Preparação de rAAV9 para superexpressão ou Knockdown Genes em mouse Corações

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Controlando a expressão ou actividade de genes específicos por meio da entrega de materiais genéticos miocárdica em modelos de murino permite a investigação de funções de genes. O seu potencial terapêutico no coração pode também ser determinada. Existem abordagens limitadas para a intervenção molecular in vivo, no coração de rato. Vírus adeno-associado (rAAV) engenharia de genoma baseada recombinante tem sido utilizada como uma ferramenta essencial para a manipulação genética cardíaca in vivo. As vantagens específicas de esta tecnologia incluem alta eficiência, de alta especificidade, baixa taxa de integração genómica, mínimo imunogenicidade, patogenicidade e mínima. Aqui, é descrito um procedimento detalhado para a construção, pacote, e purificar os vetores rAAV9. A injecção subcutânea de rAAV9 em crias recém-nascidos resulta em expressão robusta ou knockdown eficiente do gene (s) de interesse no coração de rato, mas não no fígado e outros tecidos. Usando o cardíaca-específiObteve-se C TNNT2 promotor, elevada expressão do gene GFP no coração. Além disso, sequências alvo de ARNm foi inibida no coração quando um rAAV9-U6-shRNA foi utilizado. Trabalhando conhecimento da tecnologia rAAV9 pode ser útil para as investigações cardiovasculares.

Introduction

Controlando a expressão ou actividade de genes específicos em vários sistemas biológicos tornou-se uma estratégia terapêutica valiosa no estudo da função do gene 1. Uma forma directa de alcançar este objectivo é para manipular sequências de nucleótidos e de gerar alelos mutantes. Apesar de fazer, alterações específicas precisos para o genoma de células vivas ainda é um demorado e práticas de trabalho intensivo, o desenvolvimento das poderosas ferramentas TALEN e CRISPR / Cas9 abriu uma nova era de edição genoma 2-5. Um método de laboratório mais rotina para manipulação genética tem-se centrado sobre a introdução de materiais genéticos (DNAs e RNAs contendo sequências codificantes ou siRNAs / shRNAs) nas células de expressar ou knockdown do gene (s) de interesse 1,6.

Em muitos casos, o principal ponto de estrangulamento para a manipulação de genes é a entrega de ADN, ARN, ou proteínas nas células. No que se refere a estudos in vitro, transfecti eficienteem sistemas foram estabelecidas em muitas linhas de células cultivadas. No entanto, no modelo de ratinho, em particular, na entrega de genes in vivo é mais difícil. Há uma série de barreiras extra e intracelulares que precisam ser contornado, de modo a conseguir a absorção celular eficiente dos reagentes exógenos. Obstáculos adicionais incluem a rápida depuração ea curta duração do 7,8 materiais entregues. Uma estratégia para contornar esses problemas é a utilização de vetores virais como "portadores" ou "veículos" para na entrega de genes in vivo. As propriedades de transdução naturalmente evoluídos de vírus permitir o fornecimento eficiente de um gene de interesse em células 7,9,10. Numerosos tipos de vectores virais têm sido desenvolvidos e permitir flexível na manipulação de genes in vivo em diferentes tipos de células e órgãos de ratinhos.

Os sistemas virais mais comumente usadas incluem retrovírus, lentivírus, adenovírus, e vírus adeno-associado (AAV) 12-14. No entanto, muitos tipos de retrovírus apenas para infectar células em divisão, e a sua eficácia nas células que não se dividem 15 é muito baixa. Isto limita a sua utilidade para a entrega de genes. Lentivírus é um gênero da família Retroviridae. Diferente de outros retrovírus, lentivírus pode infectar tanto células em divisão e que não se dividem e tem sido amplamente utilizado para a transferência de genes em pós-mitótico e células altamente diferenciadas 16. O ciclo de vida de lentivírus também envolve a integração do ADN do vector no genoma do hospedeiro. Assim, a entrega de genes, mediada Lentivírus permite a expressão estável e de longa duração dos elementos genéticos transduzidas 16-18. No entanto, esse recurso pode representar um duplo-eespada DGED na utilização destes vírus para manipular a expressão de genes, a integração do DNA vector pode levar a mutagénese de inserção nas células hospedeiras e podem causar efeitos artefatuais. O adenovírus é um outro sistema de entrega de genes amplamente utilizado. Ao contrário dos retrovírus e lentivírus, adenovírus são não integrado e não interfere com a integridade genómica de células hospedeiras 8,10,11,19. Além disso, adenovírus pode transfectar ADN em muitos tipos de células, e a infecção não é dependente de divisão celular activa 19. Outra característica importante de adenovírus é a facilidade de purificação do vector, como os vectores virais têm a capacidade de ser replicado 19,20. No entanto, a ressalva importante deste sistema é que a infecção com adenovírus pode provocar fortes respostas imunitárias em células e órgãos alvo 19, limitando o seu uso em muitas investigações, particularmente em estudos de terapia génica.

Comparado com estes diferentes tiposs de vectores virais, vírus recombinante adeno-associado (rAAV) parece ser o sistema de entrega de genes ideal 21,22. Ela exibe imunogenicidade mínima e patogenicidade 23,24. Além disso, de rAAV infecta uma ampla gama de tipos de células, incluindo ambas as células que não se dividem e divisória. Na maioria dos casos, rAAV não se integra nos genomas de acolhimento; Assim, o risco de alterações genéticas ou genómicas indesejáveis nas células alvo é baixa 22.

Recentemente, sistemas de rAAV foram usadas com êxito para a administração in vivo de ADN que codifica proteínas, miARNs, shRNAs, e CRISPR-gRNAs no músculo cardíaco do rato 23,25-29. Esta metodologia tem facilitado investigações fundamentais e estudos de terapia gênica no domínio da investigação cardiovascular. Aqui, o procedimento detalhado para gerar vectores rAAV9 que sobre-expressam de forma eficiente ou eliminação dos genes de interesse em corações de rato foi descrito. O protocolo proporciona um método simples e eficaz demanipular a expressão de genes cardíacos em modelos experimentais de murino.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os passos descritos foram realizados sob protocolos aprovados pela Comissão de Biossegurança e do Comité do Hospital Infantil de Boston Institucional animal Cuidado e Uso. Hospital Infantil de Boston tem instalações rato isentos de agentes patogénicos com luz ciclos regulamentados / escuras e controle do clima. mudanças de gaiolas veterinários e de cuidados com os animais e garantir a saúde dos ratos. As instalações são AAALAC certificada e têm Animal Welfare Assurance certificação ativa (AAALAC acreditação concedida em 1992/02/24 Animal Welfare Assurance número:. A3303-01). Os ratinhos foram sujeitos a eutanásia por CO 2 entregues a partir de uma fonte de gás comprimido. As amostras de tecidos foram coletadas após a confirmação de que a frequência cardíaca, o movimento ea respiração dos animais tinha cessado. Roedores neonatais são resistentes ao CO 2 a eutanásia e foram sacrificados por decapitação utilizando uma tesoura afiada. Estes métodos são consistentes com as recomendações do Painel sobre a eutanásia da American Medica Veterinárial Association.

1. Construções de Geração de rAAV9 por clonagem de um ADNc ou shRNA cassete de expressão no esqueleto de plasmídeo

NOTA: O plasmídeo rAAV9, contendo as repetições terminais invertidas (ITRs) de AAV2, usados ​​para a sobre-expressão do gene foi modificado para abrigar o TNNT2 galinha promotor (rAAV9.cTNT), que permite a expressão específica de cardiomiócitos de genes transduzidas 25,26,29. locais únicos Nhel e Kpnl foram introduzidos no plasmídeo, a jusante do promotor. Os fragmentos de ADNc que codificam os genes de interesse podem ser clonados no esqueleto rAAV9 usando estes dois locais de restrição 25,26,29. Aqui, como um exemplo, o vector rAAV9 por sobre-expressão do gene GFP no coração de ratinho foi gerado. O plasmídeo resultante contém a cassete de cTNT :: GFP flanqueado por duas ITR locais (Figura 1). construtos rAAV9.U6 :: shRNA foram usadas para o gene knockdown 25. Projeto shRNAs usandoonline de servidores de design shRNA. rAAV9.U6 :: shRNA pode ser gerado quer por hibridação e ligação de oligonucleótidos contendo sequências de ADN nos vectores de shRNA rAAV9 digerido com enzimas de restrição que albergam o promotor U6, ou por PCR de longo alcance e intra-molecular baseada em conjunto Gibson "sem costura" construção 30. O plasmídeo resultante contém a cassete deve U6-shRNA flanqueado por duas ITR locais (Figura 2). Aqui, como um exemplo, o vector rAAV9.U6 :: shRNA foi construído para knockdown de ARNm Trbp (sequência Trbp shRNA: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). Uma precipitação shRNA foi utilizado como um controlo negativo (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Clone da cassete de expressão de ADNc ou shRNA na espinha dorsal do plasmídeo rAAV9. Transformar o ADN em células de E. coli competentes 25.
    NOTA: Use as células STBL2 ou stbl3 E. coli para transformação DNA rAAV9 para minimizar recombinação ITR indesejada.
  2. Pegar oclone positivo a partir das células de E. coli transformadas. Amplificar a cultura em 500 ml de meio de Lilly-Barnett e extrair o plasmídeo rAAV9 a partir das células bacterianas 25-30.
    NOTA: Midi / Maxi prep do plasmídeo rAAV9 para se obter uma grande quantidade de ADN (> 100 mg). Antes de gerar o vírus, sempre analisar a integridade da sequência dos plasmídeos de AAV por digestão de restrição e electroforese em gel de agarose, como previamente descrito (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfecção de células HEK293 com rAAV9 plasmídeos

  1. Prepare 1 ug / uL de solução de polietilenimina linear (PEI). Dissolver o pó em PEI dH livre de endotoxina 2 O que foi aquecida a 70-80 ° C. O arrefecimento até à TA, neutralizar a solução a pH 7,0 com HCl 1M. Filtrar esterilizar (0,22 mM) a solução. Alíquota da solução de estoque / ul PEI 1 mg (1,400 mL / tubo) e armazenar o solutião a -20 ° C.
  2. células HEK293 Cultura em Dulbecco Modified Eagle Médium (DMEM) com 10% de Soro Fetal Bovino (FBS) e 1% de penicilina / estreptomicina. Cultura das células num banho a 37 ° C incubadora com dióxido de carbono a 5 ± 0,5% (CO 2).
  3. No dia 0, as células HEK293 placa em dez pratos de 150 mm 18-20 h antes da transfecção por divisão de> 90% de células confluentes em uma diluição de 1: 2.
    NOTA: No dia 1, as células devem chegar a 90% de confluência.
  4. No dia 1, transfectar células HEK293 com o plasmídeo rAAV9 (por exemplo, rAAV9.cTNT :: GFP ou rAAV6.U6 :: shRNA constrói), o plasmídeo Ad-Helper, e plasmídeo AAV-Rep / Cap usando PEI 25,26,29.
    1. Para 10 pratos de células em 90% de confluência, misturar 70 ug de plasmídeo de AAV-Rep / Cap, 70 ug de plasmídeo rAAV9 PF, e 200 ug de plasmídeo Ad-Helper em um tubo de centrífuga de 50 ml.
    2. Se as células estiverem confluentes menos, ajustar a quantidade de ADN proporcionalmente. Por exemplo, se as células estão 75% confluentes, reduzir oquantidade de DNA proporcionalmente (75/90 do montante inscrito na etapa 2.4.1): misturar 70 x 75/90 = 58,3 mg de AAV-Rep / Cap plasmídeo, 70 x 75/90 = 58,3 ug de plasmídeo rAAV9, e 200 x 75/90 = 166,7 ug de plasmídeo Ad-Helper em um tubo de centrífuga de 50 ml.
    3. Adicionar 49 ml de RT DMEM (sem FBS) para o tubo de 50 ml e misturar bem.
    4. Adicionar 1,360 ml de solução de PEI para fazer o PEI: ADN razão (v / w) ser de 4: 1. Misture bem. Incubar à temperatura ambiente durante 15 - 30 min.
    5. Adicionar 5 ml da mistura preparada no passo 2.4.4 a cada placa de 150 mm (50 ml de mistura para dez pratos de 150 mm).
  5. Cultura das células em uma incubadora a 37 ° C com 5 ± 0,5% de CO 2 durante 60-72 horas.

3. Colheita de Transfectados HEK293 células e purificação de rAAV9 Vectors

  1. Colher as células 60-72 horas após transfecção. Desalojar e suspender as células em placas por pipetagem para cima e para baixo com o meio de cultura. Transferir todas as suspensões de células a estériltubos de 50 ml.
  2. Centrifugar as células a 500 xg durante 5 min. Ressuspender o sedimento de células com 5 ml de PBS em cada tubo e combinar todas as suspensões de células em um tubo de 50 ml.
  3. Centrifugar as células a 500 xg durante 5 min. Descartar o sobrenadante. Neste passo, o sedimento celular armazenar a -80 ° C ou imediatamente purificar o AAV a partir do sedimento, como descrito nos passos 3.4-3.15.
  4. Preparar o tampão de lise: NaCl 150 mM e Tris-HCl 20 mM, pH 8,0. esterilizar filtro (0,22 mM). Armazenar o tampão a 4 ° C.
  5. Ressuspender o sedimento com 10 ml de tampão de lise.
  6. Congelar o lisado a -80 ° C ou no banho de gelo seco / etanol, em seguida, ele degelo a 37 ° C. Vortex durante 1 minuto. Congelamento e descongelamento, o lisado de 3 vezes.
  7. Adicionar solução de MgCl 2 ao lisado descongelado (que a concentração final de MgCl2 no lisado ser 1 mM). Adicionar a nuclease para uma concentração final de 250 U / ml. Incubar a 37 ° C durante 15 min para dissolver o aggr ADN / proteínasegation.
    NOTA: Se a agregação de DNA / proteína não se dissolveu após nuclease ou endonuclease tratamento, Dounce homogeneizar os lisados ​​20 vezes.
  8. Centrifugar a amostra a 4800 xg durante 20 min a 4 ° C. Recolhe-se o sobrenadante.
  9. Enquanto isso, prepare a solução gradiente Iodixanol:
    1. Prepara-se o 17% da solução gradiente por mistura de 5 ml de PBS 10x, 0,05 ml de 1 M de MgCl2, 0,125 ml de 1 M de KCl, 10 mL de NaCl 5 M, e 12,5 ml ofdensity meio de gradiente. Ajustar o volume total para 50 ml usando H 2 O.
    2. Preparar a solução de 25% por mistura de 5 ml de PBS 10x, 0,05 ml de 1 M de MgCl2, 0,125 ml de 1 M de KCl, 20 mL de meio de gradiente de densidade, e 0,2 ml de 0,5% (w / v) de vermelho de fenol. Ajustar o volume total para 50 ml usando H 2 O.
    3. Preparar a solução de 40% por mistura de 5 ml de PBS 10x, 0,05 ml de 1 M de MgCl2, 0,125 ml de 1 M de KCl, e 33,3 ml de meio de gradiente de densidade. Ajustar o volume total para 50 ml usandoH 2 O.
    4. Preparar a solução de 60% por mistura de 0,05 ml de 1 M de MgCl2, 0,125 ml de 1 M de KCl, 50 mL de meio de gradiente de densidade, e 0,1 ml de 0,5% (w / v) de vermelho de fenol.
  10. Com uma agulha e seringa, carregar a solução gradiente de Iodixanol para dentro do tubo de polipropileno, na ordem de 5 ml de 17%, 5 ml de 25%, 5 ml de 40% e 5 ml de 60%, começando a partir do fundo. Carregar todo o lisado obtido a partir do passo 3.8 (14-16 ml) na parte superior do gradiente. O gradiente, listados a partir do fundo para o topo, é de 60%, 40%, 25%, 17%, e a camada de lisado. Encha o tubo com tampão de lise e cobri-lo com a cortiça.
  11. Centrifugar a 185.000 xg durante 90 min a 16 ° C.
  12. Colher a fracção viral (camada de 40%) com uma seringa. Inserir a agulha (calibre 21) para a intersecção entre as fracções 40% e 60%, apenas a camada de aspiração de 40%.
    Nota: Evite aspiração QUALQUER da camada de 25%.
  13. Misture a fracção viral com esterilizado polioxietileno-polyoxyprosolução de copolímero de bloco de polipropi- PBS (10% de bloco de copolímero de polioxietileno-estoque polioxipropileno 1: 10.000 diluída em PBS) até um volume total de 15 ml. Carregar a mistura para dentro do tubo de filtro (cut-off molecular = 100 kD). Centrifugar a 2.000 xg durante 30 min a 4 ° C.
  14. Descartar a solução na parte inferior. Encher o tubo de filtro com uma solução de PBS copolímero de bloco de polioxietileno-polioxipropileno com um volume total de 15 ml. Centrifugar a 2.000 xg durante 20 min a 4 ° C. Repita este passo mais duas vezes. Recolhe-se o vírus purificado rAAV9 (a fracção acima do filtro).
  15. Transferir a rAAV9 purificado no tubo de filtro para tubos de 1,7 mL. Alíquota da rAAV9 purificado (100-400 uL / ​​tubo, dependendo do volume e o título do AAV) e armazenar o vírus a -80 ° C.
    Nota: Evite congelamento-degelo repetidos.

4. Medição do título de rAAV9

  1. Preparar as amostras de ADN padrão.
    1. Projetar PCR específica e eficienteprimers para vetores rAAV9 e otimizar a condição de PCR.
      NOTA: Os iniciadores utilizados neste estudo são "Forward: TCGGGATAAAAGCAGTCTGG; Reverso: TCGGACGGAGATACGTGAGT". A reacção de PCR foi realizada com os seguintes condições: desnaturação inicial a 95 ° C durante 3 min; 35 ciclos de 95 ° C durante 20 seg, 60 ° C durante 15 seg, e 72 ° C durante 10 seg; e a extensão final a 72 ° C durante 10 min. No entanto, os iniciadores e condições de PCR optimizadas são específicos do plasmídeo, tal como a sequência de inserção no vector rAAV9 pode afectar a especificidade e da eficiência da PCR 31.
    2. Realizar a reacção de PCR com as condições mostradas no passo 4.1.1. Purifica-se o produto de PCR com um kit de extracção de gel.
    3. Medir a concentração de ADN foi purificado utilizando um espectrofotómetro. Calcula-se a concentração em números moleculares de ADN com base no peso molecular / comprimento do produto de PCR.
      1. Calcular a concentração molecular utilizando a seguinte equação: MOconcentração lecular (moléculas de DNA ou fragmentos / ml) = 6,23 x 10 23 mol -1 x Con. x 10 -6 / MW. Nota: (6,23 x 10 mol -1 23 é o número de Avogadro; concentração Con .: ADN em ug / ml; MW .: peso molecular em g / mol). Por exemplo, se a concentração obtida do produto de PCR é de 100 ug / ml e o seu comprimento é de 200 pb, o peso molecular do DNA de cadeia dupla é de 2 x 200 x 310 = 124000 (o peso molecular médio de cada nucleótido no ADN de cadeia simples é de cerca de 310 g / mol). A concentração molecular (moléculas de ADN / ml) = 6.23 x 10 23 x 100 mol-1 ug / ml x 10 -6 / 124.000 g / mol = 5,18 x 10 14 moléculas de DNA / ml.
      2. Executar uma série de diluições do fragmento de ADN e preparar as amostras padrão, com concentrações de 13 a 10 moléculas / mL, 10 12 moléculas / mL, 10 11 moléculas / ml, 10 de 10 moléculas / mL, 10 9 moléculas / mL, 10 7 moléculas / ml. Use 1 ml de solução para cada amostra padrão para a PCR quantitativo (qPCR, no passo 4.6).
  2. Misturar 5 mL de solução rAAV9 purificado com 5 ul de tampão de ADNase 10x, 1 ul de ADNase (10.000 U / ml), e 39 ul de ddH 2 O. O volume total deve ser de 50 ul.
  3. Incubar o frasco a 37 ° C durante 30 minutos para remover o ADN de plasmídeo residual não embalados.
  4. Inactivar ADNase a 95 ° C durante 10 min. Arrefecer a solução, adicionar 44 ul de H2O, 5 mL de tampão de ADNase 10x e 1 ul de estoque de Proteinase K (10 mg / ml).
  5. Incubar a solução a 50 ° C durante 2 h. Parar a reacção e inactivar a proteinase K a 95 ° C durante 10 min.
  6. Use 1 ml da amostra para o ensaio de PCR quantitativo (qPCR). Calcula-se a título.
    1. Executar PCR quantitativo (qPCR) com os primers desenhados na etapa 4.1.1 utilizando as amostras fretapa om 4.1.4 (amostras padrão) e do passo 4,5 (amostras a ser medido).
      1. Para cada reacção, misturar 10 ul de 2x master mix verde (contendo a polimerase Taq, mistura de dNTP, tampão, MgCl2, e corante verde), 0,5 ul de iniciador directo (5 uM), 0,5 ul de iniciador reverso (5 ^ M), 8 ul de H 2 o, e 1 ul da amostra a ser medida. Realizar qPCR com as seguintes condições: manter as amostras a 50 ° C durante 2 min e 95 ° C durante 10 min; executar 40 ciclos a 95 ° C durante 15 segundos e a 60 ° C durante 1 min; para a fase de fusão, incubar as amostras a 95 ° C durante 30 seg e 60 ° C durante 15 seg. Gerar a curva padrão com base nos números de C T de amostras-padrão (Figura 3).
    2. Calcula-se a concentração molecular / titulação da amostra de AAV contra a curva padrão. O rAAV9 tem um genoma de ADN de cadeia simples, de modo que a concentração molecular será duas vezes maior do que ovalor calculado (2x potência (10, y), Figura 3B). Além disso, o título do rAAV9 purificado será 20 vezes maior do que o que é obtido a partir do cálculo em função da diluição do vírus em reacções de DNase e proteinase K (5 uL em 100 ul total) 01:20.

5. Injeção rAAV9 em Ratos Neonatais e Ensaios de Expressão Gênica no Coração

  1. Preparar as soluções de trabalho rAAV9 em solução PBS copolímero em bloco de polioxietileno-polioxipropileno. Faça o estoque de vírus com os títulos de 1-7 x 10 12 partículas / ml.
    NOTA: Entregue 50-70 mL de solução rAAV9 para cada dia pós-natal 0,5-1,5 rato por injecção subcutânea. Para alcançar sobre-expressão eficiente de genes ou knockdown, recomenda-se realizar um teste piloto em cada estudo para optimizar a quantidade de AAV injetado. Use a mesma quantidade de controles rAAV9.U6 :: mexidos rAAV9.cTNT :: Luc ou para cada estudo para minimizar o preconceito.
    NOTA: Nós usamos 1-1,5x 10 11 partículas / filhote de cachorro para superexpressão e 2,5-5 x 10 11 partículas / filhote de cachorro para knockdown no dia pós-natal 0,5-1,5 mi ce).
  2. Tratar ratos neonatal com rAAV9 em P0.5-P2.5 por injecção subcutânea.
    1. Pré-preencher a / 2, 0,33 x 12,7 mm seringa de insulina 29G1 com a solução rAAV9. Tenha cuidado para remover bolhas de ar.
    2. Segure o filhote anestesiados-crio em uma mão com o polegar eo indicador. Antes da injecção, deslize para a pele do dorso do filhote com um escovilhão saturada com álcool isopropílico a 70%, para manter a condição de esterilizado. Inserir a agulha da seringa na hipoderme dorsal anterior do animal a um ângulo de 5 a 10 °. Injectar 50-70 ul da solução rAAV9 usando a seringa de insulina.
      NOTA: rAAV9 também pode ser entregue ao rato através de injecção intraperitoneal ou intravenosa 26,27. expressão eficaz dos genes entregues no coração pode ser obtido. No entanto, injeção intraperitonealião, por vezes, pode resultar na expressão gotejante no fígado. Após a injecção, a condição de as crias foi monitorizado diariamente.
  3. O nível de expressão do gene no coração pode ser monitorizada com qPCR, imunofluorescência, ou Western blot (resultados representativos são mostrados nas Figuras 4 e 5) 25,26.
    NOTA: Os ratos foram submetidos à eutanásia por CO 2 entregues a partir de uma fonte de gás comprimido. As amostras de tecidos foram coletadas após a confirmação de que a frequência cardíaca, movimento e respiração dos animais tinha cessado. Roedores neonatais são resistentes ao CO 2 a eutanásia e foram sacrificados por decapitação utilizando uma tesoura afiada. O método é consistente com as recomendações do Painel sobre a eutanásia da American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

As estratégias para a construção de plasmídeos rAAV9 rAAV9.U6 :: shRNA rAAV9.cTNT :: GFP ou são mostrados nas Figuras 1 e 2, respectivamente. Como os exemplos, o vector foi gerado rAAV9 para sobre-expressar o gene GFP em corações de rato. O plasmídeo resultante contém a cassete de cTNT :: GFP flanqueado por duas ITR locais (Figura 1). O vector rAAV9.U6 :: shRNA foi construído para knockdown de ARNm Trbp (Figura 2)

A curva padrão para rAAV9 titulação foi gerado com os dados por regressão linear qPCR. O y variável manipulada representa o valor Log 10 da concentração molecular do DNA de cada amostra padrão, ea variável correspondente x representa o valor de C T. Os 10 valores (concentração) Entrar (y) e números de C T (x) apresentam uma correlação linear agradável (R2 = 0,9971) e encaixar com a equação y = 14,616 + -0.2832x (Figura 3A). As titulações de amostras rAAV9 foram calculados com base na equação linear (Figura 3B). Com o método descrito no protocolo (passo 4.6.2 e a Figura 3B), um título elevado de vectores rAAV9 (50-200 ul,> 6 x 10 13 partículas / ml) foi obtido do estudo representativo.

Para monitorar a eficiência e tecido especificidade de vetores rAAV9.cTNT, filhotes P0.5 foram tratados com mesma quantidade (1 x 10 11 partículas / filhote de cachorro) de rAAV9.cTNT :: luciferase (AAV-Luc) ou rAAV9.cTNT :: GFP (AAV-GFP) através de injecção subcutânea. Duas semanas após a injecção, o sinal de GFP foi monitorizada em vários tecidos dos ratinhos. Expressão robusta de GFP foi detectado no coração, mas não em outros órgãos (Figura 4, n> 3). Assim, a expressão do gene eficiente e específico do coração foi realizada com o vector rAAV9.cTNT.

jove_content "fo: manter-together.within-page =" 1 "> Para monitorar a eficiência knockdown e especificidade de tecido de vetores rAAV9.U6, ratos P0.5 foram tratados com mesma quantidade (3 x 10 11 partículas / filhote de cachorro) de rAAV9 .U6 :: precipitação (AAV-precipitação) ou rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) por injecção subcutânea. Duas semanas após a injecção, a expressão de Trbp em vários tecidos foi monitorizada por qPCR (Figura 5, n = 3 ). o nível de ARNm de Trbp no coração foi substancialmente reduzida por rAAV9.U6 :: shTrbp (68% downregulation, P = 0,0004452). a regulação de Trbp também foi detectado no tecido do fígado de rAAV9.U6 :: shTrbp-tratada ratinhos. no entanto, a alteração é muito menor.

figura 1
Figura 1: Estratégias para construir a rAAV9.cTNT :: GFP plasmídeo. (A) O regime do cTNT :: cassete GFP. (B TNNT2 (rAAV9.cTNT) seguido pelos dois sítios de restrição únicos (NheI e Kpnl). A grelha de leitura aberta de GFP foi clonada no vector de rAAV9.cTNT por restrição mediada pelo local de ligação para gerar o plasmídeo rAAV9.cTNT :: GFP. (B) O plasmídeo rAAV9.cTNT :: GFP podem ser construídos através da montagem de Gibson. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: As estratégias para construir o rAAV9.U6 :: shRNA Plasmid. (A) O regime do U6 :: shRNA cassete é mostrado. Expressão de shRNA é conduzida pelo promotor U6 (azul). (B) cassetes rAAV9-U6-shRNA pode ser gerado por emparelhamento e ligação de oligonucleótidos de DNA contersequências ING shRNA nos vectores rAAV9 digerido com enzimas de restrição que albergam o promotor U6. (C) rAAV9.U6 :: cassetes shRNA pode ser gerado por PCR de longo alcance e intra-molecular à base de montagem Gibson construção "sem costura". 5 'braço, laço, e 3' braço de shRNA são mostrados em verde, laranja e vermelho, respectivamente. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Cálculo do rAAV9 titulação. (A) A curva padrão para rAAV9 titulação foi gerado por agressão linear utilizando os dados de qPCR. A variável manipulada y representa o valor Log 10 da concentração molecular do DNA de cada amostra padrão, ea variável correspondente xrepresenta o valor de C T. (B) Títulos de amostras rAAV9 são calculadas com base na equação linear da curva padrão. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4: Expressão Padrão de rAAV9.cTNT :: GFP em tecidos dos ratos. Filhotes P0.5 foram tratados com mesma quantidade (1 x 10 11 partículas / filhote de cachorro) de rAAV9.cTNT :: luciferase (AAV-Luc, controle negativo) ou rAAV9.cTNT :: GFP (AAV-GFP) por injecção subcutânea. Duas semanas após a injecção, as amostras de tecido foram colhidas. Expressão de GFP foi monitorizada sob um escopo de dissecação fluorescente. Ambos brilhantes imagens de campo e de fluorescência são apresentados. As experiências foram repetidas mais do que 3 vezes (n> 3).Barra de escala = 2,0 mm. SKM, músculo esquelético. Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5: Expressão Gênica Knockdown com AAV-shRNA. Camundongos P0.5 foram tratados com a mesma quantidade (3 x 10 11 partículas / filhote de cachorro) de rAAV9.U6 :: Scramble (AAV-Scramble) ou rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) por injecção subcutânea. Duas semanas após a injecção, os níveis de mRNA de Trbp em vários tecidos foram monitorizados por qPCR (n = 3). Os dados são apresentados como a média ± SEM. O valor de corte P é de 0,05. NS, P> 0,05, não significativo. **, P <0,01. SKM, músculo esquelético. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

É importante minimizar a recombinação indesejada ITR durante a construção do plasmídeo. Antes de gerar o vírus, deve-se controlar sempre a integridade ITR dos plasmídeos de AAV, utilizando a digestão de restrição e electroforese em gel de agarose. É impossível obter 100% plasmídeos intactos, mas a razão de recombinação deve ser minimizado tanto quanto possível. Menos de 20% é aceitável para embalagem rAAV9 bem sucedida. De nota, a cultura das bactérias a temperatura mais baixa (30 ° C) com uma velocidade mais baixa agitação (180-200 rpm) pode reduzir a possibilidade de recombinação ITR.

É essencial para garantir que as células HEK293 são saudáveis ​​para a transfecção bem sucedida e embalagem rAAV9. células "saudáveis" são geralmente altamente proliferativa e crescer rapidamente. No entanto, a rápida proliferação e crescimento de células HEK293 não garante necessariamente a alta eficiência de embalagem rAAV9. Assim, é importante para iniciar as experiências com células frescas. istoé recomendado o uso de baixa passagem células HEK293 (<10 passagens, as células são passadas a cada 2-3 dias) para embalagem rAAV9. De nota, outros serótipos de rAAV pode ter de ser purificados utilizando diferentes procedimentos 32.

O investigador é concedida flexibilidade na geração de plasmídeos rAAV9. De qualquer ligação restrição local mediada ou montagem Gibson pode ser utilizado 30. Para a construção rAAV9.U6 :: shRNA, a estratégia baseada em conjunto intra-molecular Gibson é um método eficaz (Figuras 1 e 2). Vários plasmídeos AAV-shRNA ou centralizadas, AAV-shRNAs pode ser rapidamente construído. Para sobre-expressar genes utilizando rAAV9, existe uma limitação de tamanho para as sequências de ADNc inseridos. De um modo geral, o fragmento de tamanho entre as ITRs deve ser menor do que 5 kb 33. Splicing proteína intein catalisada pode ser usado para contornar o limite de tamanho de embalagem de vetores rAAV9 34.

Outro sistema virals, incluindo retrovírus, lentivírus e adenovírus, também têm sido desenvolvidas e permitir a manipulação do gene flexível. Comparado com estes diferentes tipos de vetores virais, rAAV tem vantagens específicas: alta eficiência, de alta especificidade, baixa taxa de integração genómica, mínimo imunogenicidade, patogenicidade e mínima. Assim, engenharia de genoma baseada em rAAV está a emergir como uma ferramenta ideal para in vivo manipulação genética.

Estudos anteriores demonstraram que o sistema rAAV9 permite a expressão eficaz de genes entregues in vivo. Com o promotor cTNT (galinha TNNT2), expressão de genes específicos de coração foi obtida (Figura 4) 25,26. Embora o promotor U6 é ubiquamente em tecidos de ratinho activa, uma inibição mais marcante de ARNm alvo (Trbp) por rAAV9.U6 :: shRNA foi observada no coração, mas não em outros órgãos (Figura 5). O fígado é o órgão mais comum transduzidas por diferentes sorotipos derAAV 35,36. No entanto, a eficiência knockdown (redução de 36% do nível de ARNm) no fígado é muito menor do que no coração (redução de 68% do nível de ARNm). Isto é consistente com o estudo anterior que mostra que, apesar da maior presença genoma virai no fígado, a entrega sistémica de shRNA por rAAV9 fornece mais eficiente do gene knockdown no coração 35. É possível que os hepatócitos são mais proliferativa do que cardiomiócitos e são submetidos a mais activa a divisão celular após a administração rAAV9 nas idades neonatais, o que resulta na diluição genoma de vector substancial no tecido do fígado. No entanto, isso também sugere que o serotipo de rAAV9 podem transduzir de forma mais eficiente cardiomiócitos em comparação com outros tipos de células. Como demonstrado por Lovric et ai., Em miócitos diferenciados, a resposta de dano de DNA proteínas complexas MRN são reprimidos. proteínas complexas MRN genomas de AAV se ligam e inibem a transdução de AAV por meio de silenciamento transcricional. Assim, porMissividade de transdução de AAV pode ser induzida pela diferenciação terminal de cardiomiócitos 36, fazendo com que o sistema rAAV9, em comparação com outros vectores virais, muito adequado para a manipulação genética no coração. Para minimizar ainda mais os efeitos indesejados knockdown em outros órgãos (por exemplo, o fígado), pode-se também utilizar cardíacas específicas com base shmiR-miR-30a-cTNT promotor conduzido para reprimir os genes de interesse no coração 29. Este manuscrito fornece o leitor com as técnicas específicas para capitalizar sobre a tecnologia rAAV9 em investigações cardiovasculares.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics