Fare Kalpler eksprese rAAV9 hazırlanması veya demonte Genler

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

sıçan modellerinde genetik materyallerin miyokard teslim yoluyla ifade ya da belirli genlerin aktivitesini kontrol eden gen fonksiyonlarının soruşturma izin verir. merkezinde Bunların terapötik potansiyeli de belirlenebilir. Fare kalp in vivo molekül müdahale sınırlı yaklaşımlar bulunmaktadır. Rekombinant adeno-bağlantılı virüsü (AAV) tabanlı genom mühendisliği in vivo kardiyak gen manipülasyonu için gerekli bir araç olarak kullanılmıştır. Bu teknolojinin belirli avantajları minimal yüksek verimlilik, yüksek özgüllük, düşük genomik entegrasyon oranı dahil immünojenisite ve minimal patojenite. Burada, rAAV9 vektörleri, inşa paket ve arındırmak için detaylı bir prosedür açıklanmıştır. Yenidoğan yavruların halinde rAAV9 deri altı enjeksiyonu, karaciğer ve diğer dokularında güçlü bir ifade ya da fare kalbinde ilgili gen (ler) in etkin bir devirme ile sonuçlanır, fakat. Kalp-specifi kullanarakCı TnnT2 promoteri, kalp GFP geninin yüksek elde edildi. Ayrıca, rAAV9-U6-ShRNA kullanılmıştır zaman mRNA kalbinde inhibe edilmiştir hedef. rAAV9 teknoloji bilgisi çalışma kardiyovasküler araştırmalar için de faydalı olabilir.

Introduction

Çeşitli biyolojik sistemlerde, belirli genlerin dışavurumu ya da aktivitesini kontrol gen fonksiyonu 1 çalışmasında değerli bir strateji haline gelmiştir. Bu amacı gerçekleştirmek doğrudan bir aracı nükleotid dizilerini işlemek ve mutant alelleri üretmektir. canlı hücre genomuna kesin ve hedeflenen bir değişiklik yapmak hala olmasına rağmen Bir zaman alıcı ve emek yoğun bir uygulamadır, güçlü TALEN ve CRISPR / Cas9 araçlarının geliştirilmesi genom düzenleme 2-5 yeni bir dönem açtı. Gen manipülasyonu için daha rutin laboratuvar yöntemi genetik malzemeler (DNA'lar ve kodlama dizileri veya siRNA'lar / shRNAs içeren RNA'lar) açık veya ilgi 1,6 gen (ler) demonte hücrelerin içine giriş odaklanmıştır.

Pek çok durumda, gen manipülasyonu için büyük bir darboğaz hücrelerine DNA, RNA ya da protein verilmesidir. In vitro çalışmalarda dikkate alarak, verimli transfecti ilesistemlerde çok kültürlenmiş hücre çizgileri kurulmuştur. Bununla birlikte, özellikle de fare modelinde in vivo gen aktarım daha zordur. Eksojen reaktiflerin etkili biçimde hücreye alınması elde edilmesi amacıyla bypass gereken ekstra ve hücre içi engellerin bir dizi işlem bulunmaktadır. Ek engeller, hızlı temizleme ve teslim malzemeler 7,8 kısa süreli içerir. Bu sorunları aşmak için bir strateji, in vivo gen aktarımı için "taşıyıcılar" veya "araçlar" gibi viral vektörler kullanmaktır. Virüslerin doğal olarak gelişmiş iletim özellikleri hücre 7,9,10 söz konusu bir genin etkin bir dağıtımını sağlar. Viral vektörlerin çok sayıda türleri geliştirilmiş ve farelerde, farklı hücre tipleri ve organların in vivo gen manipülasyonu esnek olanak edilmiştir.

En yaygın olarak kullanılan viral sistemler retrovirüs, lentivirüs, adenovirüs ve adeno-ilişkili virüs (AAV) dahildir 12-14 transdüksiyona genlerin yaşam boyu ifadesi için potansiyel sağlamaktadır mitotik bölünmesi sırasında istikrarlı bir şekilde konukçu hücre genomuna genetik malzemenin neden olabilir. Bununla birlikte, retrovirüsler, çok çeşitli, sadece bölünen hücreleri enfekte eder ve bölünmeyen hücreleri onların etkinliği 15 derece düşüktür. Bu gen aktarımı için bunların kullanımını sınırlar. Lentivirüs Retroviridae ailesinin bir cinsidir. Diğer retrovirüsler arasında farklı, lentivirüs, her iki bölme ve bölünmeyen hücreleri enfekte edebilir ve yaygın olarak post-mitotik ve yüksek farklılaşmış hücrelerin 16 gen transferi için kullanılmıştır. Lentivirüs yaşam döngüsü, konakçı genomuna vektör DNA'nın entegrasyonu içermektedir. Bu nedenle, lentivirüs aracılığıyla gen teslimi transduse genetik elementlerin 16-18 kararlı ve uzun süreli ifadesini sağlar. Ancak, bu özellik bir çift e temsil edebilirVektör DNA 'nın entegrasyonu girmeyle mutagenez neden olabileceğinden, bu virüslerin kullanımı dged kılıcı gen ekspresyonunu değiştirmek için ve ev sahibi hücrelerde artefakt etkilere neden olabilir. Adenovirüs başka yaygın olarak kullanılan gen aktarım sistemidir. Retrovirüsler ve lentivirüsler farklı olarak, Adenovirüsler, entegre olmayan ve konakçı hücreler 8,10,11,19 genomik bütünlüğü ile karışmaz. Buna ek olarak, Adenovirüsler, bir çok hücre tipinde içine DNA transfekte olabilir ve enfeksiyon aktif hücre bölünmesi 19 bağlı değildir. Viral vektörler yeteneği 19,20 çoğaltılması zorunda adenovirüslerin başka önemli özelliği, vektör arınma kolaylığıdır. Bununla birlikte, bu sistemin en önemli uyarı adenovirüslerin, özellikle gen tedavisi çalışmalarında, birçok araştırmalarda kullanımını kısıtlayan, hedef hücrelerin ve organlar 19 güçlü bir bağışıklık tepkilerini tetikler olabilir.

Bu farklı tip ile karşılaştırıldığındaViral vektörlerin s, rekombinant adeno-bağlantılı virüs (AAV) ideal bir gen iletim sisteminin 21,22 olduğu görülmektedir. Minimal immünojenite ve patojenitesini 23,24 sergiler. Buna ek olarak, rAAV bölünmesi ve bölünmeyen hücreleri hem de dahil olmak üzere hücre tiplerinin geniş bir yelpazede enfekte eder. Çoğu durumda, rAAV ana genomlarına entegre değildir; Bu nedenle, hedef hücrelerde arzu genetik ya da genomik değişiklik riski düşüktür 22'dir.

Son zamanlarda, rAAV sistemleri başarıyla fare kalp kası 23,25-29, DNA kodlayan proteinlerin miRNA'lar, shRNAs ve CRISPR-gRNAs in vivo verilmesi için kullanılmaktadır. Bu metodoloji kardiyovasküler araştırma alanında temel araştırmalar ve gen tedavisi çalışmaları kolaylaştırmıştır. Burada detaylı bir işlemi etkin bir şekilde tarif edilmiştir aşın veya fare kalplerinde ilgi genleri demonte rAAV9 vektörleri üretir. Protokol, basit ve etkili bir yöntem temin etmektedirfare deneysel modellerde kalp gen ifadesi manipüle.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tüm açıklanan adımlar Biyogüvenlik Komitesi ve Boston Çocuk Hastanesi Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından onaylanan protokoller altında yapıldı. Boston Çocuk Hastanesi düzenlenmiş aydınlık / karanlık döngüsü ve iklim kontrolü ile patojen içermeyen fare olanakları bulunmaktadır. Veterinerlik ve hayvan bakım personeli değişim kafesleri farelerin sağlığını sağlamak ve. tesisler AAALAC belgeli ve aktif Hayvan Refahı Güvencesi sertifikası (AAALAC Akreditasyon 1992/02/24 Hayvan Refahı Güvencesi numarası üzerinde Verilen.: A3303-01) var. Fareler, bir basınçlı gaz kaynağı teslim CO2 ile ötenazi uygulandı. Doku örnekleri durdurduğunu hayvanların kalp hızı, hareketi ve nefes onayladıktan sonra toplandı. Yenidoğan kemirgenler 2 ötenazi CO dayanıklı ve keskin bir makas kullanarak kafaları kesilmek suretiyle kurban edilmiştir. Bu yöntemler Amerikan Veteriner Medica Ötanazi Paneli tavsiyeleri ile uyumludurl Derneği.

Plazmid omurgasına bir cDNA veya shRNA ekspresyon kaseti klonlanmasıyla rAAV9 Yapılar 1. Üretim

Not: rAAV9 plazmid, gen aşırı ekspresyonu için kullanılan ters çevrilmiş terminal tekrarlarıdır AAV2 (ITRler), ihtiva eden tavuk TNNT2 liman için modifiye edilmiştir kalıt gen 25,26,29 ve kardiyomiyosit özel dışavurumunu sağlayan yükseltici (rAAV9.cTNT). Benzersiz Nhel ve KpnI sahalarına promotörün aşağı plazmid içine edilmiştir. Ilgi genleri kodlayan cDNA fragmanları, her iki sınırlandırma bölgeleri 25,26,29 kullanılarak rAAV9 omurgasına klonlanabilir. Burada bir örnek olarak, fare kalplerinde, GFP geninin aşırı ifadesi için rAAV9 vektörü oluşturuldu. Elde edilen plazmid, iki ITR sitelerinin (Şekil 1) tarafından sınırlanan cTnT :: GFP kasetini içermektedir. rAAV9.U6 :: shRNA yapıları 25 demonte gen için kullanılmıştır. kullanarak Tasarım shRNAsOnline ShRNA tasarım sunucuları. rAAV9.U6 :: ShRNA tavlama ve U6 promotör barındıran sınırlama enzimi sindirilmiş rAAV9 vektörlere ShRNA dizileri DNA içeren oligos bağlanması, ya da uzun menzilli PCR ve intra-moleküler Gibson montaj tabanlı "kesintisiz" ya oluşturulabilir inşaat 30. Elde edilen plazmid, iki ITR sitelerinin (Şekil 2) tarafından sınırlanan U6-shRNA kaseti içermelidir. Burada bir örnek olarak, rAAV9.U6 :: shRNA vektörü Trbp mRNA (: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG Trbp shRNA sekansı) demonte inşa edilmiştir. Bir mücadele shRNA, bir negatif kontrol (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) olarak kullanılmıştır.

  1. rAAV9 plazmid omurgasına cDNA ya da shRNA sentezleme kaseti klonlama. Yetkili, E. Coli hücrelerine 25 içine DNA Dönüşümü.
    Not: rAAV9 DNA transformasyonu için kullanımı stbl2 ya stbl3 E. coli hücreleri, istenmeyen ITR rekombinasyonu azaltmak için.
  2. I almaktransforme edilen E. coli hücrelerinden Pozitif bir klon. Lilly-Barnett ortamı, 500 ml kültür yükseltmek ve bakteri hücreleri 25-30 arasında rAAV9 plazmid ekstrakte edin.
    NOT: Midi / Maxi DNA (> 100 ug) yüksek miktarda elde etmek için rAAV9 plazmid hazırlık. Daha önce tarif edildiği gibi virüsün üretimini önce, her zaman, sınır sindirimi ve agaroz jel elektroforezi ile AAV plasmidlerin sekansı bütünlüğünü analiz (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

rAAV9 plazmid ile HEK293 hücrelerinin transfeksiyonu 2.

  1. doğrusal polietilenimin (PEI) çözeltisi 1 ug / ul hazırlayın. Endotoksin içermeyen dH 70-80 ° C'ye kadar ısıtılmış olan 2 O PEI toz eritilir. Oda sıcaklığına kadar soğutulması, 1 M HCI ile pH 7.0'a Çözeltinin nötralize edilmesi. Filtre sterilize (0.22 mikron) çözümüdür. 1 mcg / ml PEI stok solüsyonu (1.400 ul / tüp) alikotu ve solut saklamak-20 ° C'de iyonu.
  2. % 10 fetal sığır serumu (FBS) ve% 1 penisilin / streptomisin içeren Dulbecco Modifiye Eagle Ortamı (DMEM) içinde kültür HEK293 hücreleri. Kültür 5 ±% 0.5 karbon dioksit ile 37 ° C kuluçka makinesi içinde hücreleri (CO2).
  3. 2 seyreltme: 0. günde, on 150 mm'lik tabaklar içerisinde bir 1 bölme>% 90 konfluent hücreler tarafından transfeksiyon önce 18-20 saat HEK293 hücreleri plaka.
    Not: 1. günde, hücreler,% 90 izdiham ulaşmalıdır.
  4. Gün 1 'de, rAAV9 plasmid (ör rAAV9.cTNT :: GFP veya rAAV6.U6 :: shRNA oluşturur), Ad-yardımcı plazmit ve PEI 25,26,29 kullanarak AAV Rep / Kapak plazmidi ile transfekte edilmiş HEK293 hücreleri.
    1. % 90 izdiham hücre 10 yemekler için, 50-ml santrifüj tüpü içinde Ad-yardımcı plazmit 70 AAV Rep / Cap plazmidi ug rAAV9 plazmid PF 70 ug ve 200 ug karıştırın.
    2. Hücreler daha az konfluent iseniz, orantılı DNA miktarını ayarlamak. Hücreler% 75 konfluent altındadır Örneğin, azaltmakorantılı DNA miktarı (adım 2.4.1 gösterilen miktarın 75/90): 70 x 75/90 = AAV-Rep / Cap plazmid 58.3 mikrogram, rAAV9 plazmid x 75/90 = 58.3 mikrogram 70 ve 200 x mix 50 ml'lik bir santrifüj tüpü içinde Reklam-yardımcı plazmidin 75/90 = 166.7 ug.
    3. 50 ml'lik bir tüpe (FBS'siz) RT DMEM 49 ml ilave edilir ve iyice karıştırılır.
    4. PEI yapmak için PEI solüsyonu 1.360 ul ekleyin: DNA oranının (h / a) 4 olması: 1 arasındadır. İyice karıştırın. 30 dakika - 15, oda sıcaklığında inkübe edilir.
    5. (On 150 mm'lik tabaklar karışımın 50 mi), her 150 mm tabak için adım 2.4.4 hazırlanan karışım, 5 ml.
  5. Kültür 60-72 saat 5 ±% 0.5 CO2 ile 37 ° C kuluçka makinesi içinde hücreleri.

3. Hasat transfekte HEK293 hücreleri ve rAAV9 Vektörler saflaştırılması

  1. Hücreler, transfeksiyondan sonra, 60-72 saat hasat edilir. Çıkarmak ve yukarı pipetleme ve kültür ortamı ile aşağı yemekleri hücreleri askıya. steril tüm hücre süspansiyonları aktarın50 ml tüpler.
  2. 5 dakika boyunca 500 xg'de hücreleri Santrifüj. Her bir tüp içinde 5 ml PBS ile hücre pelletini ve bir 50 ml tüp içine tüm hücre süspansiyonları birleştirir.
  3. 5 dakika boyunca 500 xg'de hücreleri Santrifüj. süpernatant atın. Bu adımda, -80 ° C de hücre pelletini depolamak ya da hemen adımda 3,4-3,15 tarif edildiği gibi, pelet AAV saflaştırılması.
  4. 150 mM NaCl ve 20 mM Tris-HCl, pH 8.0: lizis tamponu hazırlayın. Filtre sterilize (0.22 uM). 4 ° C'de tampon saklayın.
  5. liziz tamponu 10 ml pelletini.
  6. daha sonra bunun çözülme 37 ° C'de, 80 ° C'de ya da kuru buz / etanol banyosu içinde lizat dondurun. 1 dakika vorteksleyin. Freeze ve lizat 3 kez Çözülme.
  7. Çözülmüş lizat MgCI2 solüsyonu (1 mm lizatında MgCl2 nihai konsantrasyon olun). 250 U / ml bir son konsantrasyona kadar nükleaz ekleyin. DNA / Protein AGGR çözünmesi için 15 dakika boyunca 37 ° C'de inkübe edinegation.
    NOT: DNA / protein agregasyonu, nükleaz veya endonükleaz tedaviden sonra çözülmüş olsun yoksa Dounce Lizatlar 20 kez homojenize.
  8. 4 ° C'de 20 dakika boyunca 4,800 x g'de santrifüjleyin. süpernatant toplayın.
  9. Bu arada, iyodiksanol gradyan çözeltisi hazırlayın:
    1. 10x 5 ml PBS, 1 M MgCl2, 0.05 mi, 1 M KCI, 0.125 mi, 5 M NaCI, 10 ml ve gradyan ortam ofdensity 12,5 ml karıştırma gradyan çözeltisi% 17 hazırlayın. H2O ile 50 ml toplam hacmini ayarlamak
    2. 10x 5 ml PBS, 1 M MgCl2, 0.05 mi, 1 M KCI, 0.125 mi, yoğunluk gradyanlı ortam 20 ml ve% 0.5, 0.2 ml (a / h) Fenol Kırmızısı karıştırılarak% 25 çözelti hazırlayın. H2O ile 50 ml toplam hacmini ayarlamak
    3. 10x 5 ml PBS, 0.05, 1 M MgCl2 mL, 1 M KCI, 0.125 mi, ve yoğunluk dereceli ortamının 33.3 mi karıştırılarak% 40 çözelti hazırlayın. kullanılarak 50 ml toplam hacmini ayarlamakH2O
    4. Karıştırılarak% 60 çözelti hazırlayın 0.05 ml 1 M MgCl2, 1 M KCI, 0.125 ml, yoğunluk gradyanlı ortam, 50 ml ve 0.1 ml% 0.5 (ağırlık / hacim) Fenol Kırmızısı.
  10. Bir enjektör ile, alttan başlayarak,% 60 5% 17 mi,% 25, ​​5 ml,% 40, 5 ml ve 5 ml için polipropilen tüp içine iyodiksanol gradyan çözeltisi yükleyin. gradyanın tepesinde Aşama 3,8 (14-16 mi) içinde elde edilen tüm lizat yükleyin. alttan üste doğru listelenmiş gradyan,% 60,% 40,% 25,% 17, ve lizat tabakasıdır. lizis tamponu ile tüp doldurun ve mantar ile örtün.
  11. 16 ° C'de 90 dakika boyunca 185,000 x g'de santrifüjleyin.
  12. bir şırınga ile viral kısmını (% 40 katman) Hasat. sadece% 40 katman aspire,% 40 ve% 60 fraksiyonları arasındaki kesişme içine iğne (21 gauge) yerleştirin.
    NOT:% 25 tabakasının HERHANGİ aspirasyon kaçının.
  13. Sterilize polioksietilen-polyoxypro viral kısmını karıştırın15 ml'lik bir toplam hacme kadar: pylene blok kopolimeri PBS solüsyonu (10,000 PBS içinde seyreltilmiş,% 10 polioksietilen-polioksipropilen blok kopolimeri hazır 1). Filtre tüp (cut-off MW = 100 kD) içine karışımı yerleştirin. 4 ° C'de 30 dakika boyunca 2,000 x g'de santrifüjleyin.
  14. altta çözüm atın. 15 ml'lik toplam hacme kadar polioksietilen-polioksipropilen blok kopolimeri, PBS çözeltisi ile filtre tüp doldurun. 4 ° C'de 20 dakika boyunca 2,000 x g'de santrifüjleyin. Bu adımı iki kez daha tekrarlayın. saflaştırılmış rAAV9 virüsü (filtresinin üzerine fraksiyonu) toplayın.
  15. 1.7 ml tüpler filtre tüpünde saflaştırılmıştır rAAV9 aktarın. Saflaştırılmış rAAV9 bölüm (100 - AAV hacmi ve titre bağlı olarak 400 ul / tüp), ve -80 ° C 'de virüs saklayın.
    NOT: tekrarlanan donma-çözülür kaçının.

rAAV9 titresi 4. Ölçüm

  1. Standart DNA örnekleri hazırlayın.
    1. özel ve etkili bir PCR TasarımrAAV9 vektörleri için primerler ve PCR durumunu optimize eder.
      Not: ": TCGGGATAAAAGCAGTCTGG;: İleri TCGGACGGAGATACGTGAGT" Bu çalışmada kullanılan primerlerdir. PCR reaksiyonu, aşağıdaki koşullar ile yapıldı: Initial doğasını değiştiren 3 dakika boyunca 95 ° C'de; 20 saniye, 15 saniye, 60 ° C'de ve 10 saniye boyunca 72 ° C'de, 95 ° C'de 35 döngü; ve 10 dakika boyunca 72 ° C'de son uzatma. RAAV9 vektöründe ilave sekansı PCR 31 özgünlüğünü ve verimliliğini etkileyebilir Ancak, optimize edilmiş primerleri ve PCR koşulları, plazmid-özeldir.
    2. Adım 4.1.1 gösterilen şartlara PCR reaksiyonu gerçekleştirin. Bir jel özütleme kiti ile PCR ürünü saflaştırılır.
    3. Bir spektrofotometre kullanılarak, saflaştırılmış DNA konsantrasyonu ölçümü. PCR ürününün molekül ağırlığı / uzunluğuna göre DNA moleküler sayıda konsantrasyonu hesaplanır.
      1. aşağıdaki denklem kullanılarak moleküler konsantrasyonu hesaplayın: moMolecular konsantrasyonu (DNA molekülleri veya bunların fragmanları / ml) = 6.23 x 10 23 mol-1 X Kon. x 10 -6 / MW. Not: (6.23 x 10 23 mol-1 Avagadro sayısı Kon .: DNA konsantrasyonu ng / ml; MW .: g / mol molekül ağırlığı). PCR ürününün elde konsantrasyonu, 100 ug / ml ve uzunluğu 200 bp Örneğin, iki-şeritli DNA molekül ağırlığı, her bir nükleotitden 2 x 200 x 310 = 124,000 (ortalama molekül ağırlığıdır tek-şeritli DNA, yaklaşık 310 g / mol) 'dir. Moleküler konsantrasyonu (DNA molekülleri / mi) 6.23 x 10 23 mol-1 X 100 ug / ml x 10 6 / 124.000 g / mol = 5.18 x 10 14 DNA molekülleri / ml =.
      2. 10 ila 13 molekül / ml, 10 ila 12 molekül / ml, 10 11 molekülleri / ml, 10 10 molekülleri / ml, 10 9 molekülleri / ml, 10 konsantrasyonları ile, DNA fragmanının bir seyreltme serisi gerçekleştirmek ve standart örnekleri hazırlamak 7 molekülleri / ml olmuştur. (Adım 4.6, qPCR) kantitatif PCR için her bir standart numune için solüsyonun 1 ul kullanın.
  2. 10x DNAz tamponu, 5 ul, DNAz 1 ul (10,000 U / ml) ve GKD 2 O. 39 ul toplam hacim 50 ul olmalıdır saflaştınlmış rAAV9 çözeltisi 5 ul karıştırın.
  3. Kalıntı paketlenmemiş plazmid DNA çıkarmak için 30 dakika için 37 ° C 'de şişe inkübe edin.
  4. 10 dakika boyunca 95 ° C 'de DNAz inaktive. , Çözelti önce soğumaya H2O 44 ul 10x DNAz tampon 5 ul proteinaz K ile stokunun 1 ul (10 mg / ml) ekleyin.
  5. 2 saat boyunca 50 ° C'da, çözelti inkübe edin. reaksiyonu durdurun ve 10 dakika boyunca 95 ° C 'de Proteinaz K etkisiz hale getirirler.
  6. kantitatif PCR (qPCR) deneyi için örnek 1 ul kullanın. titresi hesaplayın.
    1. Numuneler fr kullanarak adım 4.1.1 tasarlanmış primerler ile kantitatif PCR (qPCR) çalıştırınom adımı 4.1.4 (standart numune) ve aşama 4.5 ila (örnekler, bundan).
      1. Her bir reaksiyon için, (Taq polimeraz, dNTP karışımı, tampon, MgCl2 ve yeşil boya ihtiva eder) 2x Yeşil ana karışımı 10 ul ileri primer (5 uM), 0.5 ul ters primeri (5 uM), 0.5 ul karıştırın H2O 8 ul ve örnek 1 ul ölçülecek. aşağıdaki koşullarda qPCR gerçekleştirmek: 2 dakika ve 10 dakika boyunca 95 ° C, 50 ° C 'de numuneler tutun; 15 sn için ve 1 dakika boyunca 60 ° C 'de 95 ° C' de 40 döngü gerçekleştirmek; erime aşaması için, 30 saniye ve 15 saniye süreyle 60 ° C, 95 ° C 'de numuneler inkübe edin. Standart numuneler (Şekil 3) C T numaraları dayalı standart eğri oluşturmak.
    2. standart bir eğriye karşı AAV numunenin molekül konsantrasyon / titresi hesaplanır. rAAV9 tek iplikli DNA genomu, bu nedenle molekül konsantrasyonundan 2 kat daha yüksek olacakHesaplanan değer (2x gücü (10, y), Şekil 3B). Buna ek olarak, arıtılmış, rAAV9 titresi bağlı DNase ve proteinaz K reaksiyonlarda virüsü (100 ul toplam 5 ul) 1:20 seyreltme hesaplama elde edilen daha büyük bir değere 20 kat olacaktır.

Heart Yenidoğan Farelerde ve Gen İfadesi Tahliller 5. rAAV9 Enjeksiyon

  1. polioksietilen-polioksipropilen blok kopolimeri, PBS çözeltisi içinde rAAV9 çalışma çözümleri hazırlayın. 1-7 x 10 12 parçacıklar / ml titreleri ile virüs stok yapmak.
    NOT: deri altı enjeksiyonu ile her doğum sonrası gün 0.5-1.5 fare içine rAAV9 çözeltisi 50-70 ul sunun. etkin gen ifadesinin veya demonte elde etmek için, enjekte edilen AAV miktarını optimize etmek için her bir çalışma için bir pilot testi gerçekleştirmek için tavsiye edilir. önyargı en aza indirmek için her çalışma için rAAV9.cTNT :: Luc veya rAAV9.U6 :: karıştıran kontrolleri aynı miktarda kullanın.
    NOT: 1-1.5 kullanılanx 10 11 parçacıklar / yavru aşırı ekspresyonunun ve 2.5 - doğum sonrası gün 0.5-1.5 mi ce) içinde demonte için 5 x 10 11 parçacıklar / yavru.
  2. Deri altı enjeksiyonu ile P0.5-P2.5 de rAAV9 neonatal fareler davranın.
    1. rAAV9 çözümü ile bir 29G1 / 2, 0.33 x 12.7 mm insülin şırınga önceden doldurun. Hava kabarcıklarını çıkarmak için dikkatli olun.
    2. başparmak ve işaret parmağı ile bir yandan cryo anestezi yavru tutun. Enjeksiyondan önce, steril durumunu korumak için% 70 izopropil alkol ile doymuş bir çubukla sopayla yavru arka cilt tokatlamak. 5 ila 10 ° 'lik bir açı ile hayvan ön-dorsal subkütisine bir şırınga iğnesi yerleştirin. insülin şırınga kullanarak rAAV9 çözeltisi 50-70 ul enjekte edilir.
      NOT: rAAV9 da intraperitoneal veya intravenöz enjeksiyon 26,27 aracılığıyla fare teslim edilebilir. kalp teslim genlerin etkin ekspresyonu elde edilebilir. Bununla birlikte, intraperitonal enjekteİyon bazen karaciğer sızan ifade neden olabilir. enjeksiyonundan sonra, yavruların durumu her gün izlendi.
  3. Kalp gen ekspresyonunun seviyesi qPCR, immünofloresan veya western blot ile izlenebilir (Örnek sonuçlar Şekil 4'te gösterilmiştir ve 5) 25,26.
    Not: Fareler, sıkıştırılmış gaz kaynağından teslim CO2 ile ötenazi uygulandı. Doku örnekleri hayvanların kalp atış hızı, hareket ve solunum sona olduğu doğrulandıktan sonra toplanmıştır. Yenidoğan kemirgenler 2 ötenazi CO dayanıklı ve keskin bir makas kullanarak kafaları kesilmek suretiyle kurban edilmiştir. yöntem Amerikan Veteriner Hekimleri Birliği Ötanazi Paneli önerileri ile tutarlıdır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

RAAV9.cTNT :: GFP veya rAAV9.U6 :: shRNA plasmidlerin rAAV9 yapımı için strateji Şekil sırasıyla 1 ve 2, gösterilmiştir. Örnek olarak, rAAV9 vektörü, fare kalplerinde GFP geninin aşın ifade etmek üzere oluşturuldu. Elde edilen plazmid, iki ITR sitelerinin (Şekil 1) tarafından sınırlanan cTnT :: GFP kasetini içermektedir. RAAV9.U6 :: ShRNA vektör Trbp mRNA demonte inşa edilmiştir (Şekil 2)

rAAV9 titrasyon için standart eğri doğrusal regresyon ile qPCR verileri elde edilmiştir. Manipüle edilmiş değişken y her bir standart numunenin DNA moleküler konsantrasyonunun Log 10 değerini temsil eder ve karşılık gelen x değişkeni C T değerini temsil eder. Giriş 10 (konsantrasyon) değerleri (Y) ve C t sayıları (X) güzel lineer ilişki sergiler (R2 = 0,9971) ve denklem y = -0.2832x + 14,616 (Şekil 3A) ile uyum. RAAV9 örneklerinin Titreler doğrusal denklem (Şekil 3B) göre hesaplanmıştır. Protokolü (aşama 4.6.2 ve şekil 3B) de tarif edilen yönteme, rAAV9 vektörler yüksek titre (50-200 uL,> 6 x 10 ila 13 parçacık / mi) ile Örnek çalışmada elde edildi.

RAAV9.cTNT vektörlerin verimliliğini ve doku özgüllüğünün izlemek için, P0.5 yavrular aynı miktarda rAAV9.cTNT :: Lusiferaz (AAV-Luc) (1 x 10 11 parçacık / yavru) ya da rAAV9.cTNT :: GFP ile muamele edildi deri altından enjeksiyon ile (AAV-GFP). İki hafta sonra GFP sinyali farelerde çeşitli dokularda izlenmiştir. GFP Sağlam ifade kalbinde tespit ama değildi diğer organlara (Şekil 4, n> 3) 'de. Bu nedenle, etkin ve kalp-özgü gen sentezleme rAAV9.cTNT vektörü elde edilmiştir.

"fo: keep-together.within Sayfa =" jove_content 1 ">, yok etme etkisi ve rAAV9.U6 vektörlerinin doku özgüllüğünü izlemek için, P0.5 fareler aynı miktarda rAAV9 (3 x 10 11 parçacık / yavru) ile muamele edildi deri altından enjeksiyon ile .U6 :: karıştırmak (AAV-Sinyal Değiştirme) veya rAAV9.U6 :: Trbp shRNA (AAV-shTrbp). iki enjeksiyondan sonra hafta qPCR (Şekil 5 ile gözlenmiş çeşitli dokularında Trbp ekspresyonu, n = 3 Trbp arasında). merkezinde Trbp mRNA seviyesi esas rAAV9.U6 :: shTrbp (% 68 ile aşağı doğru düzenleme, p = 0,0004452) azaltılmıştır. aşağı düzenleme de rAAV9.U6 karaciğer dokusunda tespit edilmiştir :: shTrbp ile muamele fareler. Bununla birlikte, değiştirme çok daha düşüktür.

Şekil 1
Şekil 1: Stratejiler rAAV9.cTNT :: GFP Plasmitlerinin Construct için. (A) cTnT :: GFP kaset düzeni. (B TNNT2 promotörü (rAAV9.cTNT) liman için modifiye edilmiştir. GFP açık okuma çerçevesi rAAV9.cTNT :: GFP plazmidi üretmek için kısıtlama alanı aracılı bağlanması ile rAAV9.cTNT vektörüne klonlanmıştır. (B) rAAV9.cTNT :: GFP plazmid Gibson meclis tarafından inşa edilebilir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Şekil 2: Stratejiler rAAV9.U6 :: shRNA Plasmitlerinin Construct için. (A) U6 şeması :: ShRNA kaset gösterilmektedir. shRNA İfade U6 organizatörü (Mavi) ile tahrik edilir. (B) rAAV9-U6-shRNA kasetleri tavlama tarafından oluşturulan ve bağlanması DNA oligos içerebilir edilebilirU6 promotör barındıran sınır enzimi sindirilmiş rAAV9 vektörlere ING shRNA dizileri. (C) rAAV9.U6 :: ShRNA kasetleri uzun menzilli PCR ve intra-moleküler Gibson montaj tabanlı "kesintisiz" inşaat tarafından oluşturulmuş olabilir. shRNA 5 'kol, loop, ve 3' kol sırasıyla yeşil, turuncu gösterilen ve kırmızı edilir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3: rAAV9 titresinin hesaplanması. (A) rAAV9 titrasyon için standart eğri qPCR verileri kullanılarak lineer saldırganlık ile oluşturulmuştur. Manipüle edilmiş değişken y her bir standart numunenin DNA moleküler konsantrasyonunun Log 10 değerini ve ilgili değişken x temsilC T değerini temsil eder. RAAV9 örnekleri (B) Titreler, standart eğrinin lineer denkleme göre hesaplanır. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4: Fare Dokularında rAAV9.cTNT :: GFP salgılama modeli. P0.5 yavrular deri altından enjeksiyon ile rAAV9.cTNT :: Lusiferaz (AAV-Luc, negatif kontrol) ya da rAAV9.cTNT :: GFP (AAV-GFP) aynı miktarda (1 x 10 11 parçacık / yavru) ile muamele edildi. İki hafta sonra, enjeksiyon, doku örnekleri toplandı. GFP ekspresyonu, floresan diseksiyon kapsamında izlenmiştir. Hem parlak alan ve floresan görüntüleri sunulmuştur. Deneyler (n> 3) en fazla 3 kez tekrarlandı edilmiştir.Ölçek çubuğu = 2,0 mm. SKM, iskelet kası. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 5,
Şekil 5: AAV-shRNA ile demonte Gen İfadesi. P0.5 farenin deri altına enjeksiyon ile rAAV9.U6 :: karıştırmak (AAV-Sinyal Değiştirme) veya rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) aynı miktarda (3 x 10 11 parçacık / yavru) ile muamele edildi. İki hafta enjeksiyonundan sonra, çeşitli dokularda Trbp mRNA seviyeleri qPCR ile gözlenmiş (n = 3). Veri Ortalama ± SEM olarak sunulmaktadır. cut-off P değerinin 0.05 olduğunu. NS, p> 0.05, anlamlı değil. ** P <0.01. SKM, iskelet kası. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Plazmid, inşaat sırasında istenmeyen ITR rekombinasyonu azaltmak için çok önemlidir. virüs oluşturmadan önce, bir zaman kısıtlaması sindirim ve agaroz jel elektroforezi kullanılarak AAV plazmid ITR bütünlüğünü izlemek gerekir. % 100 sağlam plazmidler elde etmek mümkün değildir, ancak rekombinasyon oranı mümkün olduğunca en aza indirilmelidir. Az% 20 başarı rAAV9 paket için kabul edilebilir. Dikkat çekici bir alt sallayarak hızla (180-200 rpm) ile düşük sıcaklıkta (30 ° C) bakterileri kültüre ITR rekombinasyon şansını azaltabilir.

HEK293 hücreleri, başarılı transfeksiyon ve rAAV9 ambalaj sağlıklı olmasını sağlamak için gereklidir. "Sağlıklı" hücreler genellikle yüksek proliferatif ve hızlı bir şekilde büyür. Ancak, hızlı çoğalması ve HEK293 hücrelerinin büyümesi mutlaka rAAV9 ambalaj yüksek verim garanti etmez. Nedenle, taze hücreler ile deneyler başlatmak için önemlidir. ODüşük geçit HEK293 hücrelerinin kullanılması önerilir rAAV9 ambalaj (<10 pasajlar, hücreler her 2-3 günde edilmiştir). Dikkat çekici bir şekilde, rAAV diğer serotipler farklı prosedürler 32 kullanılarak saflaştırılabilir gerekebilir.

Araştırmacı rAAV9 plazmid nesil esneklik verilir. Her iki sınırlama sitesi aracılı bağlanma ve Gibson tertibatı 30 kullanılabilir. RAAV9.U6 :: ShRNA yapımı için, içi moleküler Gibson montaj tabanlı strateji etkili bir yöntemdir (Şekil 1 ve 2). Çoklu AAV-shRNA plazmid ya da AAV-shRNAs hızlı yapılabilir havuzlanır. rAAV9 kullanarak genlerin aşırı ifade etmek için, eklenen cDNA sekansları için büyüklük sınırlaması yoktur bulunmaktadır. Genel olarak, ITR arasındaki boyut parçası daha küçük 5 kb 33 olması gerekir. Intein katalizli bir protein birleştirme rAAV9 vektörleri 34 ambalaj boyut sınırını aşmak için kullanılabilir.

Diğer viral sistemiretrovirüs, lentivirüs ve adenovirüs dahil ler, aynı zamanda gelişmiş ve esnek gen manipülasyonu etkinleştirmek edilmiştir. minimum yüksek verim, yüksek özgünlüğü, düşük genomik entegrasyon oranı: viral vektörlerin, bu farklı tipleri ile karşılaştırıldığında rAAV belirli faydaları vardır immünojenisite ve minimal patojenite. Böylece, rAAV tabanlı genom mühendisliği in vivo gen manipülasyonu için ideal bir araç olarak ortaya çıkmaktadır.

Daha önce yapılan çalışmalar rAAV9 sistemi, in vivo olarak teslim genlerin etkin ekspresyonunu sağlayan göstermiştir. CTnT (tavuk TnnT2) promoteri ile kalp-özgü gen ekspresyonu (Şekil 4) 25,26 elde edildi. U6 promotör fare dokuları rAAV9.U6 hedef mRNA (Trbp) içindeki bir en çarpıcı inhibisyonu her yerde görülen aktif olmasına rağmen :: shRNA diğer organlarda (Şekil 5) kalp gözlenmiştir fakat değildi. Karaciğer en yaygın organı farklı serotiplerin transdüse edilirrAAV 35,36. Bununla birlikte, karaciğer, yok etme etkisi (mRNA düzeyinde% 36 azalma), kalp (mRNA düzeyinde% 68 azalma) göre çok daha düşüktür. Bu karaciğerde daha yüksek bir viral genomun varlığına rağmen rAAV9 ile shRNA sistemik dağıtım merkezinde 35 demonte daha verimli gen içerir, bu gösteren önceki çalışma ile tutarlıdır. Hepatositler kardiyomiyositlerde daha proliferatif ve daha aktif karaciğer dokusunda önemli bir vektör genom seyreltme ile sonuçlanan yeni doğan yaşlarda rAAV9 uygulama, sonra hücre bölünmesi geçirmekte mümkündür. Bununla birlikte, bu rAAV9 serotip daha verimli bir şekilde, diğer hücre tipleri ile karşılaştırıldığında kardiyomiyositlerde transdüksiyonu olabileceğini düşündürmektedir. Lovric ve arkadaşları tarafından gösterildiği gibi., Farklılaşmış miyositlerde, DNA hasar cevabı MRN kompleksi proteinleri bastırıldı. MRN kompleks proteinleri AAV genomları bağlanan ve transkripsiyon susturma yoluyla AAV transdüksiyonunu inhibe eder. Bu nedenle, herAAV iletimine missivity merkezinde gen manipülasyonu için çok uygundur, diğer viral vektörler, karşılaştırarak, rAAV9 sistemi yapmak, kardiyomiyositlerde 36 terminal farklılaşma indüklenebilir. Ayrıca başka organların (örneğin, karaciğer), bir de kalp 29 içindeki ilgi genlerinin bastırmak için kardiyak spesifik cTnT promotörü tahrikli miR-30a-tabanlı shmir kullanabilir istenmeyen yok etme etkisini en aza indirmek için. Bu yazının kardiyovasküler araştırmalarda rAAV9 teknolojisi üzerine sermaye için özel teknikler ile okuyucu sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics