माउस दिलों में overexpress को rAAV9 की तैयारी या पछाड़ना जीन

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

murine मॉडल में आनुवंशिक सामग्री के दौरे वितरण के माध्यम से अभिव्यक्ति या विशिष्ट जीन की गतिविधि को नियंत्रित जीन कार्यों की जांच के लिए परमिट। दिल में उनके चिकित्सीय क्षमता भी निर्धारित किया जा सकता है। वहाँ माउस दिल में इन विवो आणविक हस्तक्षेप के लिए सीमित दृष्टिकोण हैं। संयोजक एडिनो से जुड़े वायरस (rAAV) आधारित जीनोम इंजीनियरिंग में विवो हृदय जीन में गड़बड़ी के लिए एक अनिवार्य उपकरण के रूप में उपयोग किया गया है। इस प्रौद्योगिकी के विशिष्ट लाभ उच्च दक्षता, उच्च विशिष्टता, कम जीनोमिक एकीकरण दर, कम से कम शामिल प्रतिरक्षाजनकता, और कम से कम pathogenicity। यहाँ, के निर्माण के लिए पैकेज, और rAAV9 वैक्टर शुद्ध एक विस्तृत प्रक्रिया में वर्णित है। नवजात पिल्ले में rAAV9 के चमड़े के नीचे इंजेक्शन मजबूत अभिव्यक्ति या माउस दिल में ब्याज की जीन (एस) के कुशल पछाड़ना में परिणाम है, लेकिन जिगर और अन्य ऊतकों में नहीं। हृदय-specifi का प्रयोगग TnnT2 प्रमोटर, दिल में GFP जीन की उच्च अभिव्यक्ति प्राप्त हुई थी। इसके अतिरिक्त, लक्ष्य mRNA दिल में हिचकते किया गया था जब एक rAAV9-U6-shRNA उपयोग किया गया था। वर्किंग rAAV9 प्रौद्योगिकी के ज्ञान के हृदय की जांच के लिए उपयोगी हो सकता है।

Introduction

को नियंत्रित अभिव्यक्ति या विभिन्न जैविक प्रणालियों में विशिष्ट जीन की गतिविधि जीन समारोह 1 के अध्ययन में एक मूल्यवान रणनीति बन गया है। इस लक्ष्य को पूरा करने का एक सीधा मतलब न्यूक्लियोटाइड दृश्यों में हेरफेर और उत्परिवर्ती alleles उत्पन्न करने के लिए है। हालांकि जीवित कोशिकाओं के जीनोम के लिए सटीक, लक्षित परिवर्तन करने में अभी भी है एक समय लेने वाली और श्रम प्रधान अभ्यास, शक्तिशाली TALEN और Crispr / Cas9 उपकरणों के विकास जीनोम संपादन 2-5 के एक नए युग खोल दिया है। जीन में गड़बड़ी के लिए एक अधिक नियमित प्रयोगशाला विधि आनुवंशिक सामग्री (DNAs और कोडिंग दृश्यों या siRNAs / shRNAs युक्त आरएनए) कोशिकाओं में व्यक्त या ब्याज 1,6 के जीन (ओं) को पछाड़ना की शुरूआत पर ध्यान केंद्रित किया है।

कई मामलों में, जीन में गड़बड़ी के लिए बड़ी अड़चन कोशिकाओं में डीएनए, आरएनए, या प्रोटीन की डिलीवरी है। इन विट्रो अध्ययन के संबंध में, कुशल transfecti के साथसिस्टम पर कई सुसंस्कृत सेल लाइनों में स्थापित किया गया है। हालांकि, विशेष रूप से माउस मॉडल में, इन विवो जीन डिलीवरी अधिक चुनौतीपूर्ण है। वहाँ अतिरिक्त और intracellular बाधाओं को आदेश बहिर्जात अभिकर्मकों के कुशल सेलुलर तेज हासिल करने के लिए नजरअंदाज किए जाने की जरूरत है की एक श्रृंखला रहे हैं। अतिरिक्त बाधाएं तेजी से निकासी और वितरित की सामग्री 7.8 से कम की अवधि शामिल हैं। एक रणनीति के इन मुद्दों को दरकिनार करने के लिए "वाहक" या "वाहन" इन विवो जीन डिलीवरी के लिए के रूप में वायरल वैक्टर का उपयोग करने के लिए है। वायरस के स्वाभाविक रूप से विकसित पारगमन गुण कोशिकाओं 7,9,10 में ब्याज की एक जीन की कुशल वितरण की अनुमति है। वायरल वैक्टर के कई प्रकार विकसित किया है और विभिन्न प्रकार के और अंगों चूहों में कोशिका में विवो जीन हेरफेर में लचीला सक्षम किया गया है।

सबसे अधिक इस्तेमाल किया वायरल सिस्टम Retrovirus, Lentivirus, Adenovirus, और एडिनो जुड़े वायरस (एएवी) शामिल 12-14 में transduced जीनों की अभिव्यक्ति के लिए आजीवन संभावित प्रदान करते हैं। हालांकि, रेट्रोवायरस के कई प्रकार के केवल संक्रमित कोशिकाओं को विभाजित है, और गैर विभाजित कोशिकाओं में उनकी प्रभावकारिता बहुत कम 15 है। इस जीन डिलीवरी के लिए उनकी उपयोगिता को सीमित करता है। Lentivirus Retroviridae परिवार की एक जीनस है। अन्य रेट्रोवायरस से अलग है, Lentivirus दोनों को विभाजित और गैर विभाजित कोशिकाओं को संक्रमित कर सकते हैं और व्यापक रूप से बाद mitotic और अत्यधिक विभेदित कोशिकाओं 16 में जीन स्थानांतरण के लिए इस्तेमाल किया गया है। Lentivirus के जीवन चक्र भी मेजबान जीनोम में वेक्टर डीएनए के एकीकरण शामिल है। इस प्रकार, Lentivirus की मध्यस्थता जीन डिलीवरी transduced आनुवंशिक तत्वों 16-18 के स्थिर और लंबी अवधि अभिव्यक्ति सक्षम बनाता है। हालांकि, यह सुविधा एक डबल-ए प्रतिनिधित्व कर सकते हैंइन वायरस के उपयोग में dged तलवार जीन अभिव्यक्ति में हेरफेर करने के लिए, के रूप में वेक्टर डीएनए के एकीकरण इन्सर्शनल म्युटाजेनेसिस को जन्म दे सकती मेजबान कोशिकाओं में और artefactual प्रभाव पैदा कर सकता है। Adenovirus एक और व्यापक रूप से इस्तेमाल जीन वितरण प्रणाली है। रेट्रोवायरस और lentiviruses के विपरीत, एडिनोवायरस गैर एकीकृत कर रहे हैं और मेजबान कोशिकाओं 8,10,11,19 के जीनोमिक ईमानदारी के साथ हस्तक्षेप नहीं करते। इसके अलावा, एडिनोवायरस कई प्रकार की कोशिकाओं में डीएनए transfect कर सकते हैं, और संक्रमण सक्रिय कोशिका विभाजन 19 पर निर्भर नहीं है। एडिनोवायरस की एक और महत्वपूर्ण विशेषता है, वेक्टर शुद्धि में आसानी के रूप में वायरल वैक्टर क्षमता 19,20 दोहराया जाना है। हालांकि, इस प्रणाली का एक प्रमुख चेतावनी है कि Adenovirus संक्रमण विशेष रूप से जीन थेरेपी के अध्ययन में, लक्ष्य कोशिकाओं और अंगों 19 में मजबूत प्रतिरक्षा प्रतिक्रिया ट्रिगर, कई जांच में इसके उपयोग को सीमित कर सकते हैं।

इन विभिन्न प्रकार के साथ तुलनावायरल वैक्टर एस, पुनः संयोजक एडिनो जुड़े वायरस (rAAV) आदर्श जीन वितरण प्रणाली 21,22 प्रतीत होता है। यह कम से कम प्रतिरक्षाजनकता और pathogenicity 23,24 दर्शाती है। इसके अलावा, rAAV प्रकार की कोशिकाओं का एक व्यापक रेंज, दोनों विभाजन और गैर विभाजित कोशिकाओं सहित संक्रमित। ज्यादातर मामलों में, rAAV मेजबान जीनोम में एकीकृत नहीं करता है; इस प्रकार, लक्ष्य कोशिकाओं में अवांछित आनुवंशिक या जीनोमिक परिवर्तन के खतरे को कम 22 है।

हाल ही में, rAAV सिस्टम सफलतापूर्वक माउस हृदय की मांसपेशी 23,25-29 में डीएनए एन्कोडिंग प्रोटीन, miRNAs, shRNAs, और Crispr-gRNAs के vivo प्रसव के लिए इस्तेमाल किया गया है। इस पद्धति हृदय अनुसंधान के क्षेत्र में मौलिक जांच और जीन थेरेपी के अध्ययन में मदद की है। इधर, विस्तृत प्रक्रिया rAAV9 वैक्टर कि कुशलतापूर्वक overexpress या माउस दिलों में ब्याज की जीन पछाड़ना वर्णित किया गया था उत्पन्न करते हैं। प्रोटोकॉल के लिए एक सरल और प्रभावी तरीका प्रदान करता हैmurine प्रयोगात्मक मॉडल में हृदय जीन अभिव्यक्ति जोड़ तोड़।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी वर्णित चरणों जैव सुरक्षा समिति और बोस्टन बच्चों के अस्पताल के संस्थागत पशु की देखभाल और उपयोग समिति द्वारा अनुमोदित प्रोटोकॉल के तहत प्रदर्शन किया गया। बोस्टन बच्चों के अस्पताल विनियमित प्रकाश / अंधेरे चक्र और जलवायु नियंत्रण के साथ रोगज़नक़ मुक्त माउस की सुविधा है। पशु चिकित्सा एवं पशु की देखभाल के कर्मचारियों परिवर्तन पिंजरों और चूहों के स्वास्थ्य को सुनिश्चित। सुविधाओं AAALAC प्रमाणित कर रहे हैं और सक्रिय पशु कल्याण आश्वासन प्रमाण पत्र (AAALAC प्रत्यायन पर 1992/02/24 पशु कल्याण आश्वासन नंबर दी।: A3303-01) है। चूहे सीओ 2 एक संकुचित गैस स्रोत से बचाया द्वारा euthanized थे। ऊतकों के नमूनों की पुष्टि है कि हृदय गति, आंदोलन, और जानवरों की सांस लेने के बाद बंद था एकत्र किए गए थे। नवजात मूषक 2 इच्छामृत्यु सीओ प्रतिरोधी रहे हैं और तेज कैंची का उपयोग कत्ल द्वारा euthanized थे। इन तरीकों में पशु चिकित्सा अमेरिकन मेडिका का इच्छामृत्यु पर पैनल की सिफारिशों के साथ संगत कर रहे हैंएल एसोसिएशन।

प्लाज्मिड रीढ़ की हड्डी में एक सीडीएनए या shRNA अभिव्यक्ति कैसेट क्लोनिंग द्वारा rAAV9 निर्माणों के 1. जनरेशन

नोट: rAAV9 प्लाज्मिड, उल्टे टर्मिनल दोहराता AAV2 की (ITRS), जीन overexpression के लिए इस्तेमाल किया युक्त चिकन TNNT2 बंदरगाह करने के लिए संशोधित किया गया है प्रमोटर (rAAV9.cTNT), जो transduced जीन 25,26,29 की cardiomyocyte विशिष्ट अभिव्यक्ति सक्षम बनाता है। अनोखा NheI और KpnI साइटों प्लाज्मिड, प्रमोटर के बहाव में पेश किया गया है। सीडीएनए ब्याज की जीन एन्कोडिंग टुकड़े इन दोनों प्रतिबंध साइटों का उपयोग कर 25,26,29 rAAV9 रीढ़ की हड्डी में क्लोन किया जा सकता है। इधर, एक उदाहरण के रूप में, माउस दिलों में GFP जीन की overexpression के लिए rAAV9 वेक्टर उत्पन्न किया गया था। जिसके परिणामस्वरूप प्लाज्मिड cTNT :: GFP कैसेट दो आईटीआर साइटों (चित्रा 1) से घिरे होते हैं। rAAV9.U6 :: shRNA निर्माणों 25 पछाड़ना जीन के लिए इस्तेमाल किया गया। डिजाइन का उपयोग कर shRNAsऑनलाइन shRNA डिजाइन सर्वर। rAAV9.U6 :: shRNA या तो annealing द्वारा और डीएनए ओलिगोस युक्त U6 प्रमोटर को शरण देने प्रतिबंध एंजाइम पचा rAAV9 वैक्टर में shRNA दृश्यों ligating, या लंबी दूरी से पीसीआर और इंट्रा-आणविक गिब्सन विधानसभा आधारित "सहज" उत्पन्न किया जा सकता निर्माण 30। जिसके परिणामस्वरूप प्लाज्मिड U6-shRNA कैसेट दो आईटीआर साइटों (चित्रा 2) से घिरे शामिल करना चाहिए। इधर, एक उदाहरण के रूप में, rAAV9.U6 :: shRNA वेक्टर Trbp mRNA (: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG Trbp shRNA अनुक्रम) पछाड़ना के लिए निर्माण किया गया था। एक संघर्ष shRNA एक नकारात्मक नियंत्रण (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) के रूप में इस्तेमाल किया गया था।

  1. rAAV9 प्लाज्मिड रीढ़ की हड्डी में सीडीएनए या shRNA अभिव्यक्ति कैसेट क्लोन। सक्षम ई कोलाई कोशिकाओं में डीएनए 25 रूपांतरण।
    नोट: rAAV9 डीएनए परिवर्तन के लिए उपयोग stbl2 या stbl3 ई कोलाई कोशिकाओं अवांछित आईटीआर पुनर्संयोजन कम से कम।
  2. उठाओबदल ई कोलाई कोशिकाओं से सकारात्मक क्लोन। लिली-बार्नेट माध्यम की 500 मिलीलीटर में संस्कृति बढ़ाना और बैक्टीरियल कोशिकाओं 25-30 से rAAV9 प्लाज्मिड निकाल सकते हैं।
    नोट: मिडी / मैक्सी डीएनए (> 100 माइक्रोग्राम) के एक उच्च राशि प्राप्त करने के लिए rAAV9 प्लाज्मिड प्रस्तुत करने का। वायरस पैदा करने से पहले, हमेशा की तरह, प्रतिबंध पाचन और agarose जेल वैद्युतकणसंचलन द्वारा एएवी plasmids के अनुक्रम अखंडता का विश्लेषण के रूप में पहले से वर्णित (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html)।

2. rAAV9 plasmids के साथ HEK293 कोशिकाओं के अभिकर्मक

  1. रेखीय पॉलीएथिलएमीन (पी) समाधान के 1 माइक्रोग्राम / μl तैयार करें। Endotoxin मुक्त DH में पी पाउडर भंग 2 हे कि 70-80 डिग्री सेल्सियस तक गर्म किया गया है। आर टी करने के लिए नीचे Aftercooling, 1 एम एचसीएल के साथ पीएच 7.0 का हल बेअसर। बाँझ फ़िल्टर (0.22 माइक्रोन) समाधान। 1 माइक्रोग्राम / μl पी शेयर समाधान (1,400 μl / ट्यूब) अशेष भाजक और solut स्टोर-20 डिग्री सेल्सियस पर आयन।
  2. Dulbecco संशोधित ईगल मध्यम (DMEM) 10% भ्रूण गोजातीय सीरम (FBS) और 1% पेनिसिलिन / स्ट्रेप्टोमाइसिन के साथ में संस्कृति HEK293 कोशिकाओं। संस्कृति 5 ± 0.5% कार्बन डाइऑक्साइड के साथ एक 37 डिग्री सेल्सियस इनक्यूबेटर में कोशिकाओं (सीओ 2)।
  3. 2 घोला: 0 दिन में, एक 1 में बंटवारे> 90% मिला हुआ कोशिकाओं द्वारा अभिकर्मक पहले 18-20 घंटा के दस 150 मिमी बर्तन में HEK293 कोशिकाओं थाली।
    नोट: 1 दिन में, कोशिकाओं 90% संगम तक पहुंच जाना चाहिए।
  4. 1 दिन में rAAV9 प्लाज्मिड (जैसे, rAAV9.cTNT :: GFP या rAAV6.U6 :: shRNA constructs), विज्ञापन-हेल्पर प्लाज्मिड, और एएवी प्रतिनिधि / कैप प्लाज्मिड पी 25,26,29 उपयोग कर के साथ HEK293 कोशिकाओं transfect।
    1. 90% संगम पर कोशिकाओं के 10 व्यंजन के लिए, एक 50 मिलीलीटर अपकेंद्रित्र ट्यूब में एएवी प्रतिनिधि / कैप प्लाज्मिड के 70 माइक्रोग्राम, 70 माइक्रोग्राम rAAV9 प्लाज्मिड पीएफ, और 200 माइक्रोग्राम प्रति विज्ञापन-हेल्पर प्लाज्मिड के मिश्रण।
    2. कोशिकाओं को कम मिला हुआ हैं, तो डीएनए राशि आनुपातिक समायोजित करें। उदाहरण के लिए, यदि कोशिकाओं को 75% मिला हुआ पर हैं, को कमडीएनए राशि आनुपातिक (राशि कदम 2.4.1 में दिखाया गया की 75/90): मिश्रण 70 x 75/90 = 58.3 माइक्रोग्राम एएवी प्रतिनिधि / कैप प्लाज्मिड के, 70 x 75/90 = 58.3 rAAV9 प्लाज्मिड की माइक्रोग्राम, और 200 x 75/90 = 166.7 एक 50 मिलीलीटर अपकेंद्रित्र ट्यूब में विज्ञापन-हेल्पर प्लाज्मिड की माइक्रोग्राम।
    3. 50 मिलीलीटर ट्यूब के लिए आरटी DMEM (FBS के बिना) के 49 मिलीलीटर जोड़ें और मिश्रण अच्छी तरह से।
    4. पी बनाने के लिए पी समाधान के 1,360 μl जोड़ें: डीएनए अनुपात (v / डब्ल्यू) 4: 1। अच्छी तरह मिलाएं। 30 मिनट - 15 के लिए आरटी पर सेते हैं।
    5. (दस 150 मिमी व्यंजनों के लिए मिश्रण के 50 एमएल) के प्रत्येक 150 मिमी पकवान करने के लिए कदम 2.4.4 में तैयार मिश्रण के 5 मिलीलीटर जोड़ें।
  5. संस्कृति 60-72 घंटे के लिए 5 ± 0.5% सीओ 2 के साथ एक 37 डिग्री सेल्सियस इनक्यूबेटर में कोशिकाओं।

3. ट्रांसफ़ेक्ट HEK293 की फसल कोशिकाओं और rAAV9 वैक्टर की शुद्धि

  1. कोशिकाओं अभिकर्मक के बाद 60-72 मानव संसाधन हार्वेस्ट। हटाना और ऊपर pipetting द्वारा और संस्कृति के माध्यम से नीचे बर्तन में कोशिकाओं को निलंबित। सभी सेल निलंबन स्थानांतरण बाँझ50 मिलीलीटर ट्यूब।
  2. 5 मिनट के लिए 500 XG पर कोशिकाओं अपकेंद्रित्र। प्रत्येक ट्यूब में पीबीएस के 5 मिलीलीटर के साथ सेल गोली Resuspend और एक 50 मिलीलीटर ट्यूब में सभी सेल निलंबन गठबंधन।
  3. 5 मिनट के लिए 500 XG पर कोशिकाओं अपकेंद्रित्र। सतह पर तैरनेवाला त्यागें। इस चरण में, -80 डिग्री सेल्सियस पर सेल गोली दुकान या तुरंत कदम 3.4-3.15 में वर्णित है, गोली से एएवी शुद्ध।
  4. 150 मिमी NaCl और 20 मिमी Tris एचसीएल, पीएच 8.0: lysis बफर तैयार करें। बाँझ फ़िल्टर (0.22 सुक्ष्ममापी)। 4 डिग्री सेल्सियस पर बफर स्टोर।
  5. lysis बफर के 10 मिलीलीटर के साथ गोली Resuspend।
  6. -80 डिग्री सेल्सियस पर या सूखी बर्फ / इथेनॉल स्नान में lysate रुक, तो यह पिघलना 37 डिग्री सेल्सियस पर। 1 मिनट के लिए भंवर। रुक और lysate गल 3 बार।
  7. Thawed lysate के लिए 2 MgCl समाधान जोड़ें (lysate में 2 MgCl के अंतिम एकाग्रता बनाने 1 मिमी होना)। 250 यू / मिलीलीटर की एक अंतिम एकाग्रता के लिए nuclease जोड़ें। 15 मिनट के लिए 37 डिग्री सेल्सियस पर सेते डीएनए / प्रोटीन aggr भंग करने के लिएegation।
    नोट: डीएनए / प्रोटीन एकत्रीकरण, nuclease या endonuclease उपचार के बाद भंग नहीं मिलता है तो Dounce homogenize lysates 20 बार।
  8. 4 डिग्री सेल्सियस पर 20 मिनट के लिए 4800 XG पर नमूना अपकेंद्रित्र। सतह पर तैरनेवाला लीजिए।
  9. इस बीच, iodixanol ढाल समाधान तैयार:
    1. 1 एम 2 MgCl के 0.05 मिलीलीटर, 1 एम KCl की 0.125 मिलीग्राम 10x पीबीएस के 5 मिलीलीटर, 5 एम NaCl के 10 मिलीलीटर, और ढाल मध्यम ofdensity 12.5 मिलीलीटर मिश्रण से ढाल समाधान का 17% तैयार करें। एच 2 ओ का उपयोग कर 50 मिलीलीटर की कुल मात्रा समायोजित करें
    2. 1 एम 2 MgCl के 0.05 मिलीलीटर, 1 एम KCl की 0.125 मिलीग्राम, घनत्व ढाल माध्यम के 20 मिलीलीटर, और 0.5% की 0.2 मिलीग्राम (डब्ल्यू / वी) फिनोल लाल 10x पीबीएस के 5 मिलीलीटर, मिश्रण से 25% समाधान तैयार है। एच 2 ओ का उपयोग कर 50 मिलीलीटर की कुल मात्रा समायोजित करें
    3. 1 एम 2 MgCl के 0.05 मिलीलीटर, 1 एम KCl की 0.125 मिलीग्राम, और घनत्व ढाल माध्यम की 33.3 मिलीलीटर 10x पीबीएस के 5 मिलीलीटर, मिश्रण से 40% समाधान तैयार है। का उपयोग करते हुए 50 मिलीलीटर की कुल मात्रा समायोजित करेंएच 2
    4. मिश्रण से 60% समाधान तैयार है 1 एम MgCl 2, 1 एम KCl की 0.125 मिलीग्राम की 0.05 मिलीग्राम, घनत्व ढाल माध्यम के 50 मिलीलीटर, और 0.1 0.5 मिलीलीटर% (w / v) फिनोल लाल।
  10. एक सुई और सिरिंज के साथ, और 60% से 17% के 5 मिलीलीटर, 25% के 5 मिलीलीटर, 40% के 5 मिलीलीटर 5 मिलीलीटर के क्रम में polypropylene ट्यूब में iodixanol ढाल समाधान लोड नीचे से शुरू। लोड सभी lysate ढाल के शीर्ष पर कदम 3.8 (14-16 मिलीलीटर) से प्राप्त किया। ढाल, नीचे से ऊपर तक सूचीबद्ध है, 60%, 40%, 25%, 17%, और lysate परत है। lysis बफर के साथ ट्यूब भरें और काग के साथ कवर।
  11. 16 डिग्री सेल्सियस पर 90 मिनट के लिए 185,000 XG पर अपकेंद्रित्र।
  12. एक सिरिंज के साथ वायरल अंश (40% परत) हार्वेस्ट। 40% और 60% अंशों बीच चौराहे में सुई (21 गेज) डालें, केवल 40% परत aspirating।
    नोट: 25% परत के किसी भी श्वास से बचें।
  13. निष्फल polyoxyethylene-polyoxypro के साथ वायरल अंश मिक्सpylene ब्लॉक copolymer पीबीएस समाधान (10% polyoxyethylene-polyoxypropylene ब्लॉक copolymer शेयर 1: 10,000 पीबीएस में पतला) 15 मिलीलीटर की कुल मात्रा पर निर्भर है। फिल्टर ट्यूब (कट ऑफ मेगावाट = 100 केडी) में मिश्रण लोड। 4 डिग्री सेल्सियस पर 30 मिनट के लिए 2,000 XG पर अपकेंद्रित्र।
  14. तल पर समाधान त्यागें। 15 मिलीलीटर की कुल मात्रा को polyoxyethylene-polyoxypropylene ब्लॉक copolymer पीबीएस समाधान के साथ फिल्टर ट्यूब फिर से भरना। 4 डिग्री सेल्सियस पर 20 मिनट के लिए 2,000 XG पर अपकेंद्रित्र। इस कदम दो बार दोहराएँ। शुद्ध rAAV9 वायरस (फिल्टर ऊपर अंश) ले लीजिए।
  15. 1.7 एमएल ट्यूबों के लिए फिल्टर ट्यूब में शुद्ध rAAV9 स्थानांतरण। शुद्ध rAAV9 विभाज्य (100 - 400 से μl / ट्यूब, मात्रा और एएवी की अनुमापांक के आधार पर) और -80 डिग्री सेल्सियस पर वायरस की दुकान।
    ध्यान दें: बचें दोहराया फ्रीज thaws।

4. rAAV9 के अनुमापांक का मापन

  1. मानक डीएनए नमूने तैयार करें।
    1. डिजाइन विशिष्ट और कुशल पीसीआरrAAV9 वैक्टर के लिए प्राइमरों और पीसीआर हालत अनुकूलन।
      नोट: इस अध्ययन में इस्तेमाल प्राइमरों कर रहे हैं "फॉरवर्ड: TCGGGATAAAAGCAGTCTGG, रिवर्स: TCGGACGGAGATACGTGAGT"। 3 मिनट के लिए 95 डिग्री सेल्सियस पर प्रारंभिक अप्राकृतिकरण;: पीसीआर प्रतिक्रिया निम्न शर्तों के साथ प्रदर्शन किया गया था 20 सेकंड, 15 सेकंड के लिए 60 डिग्री सेल्सियस, और 10 सेकंड के लिए 72 डिग्री सेल्सियस के लिए 95 डिग्री सेल्सियस के 35 चक्र; और 10 मिनट के लिए 72 डिग्री सेल्सियस पर अंतिम विस्तार। हालांकि, अनुकूलित प्राइमरों और पीसीआर की स्थिति, प्लाज्मिड विशिष्ट हैं के रूप में rAAV9 वेक्टर में इनसेट अनुक्रम विशिष्टता और पीसीआर 31 की क्षमता को प्रभावित कर सकता है।
    2. कदम 4.1.1 में दिखाया शर्तों के साथ पीसीआर प्रतिक्रिया प्रदर्शन करना। एक जेल निकालना किट के साथ पीसीआर उत्पाद शुद्ध।
    3. एक स्पेक्ट्रोफोटोमीटर का उपयोग कर शुद्ध डीएनए की एकाग्रता को मापने। पीसीआर उत्पाद की आणविक वजन / लंबाई के आधार पर डीएनए आणविक संख्या में एकाग्रता की गणना।
      1. निम्न समीकरण का उपयोग आणविक एकाग्रता की गणना: मोlecular एकाग्रता (डीएनए अणु या टुकड़े / एमएल) = 6.23 x 10 23 मोल -1 एक्स कोन। एक्स 10 -6 / मेगावाट। नोट: (6.23 x 10 23 मोल -1 Avagadro की संख्या है, माइक्रोग्राम / एमएल में कोन .: डीएनए एकाग्रता; मेगावाट .: जी / मोल में आणविक वजन)। उदाहरण के लिए, यदि पीसीआर उत्पाद के प्राप्त एकाग्रता 100 माइक्रोग्राम / एमएल है और इसकी लंबाई 200 बीपी है, डबल असहाय डीएनए की आणविक वजन 2 x 200 x 310 = 124,000 (प्रत्येक में न्यूक्लियोटाइड की औसत आणविक भार है एकल असहाय डीएनए के बारे में 310 जी / मोल) है। आणविक एकाग्रता (डीएनए अणु / एमएल) = 6.23 x 10 23 मोल -1 x 100 माइक्रोग्राम / एमएल एक्स 10 -6 / 124,000 जी / मोल = 5.18 x 10 14 डीएनए अणु / एमएल।
      2. 10 से 13 अणुओं / एमएल, 10 से 12 के अणुओं / एमएल, 10 11 अणुओं / एमएल, 10 10 अणुओं / एमएल, 10 9 अणुओं / एमएल, 10 की सांद्रता के साथ डीएनए टुकड़ा की एक कमजोर पड़ने श्रृंखला प्रदर्शन और मानक नमूने तैयार करते हैं, 7 अणुओं / एमएल। मात्रात्मक पीसीआर के लिए प्रत्येक मानक नमूना के लिए समाधान के 1 μl का उपयोग करें (qPCR, कदम 4.6 में)।
  2. 10x DNase बफर के 5 μl, DNase के 1 μl (10,000 यू / एमएल), और कुल मात्रा 50 μl होना चाहिए DDH 2 ओ के 39 μl के साथ शुद्ध rAAV9 समाधान के 5 μl मिक्स।
  3. अवशिष्ट विसंकुलित प्लास्मिड डीएनए दूर करने के लिए 30 मिनट के लिए 37 डिग्री सेल्सियस पर शीशी को सेते हैं।
  4. 10 मिनट के लिए 95 डिग्री सेल्सियस पर DNase निष्क्रिय। समाधान शांत हो जाओ, एच 2 ओ के 44 μl, 10x DNase बफर के 5 μl, और proteinase कश्मीर शेयर की 1 μl (10 मिलीग्राम / एमएल) जोड़ें।
  5. 2 घंटे के लिए 50 डिग्री सेल्सियस पर समाधान सेते हैं। प्रतिक्रिया बंद करो और 10 मिनट के लिए 95 डिग्री सेल्सियस पर proteinase कश्मीर निष्क्रिय।
  6. मात्रात्मक पीसीआर (qPCR) परख के लिए नमूने के 1 μl का प्रयोग करें। अनुमापांक गणना।
    1. कदम 4.1.1 में तैयार नमूने सोमवार का उपयोग कर प्राइमरों के साथ मात्रात्मक पीसीआर (qPCR) भागोओम कदम 4.1.4 (मानक नमूने) और 4.5 कदम से (नमूने मापा जा सकता है)।
      1. प्रत्येक प्रतिक्रिया के लिए, 2x ग्रीन मास्टर मिश्रण के 10 μl (Taq पोलीमर्स, dNTP मिश्रण, बफर, 2 MgCl, और ग्रीन डाई युक्त), आगे प्राइमर (5 माइक्रोन) के 0.5 μl, रिवर्स प्राइमर (5 माइक्रोन) के 0.5 μl मिश्रण एच 2 ओ के 8 μl, और नमूने के 1 μl मापा जाएगा। निम्न शर्तों के साथ qPCR प्रदर्शन करना: 2 मिनट और 10 मिनट के लिए 95 डिग्री सेल्सियस के लिए 50 डिग्री सेल्सियस पर नमूने पकड़; 15 सेकंड के लिए और 1 मिनट के लिए 60 डिग्री सेल्सियस पर 95 डिग्री सेल्सियस पर 40 चक्रों प्रदर्शन; पिघल चरण के लिए 30 सेकंड और 15 सेकंड के लिए 60 डिग्री सेल्सियस के लिए 95 डिग्री सेल्सियस पर नमूने सेते हैं। मानक मानक नमूने (चित्रा 3) के सी टी संख्या के आधार पर की अवस्था उत्पन्न करता है।
    2. आणविक एकाग्रता / मानक वक्र के खिलाफ एएवी नमूने की अनुमापांक गणना। rAAV9 एक एकल कतरा डीएनए जीनोम है, तो आणविक एकाग्रता से अधिक 2 गुना हो जाएगामूल्य की गणना (2x बिजली (10, वाई), चित्रा 3 बी)। इसके अलावा, शुद्ध rAAV9 की अनुमापांक क्या हिसाब से DNase और proteinase कश्मीर प्रतिक्रियाओं में वायरस (100 μl कुल में 5 μl) के 1:20 कमजोर पड़ने के कारण प्राप्त की है की तुलना में अधिक 20 गुना हो जाएगा।

5. नवजात चूहों और हृदय में जीन की अभिव्यक्ति assays में rAAV9 इंजेक्शन

  1. polyoxyethylene-polyoxypropylene ब्लॉक copolymer पीबीएस समाधान में rAAV9 काम कर समाधान तैयार करें। 1-7 एक्स 10 12 कणों / एमएल के titers के साथ वायरस शेयर करें।
    ध्यान दें: चमड़े के नीचे इंजेक्शन द्वारा प्रत्येक प्रसव के बाद दिन 0.5-1.5 माउस में rAAV9 समाधान के 50-70 μl उद्धार। कुशल जीन overexpression या पछाड़ना को प्राप्त करने के लिए, यह इंजेक्शन एएवी की राशि का अनुकूलन करने के लिए प्रत्येक अध्ययन के लिए एक पायलट परीक्षण करने के लिए सिफारिश की है। पूर्वाग्रह को कम करने के लिए प्रत्येक अध्ययन के लिए rAAV9.cTNT :: ल्यूक या rAAV9.U6 :: हाथापाई नियंत्रण का एक ही राशि का प्रयोग करें।
    नोट: हम 1-1.5 इस्तेमाल किया10 x 11 कणों / overexpression के लिए पिल्ला और 2.5 - 5 एक्स 10 11 कणों / पछाड़ना के लिए प्रसव के बाद दिन 0.5-1.5 एम आई सीई) में पिल्ला।
  2. चमड़े के नीचे इंजेक्शन द्वारा P0.5-P2.5 पर rAAV9 साथ नवजात चूहों को समझो।
    1. एक 29G1 / 2, 0.33 x 12.7 मिमी इंसुलिन rAAV9 समाधान के साथ सिरिंज पहले से भरना। हवाई बुलबुले को दूर करने के लिए सावधान रहें।
    2. अंगूठे और तर्जनी के साथ एक हाथ में क्रायो anesthetized पिल्ला पकड़ो। इंजेक्शन से पहले, एक झाड़ू छड़ी 70% isopropyl शराब के साथ संतृप्त बाँझ स्थिति बनाए रखने के साथ पिल्ला के पीछे त्वचा स्वाइप करें। 5 से 10 डिग्री के कोण पर पशु का अग्र-पृष्ठीय subcutis में सिरिंज सुई डालें। rAAV9 समाधान इंसुलिन सिरिंज का उपयोग कर के 50-70 μl इंजेक्षन।
      नोट: rAAV9 भी intraperitoneal या नसों में इंजेक्शन के माध्यम से 26,27 माउस के लिए दिया जा सकता है। दिल में दिया जीन की कुशल अभिव्यक्ति प्राप्त किया जा सकता है। हालांकि, intraperitoneal इंजेक्षनआयन कभी कभी जिगर में टपकाया अभिव्यक्ति में परिणाम हो सकता है। इंजेक्शन के बाद, पिल्ले की हालत हर दिन नजर रखी थी।
  3. दिल में जीन की अभिव्यक्ति के स्तर qPCR, immunofluorescence, या पश्चिमी धब्बा के साथ नजर रखी जा सकती है, 25,26 (प्रतिनिधि परिणाम आंकड़े 4 में 5 दिखाया गया है और कर रहे हैं)।
    नोट: चूहे सीओ 2 एक संकुचित गैस स्रोत से बचाया द्वारा euthanized थे। ऊतकों के नमूनों की पुष्टि है कि हृदय गति, आंदोलन, और जानवरों की सांस लेने के बाद बंद था एकत्र किए गए थे। नवजात मूषक 2 इच्छामृत्यु सीओ प्रतिरोधी रहे हैं और तेज कैंची का उपयोग कत्ल द्वारा euthanized थे। विधि पशु चिकित्सा अमेरिकन मेडिकल एसोसिएशन के इच्छामृत्यु पर पैनल की सिफारिशों के अनुरूप है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

RAAV9.cTNT :: GFP या rAAV9.U6 :: shRNA plasmids के rAAV9 निर्माण के लिए रणनीति आंकड़े 1 और 2, क्रमशः में दिखाए जाते हैं। उदाहरण के रूप में, rAAV9 वेक्टर माउस दिलों में GFP जीन overexpress करने के लिए तैयार की गई थी। जिसके परिणामस्वरूप प्लाज्मिड cTNT :: GFP कैसेट दो आईटीआर साइटों (चित्रा 1) से घिरे होते हैं। RAAV9.U6 :: shRNA वेक्टर Trbp mRNA पछाड़ना के लिए निर्माण किया गया था (चित्रा 2)

rAAV9 अनुमापन के लिए मानक वक्र रेखीय प्रतिगमन द्वारा qPCR डेटा के साथ उत्पन्न किया गया था। चालाकी से चर y प्रत्येक मानक नमूने के डीएनए आणविक एकाग्रता के प्रवेश 10 मूल्य का प्रतिनिधित्व करता है, और इसी चर x सी टी मूल्य का प्रतिनिधित्व करता है। लॉग 10 (एकाग्रता) मूल्यों (y) और सी टी संख्या (x) एक अच्छा रैखिक संबंध का प्रदर्शन (2 आर = 0.9971) और समीकरण y = -0.2832x + 14.616 (चित्रा 3) के साथ फिट बैठते हैं। RAAV9 नमूनों की titers रेखीय समीकरण (चित्रा 3 बी) के आधार पर गणना की गई। विधि प्रोटोकॉल (कदम 4.6.2 और चित्रा 3 बी) में वर्णित है, rAAV9 वैक्टर के एक उच्च अनुमापांक (50-200 μL,> 6 एक्स 10 से 13 कणों / एमएल) के साथ प्रतिनिधि अध्ययन में प्राप्त हुई थी।

RAAV9.cTNT वैक्टर की दक्षता और ऊतक विशिष्टता की निगरानी करने के लिए, P0.5 पिल्ले ही राशि rAAV9.cTNT :: Luciferase (एएवी ल्यूक) (1 x 10 11 कणों / पिल्ला) या rAAV9.cTNT :: GFP के साथ इलाज किया गया (एएवी GFP) चमड़े के नीचे इंजेक्शन द्वारा। दो हफ्ते इंजेक्शन के बाद, GFP संकेत चूहों के विभिन्न ऊतकों में नजर रखी थी। GFP के मजबूत अभिव्यक्ति दिल में पता चला था, लेकिन अन्य अंगों (चित्रा 4, एन> 3) में नहीं है। इस प्रकार, कुशल और दिल के विशिष्ट जीन अभिव्यक्ति rAAV9.cTNT वेक्टर के साथ हासिल की थी।

jove_content "fo: रख-together.within-पेज =" 1 "> पछाड़ना दक्षता और rAAV9.U6 वैक्टर के ऊतक विशिष्टता की निगरानी करने के लिए, P0.5 चूहों ही राशि rAAV9 (3 एक्स 10 11 कणों / पिल्ला) के साथ इलाज किया गया .U6 :: हाथापाई (एएवी-हाथापाई) या rAAV9.U6 :: Trbp shRNA (एएवी-shTrbp) चमड़े के नीचे इंजेक्शन द्वारा। इंजेक्शन के बाद दो सप्ताह की qPCR (चित्रा 5 से नजर रखी थी विभिन्न ऊतकों में Trbp की अभिव्यक्ति, एन = 3 Trbp का विनियमन)। दिल में Trbp के mRNA स्तर काफी rAAV9.U6 :: shTrbp (68% डाउनरेगुलेशन, पी = 0.0004452) द्वारा कम हो गया था। यह भी rAAV9.U6 से जिगर के ऊतकों में पाया गया :: shTrbp इलाज चूहों। हालांकि, परिवर्तन बहुत कम है।

आकृति 1
चित्रा 1: रणनीतियाँ rAAV9.cTNT :: GFP प्लाज्मिड का निर्माण करने के लिए। (ए) cTNT :: GFP कैसेट की योजना। (बी TNNT2 प्रमोटर (rAAV9.cTNT) दो अद्वितीय प्रतिबंध साइटों (NheI और KpnI) के बाद बंदरगाह करने के लिए संशोधित किया गया है। GFP खुला पढ़ने फ्रेम प्रतिबंध साइट की मध्यस्थता बंधाव द्वारा rAAV9.cTNT वेक्टर में क्लोन किया गया था rAAV9.cTNT :: GFP प्लाज्मिड उत्पन्न करते हैं। (बी) rAAV9.cTNT :: GFP प्लाज्मिड गिब्सन विधानसभा द्वारा निर्माण किया जा सकता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2: रणनीतियाँ rAAV9.U6 :: shRNA प्लाज्मिड का निर्माण करने के लिए। (ए) U6 की योजना :: shRNA कैसेट दिखाया गया है। shRNA की अभिव्यक्ति U6 प्रमोटर (ब्लू) से प्रेरित है। (बी) rAAV9-U6-shRNA कैसेट annealing द्वारा उत्पन्न किया जा सकता है और ligating डीएनए ओलिगोस शामिलU6 प्रमोटर को शरण देने प्रतिबंध एंजाइम पचा rAAV9 वैक्टर में आईएनजी shRNA दृश्यों। (सी) rAAV9.U6 :: shRNA कैसेट लंबी दूरी की पीसीआर और इंट्रा-आणविक गिब्सन विधानसभा आधारित "सहज" निर्माण के द्वारा उत्पन्न की जा सकती है। 5 'हाथ, पाश, और 3' shRNA के हाथ में क्रमश: हरे, नारंगी में दिखाया जाता है, और लाल। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3: rAAV9 टिटर की गणना। (ए) rAAV9 अनुमापन के लिए मानक वक्र रैखिक आक्रामकता qPCR डेटा का उपयोग करके तैयार की गई थी। चालाकी से चर y प्रत्येक मानक नमूने के डीएनए आणविक एकाग्रता के प्रवेश 10 मूल्य, और इसी चर x का प्रतिनिधित्व करता हैसी टी मूल्य का प्रतिनिधित्व करता है। (बी) rAAV9 नमूनों की titers मानक वक्र के रेखीय समीकरण के आधार पर गणना कर रहे हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4: चूहे के ऊतकों में rAAV9.cTNT :: GFP की अभिव्यक्ति पैटर्न। P0.5 पिल्ले चमड़े के नीचे इंजेक्शन द्वारा rAAV9.cTNT :: Luciferase (एएवी ल्यूक, नकारात्मक नियंत्रण) या rAAV9.cTNT :: GFP (एएवी GFP) की एक ही राशि (1 x 10 11 कणों / पिल्ला) के साथ इलाज किया गया। दो हफ्ते इंजेक्शन के बाद, ऊतकों के नमूनों काटा गया। GFP की अभिव्यक्ति एक फ्लोरोसेंट विच्छेदन दायरे के तहत नजर रखी थी। दोनों उज्ज्वल क्षेत्र और प्रतिदीप्ति छवियों प्रस्तुत कर रहे हैं। प्रयोगों से अधिक 3 बार (एन> 3) दोहराया गया है।स्केल बार = 2.0 मिमी। एसकेएम, कंकाल की मांसपेशी। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5: एएवी-shRNA साथ पछाड़ना जीन एक्सप्रेशन। P0.5 चूहों चमड़े के नीचे इंजेक्शन द्वारा rAAV9.U6 :: हाथापाई (एएवी-हाथापाई) या rAAV9.U6 :: Trbp shRNA (एएवी-shTrbp) की एक ही राशि (3 एक्स 10 11 कणों / पिल्ला) के साथ इलाज किया गया। दो हफ्ते इंजेक्शन के बाद, विभिन्न ऊतकों में Trbp की mRNA स्तर qPCR द्वारा निगरानी की गई (एन = 3)। डेटा मतलब ± SEM के रूप में प्रस्तुत कर रहे हैं। कट ऑफ पी मूल्य 0.05 है। एन एस, पी> 0.05, महत्वपूर्ण नहीं है। **, पी <0.01। एसकेएम, कंकाल की मांसपेशी। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यह प्लाज्मिड निर्माण के दौरान अवांछित आईटीआर पुनर्संयोजन कम करने के लिए महत्वपूर्ण है। वायरस पैदा करने से पहले, एक हमेशा प्रतिबंध पाचन और agarose जेल वैद्युतकणसंचलन का उपयोग करके एएवी plasmids के आईटीआर अखंडता पर नजर रखने चाहिए। यह 100% बरकरार plasmids प्राप्त करने के लिए असंभव है, लेकिन पुनर्संयोजन अनुपात जितना संभव हो उतना कम किया जाना चाहिए। 20% से कम सफल rAAV9 पैकेजिंग के लिए स्वीकार्य है। ध्यान से, एक कम झटकों की गति (180-200 आरपीएम) के साथ कम तापमान (30 डिग्री सेल्सियस) पर बैक्टीरिया संवर्धन आईटीआर पुनर्संयोजन की संभावना को कम कर सकते हैं।

यह सुनिश्चित करने के लिए कि HEK293 कोशिकाओं सफल अभिकर्मक और rAAV9 पैकेजिंग के लिए स्वस्थ हैं आवश्यक है। "स्वस्थ" कोशिकाओं को आमतौर पर अत्यधिक proliferative कर रहे हैं और जल्दी बढ़ता है। हालांकि, तेजी से प्रसार और HEK293 कोशिकाओं के विकास के लिए जरूरी rAAV9 पैकेजिंग की उच्च क्षमता की गारंटी नहीं है। इस प्रकार, यह ताजा कोशिकाओं के साथ प्रयोगों शुरू करने के लिए महत्वपूर्ण है। यहकम पारित होने HEK293 कोशिकाओं का उपयोग करने की सिफारिश की है rAAV9 पैकेजिंग के लिए (<10 मार्ग, कोशिकाओं हर 2-3 दिन passaged कर रहे हैं)। ध्यान से, rAAV के अन्य सीरमप्रकारों विभिन्न प्रक्रियाओं 32 का उपयोग कर शुद्ध होना पड़ सकता है।

अन्वेषक rAAV9 plasmids की पीढ़ी में लचीलापन प्रदान किया जाता है। या तो प्रतिबंध साइट की मध्यस्थता बंधाव या गिब्सन विधानसभा 30 का इस्तेमाल किया जा सकता है। RAAV9.U6 :: shRNA निर्माण के लिए, इंट्रा-आणविक गिब्सन विधानसभा आधारित रणनीति एक प्रभावी तरीका है (आंकड़े 1 और 2)। एकाधिक एएवी-shRNA plasmids या जमा एएवी-shRNAs तेजी से निर्माण किया जा सकता है। rAAV9 का उपयोग कर जीन overexpress करने के लिए, वहाँ डाला सीडीएनए दृश्यों के लिए एक आकार सीमा से मौजूद है। आम तौर पर, ITRS बीच आकार टुकड़ा छोटे से अधिक 5 केबी 33 होने की जरूरत है। Intein उत्प्रेरित प्रोटीन splicing rAAV9 वैक्टर 34 की पैकेजिंग के आकार की सीमा को नाकाम करने के लिए इस्तेमाल किया जा सकता है।

अन्य वायरल प्रणालीरेट्रोवायरस, lentivirus और एडीनोवायरस सहित, को भी विकसित किया है और लचीला जीन में गड़बड़ी सक्षम किया गया है। उच्च दक्षता, उच्च विशिष्टता, कम जीनोमिक एकीकरण दर, कम से कम: वायरल वैक्टर के इन विभिन्न प्रकार के साथ तुलना में, rAAV विशिष्ट फायदे प्रतिरक्षाजनकता, और कम से कम pathogenicity। इस प्रकार, rAAV आधारित जीनोम इंजीनियरिंग में विवो जीन में गड़बड़ी के लिए एक आदर्श उपकरण के रूप में उभर रहा है।

पिछले अध्ययनों से पता चला है कि rAAV9 प्रणाली विवो में दिया जीन की कुशल अभिव्यक्ति के लिए सक्षम बनाता है। CTNT (चिकन TnnT2) प्रमोटर के साथ, दिल के विशिष्ट जीन अभिव्यक्ति (चित्रा 4) 25,26 प्राप्त हुई थी। हालांकि U6 प्रमोटर माउस ऊतकों, लक्ष्य mRNA (Trbp) rAAV9.U6 द्वारा की सबसे हड़ताली निषेध में सर्वत्र सक्रिय है :: shRNA दिल में मनाया गया, लेकिन अन्य अंगों में (चित्रा 5)। जिगर सबसे आम अंग के विभिन्न सीरमप्रकारों द्वारा transduced हैrAAV 35,36। हालांकि, पछाड़ना दक्षता (mRNA स्तर के 36% की कमी) जिगर में है कि दिल (mRNA स्तर के 68% की कमी) की तुलना में काफी कम है। यह पिछले दिखा रहा है कि अध्ययन के साथ संगत है, जिगर में उच्च वायरल जीनोम मौजूदगी के बावजूद, rAAV9 द्वारा shRNA के प्रणालीगत प्रसव अधिक कुशल जीन दिल 35 में पछाड़ना है। यह संभव है कि hepatocytes cardiomyocytes की तुलना में अधिक proliferative कर रहे हैं और अधिक सक्रिय रूप से नवजात उम्र में rAAV9 प्रशासन, जो जिगर के ऊतकों में पर्याप्त वेक्टर जीनोम कमजोर पड़ने में परिणाम के बाद कोशिका विभाजन के दौर से गुजर रहे हैं। बहरहाल, यह भी पता चलता है कि rAAV9 की सीरोटाइप और अधिक कुशलता से अन्य प्रकार की कोशिकाओं की तुलना में cardiomyocytes transduce सकता है। Lovric एट अल द्वारा प्रदर्शन के रूप में।, विभेदित myocytes में, डीएनए की क्षति की प्रतिक्रिया MRN जटिल प्रोटीन दमित कर रहे हैं। MRN जटिल प्रोटीन एएवी जीनोम बाँध और ट्रांसक्रिप्शनल मुंह बंद करने के माध्यम से एएवी पारगमन को रोकती हैं। इस प्रकार, प्रतिएएवी पारगमन को missivity cardiomyocytes 36 के टर्मिनल भेदभाव से प्रेरित किया जा सकता है, rAAV9 प्रणाली बनाने, अन्य वायरल वैक्टर, दिल में जीन की हेरफेर के लिए बहुत उपयुक्त की तुलना में। आगे अन्य अंगों (जैसे, यकृत), एक भी हृदय-विशिष्ट cTNT प्रमोटर संचालित मीर 30A आधारित shmiR उपयोग कर सकते हैं दिल 29 में ब्याज की जीन को दबाने के लिए अवांछित पछाड़ना प्रभाव को कम करने के लिए। यह पांडुलिपि हृदय जांच में rAAV9 प्रौद्योगिकी पर capitalizing के लिए विशेष तकनीक के साथ पाठक प्रदान करता है।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics