five formulated fungicides to Osmia lignaria and Apis mellifera. Apidologie. 36, (3), 449-460 (2005).
  53. Huntzinger, C. I., James, R. R., Bosch, J., Kemp, W. P. Fungicide Tests on Adult Alfalfa Leafcutting Bees (Hymenoptera: Megachilidae). J Econ Entomol. 101, (4), 1088-1094 (2008).
  54. Gradish, A. E., Scott-Dupree, C. D., Shipp, L., Harris, C. R., Ferguson, G. Effect of reduced risk pesticides for use in greenhouse vegetable production on Bombus impatiens (Hymenoptera: Apidae). Pest Manag. Sci. 66, (2), 142-146 (2010).
  55. Calderone, N. W. Insect pollinated crops, insect pollinators and US agriculture: trend analysis of aggregate data for the period 1992-2009. PloS One. 7, (5), e37235 (2012).
  56. Ollerton, J., Winfree, R., Tarrant, S. How many flowering plants are pollinated by animals? Oikos. 120, (3), 321-326 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics