Preparazione di rAAV9 per iperespressione o Knockdown geni in Cuori mouse

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Controllare l'espressione o l'attività di specifici geni attraverso la consegna del miocardio del materiale genetico in modelli murini permette l'indagine delle funzioni dei geni. Il loro potenziale terapeutico nel cuore può anche essere determinato. Ci sono approcci limitati di intervento molecolare in vivo nel cuore del mouse. Ricombinante virus adeno-associato (rAAV) ingegneria del genoma basata su è stata utilizzata come uno strumento essenziale per in vivo manipolazione genetica cardiaco. I vantaggi specifici di questa tecnologia sono ad alta efficienza, alta specificità, basso tasso di integrazione genomica, minimal immunogenicità e patogenicità minima. Qui, una procedura dettagliata per la costruzione, il pacchetto, e purificare i vettori rAAV9 è descritto. L'iniezione sottocutanea di rAAV9 in cuccioli neonatali traduce in espressione robusta o efficiente knockdown del gene (s) di interesse nel cuore del mouse, ma non nel fegato e in altri tessuti. Utilizzando la cardiaco-specific TnnT2 promotore, alta espressione del gene GFP nel cuore è stato ottenuto. Inoltre, mRNA è stato inibito nel cuore, quando un rAAV9-U6-shRNA è stato utilizzato. Lavorando conoscenza della tecnologia rAAV9 può essere utile per le indagini cardiovascolari.

Introduction

Controllo dell'espressione o dell'attività di geni specifici in vari sistemi biologici è diventato una strategia valida nello studio della funzione genica 1. Un mezzo diretto di realizzazione di questo obiettivo è quello di manipolare sequenze nucleotidiche e generare alleli mutanti. Anche se fare precise, modifiche mirate al genoma delle cellule viventi è ancora un tempo e la pratica alta intensità di lavoro, lo sviluppo di potenti strumenti Talen e CRISPR / Cas9 ha aperto una nuova era di editing genoma 2-5. Un metodo di laboratorio di routine di più per la manipolazione genetica si è concentrata sull'introduzione di materiale genetico (DNA e RNA che contengono sequenze codificanti o siRNA / shRNAs) nelle cellule per esprimere o caduta del gene (s) di interesse 1,6.

In molti casi, il principale ostacolo manipolazione genetica è la consegna di DNA, RNA, o proteine ​​nelle cellule. Per quanto riguarda gli studi in vitro, transfecti efficienteNei sistemi sono stati istituiti in molte linee di cellule in coltura. Tuttavia, nel modello murino in particolare, in vivo consegna del gene è più impegnativo. Ci sono una serie di barriere extra-intracellulari e che devono essere bypassato per conseguire efficace assorbimento cellulare dei reagenti esogeni. Ostacoli aggiuntivi includono la rapida clearance e la breve durata dei materiali 7,8 consegnato. Una strategia per aggirare questi problemi è quello di utilizzare vettori virali come "portatori" o "veicoli" per in vivo consegna del gene. Le proprietà di trasduzione naturalmente evoluti di virus consentono la fornitura efficiente di un gene di interesse in cellule 7,9,10. Numerosi tipi di vettori virali sono stati sviluppati e consentire flessibilità nella manipolazione genica in vivo in diversi tipi di cellule e organi topi.

I sistemi virali più comunemente utilizzati includono Retrovirus, Lentivirus, Adenovirus, e adeno-associato virus (AAV) 12-14. Tuttavia, molti tipi di retrovirus infettano solo le cellule in divisione, e la loro efficacia in cellule non-divisione è molto bassa 15. Questo limita la loro utilità per la consegna del gene. Lentivirus è un genere della famiglia Retroviridae. Diverso da altri retrovirus, Lentivirus può infettare sia cellule in divisione e non di divisione ed è stato ampiamente utilizzato per il trasferimento genico in post-mitotico e cellule altamente differenziate-16. Il ciclo di vita di Lentivirus coinvolge anche l'integrazione del DNA vettore nel genoma dell'ospite. Gene delivery Così, Lentivirus-mediata consente espressione stabile e di lunga durata degli elementi genetici trasdotte 16-18. Tuttavia, questa caratteristica può rappresentare un doppio-espada dged nell'uso di questi virus per manipolare l'espressione genica, come integrazione di DNA vettoriale può portare a mutagenesi inserzionale nelle cellule ospiti e può causare effetti artefattuali. Adenovirus è un altro sistema di consegna del gene ampiamente utilizzato. A differenza dei retrovirus e lentivirus, Adenovirus sono non integrati e non interferiscono con l'integrità genomica delle cellule ospiti 8,10,11,19. Inoltre, adenovirus può trasfezione di DNA in molti tipi di cellule, e l'infezione non dipende divisione cellulare attiva 19. Un'altra caratteristica importante di adenovirus è la facilità di purificazione vettoriale, come i vettori virali hanno la capacità di essere replicato 19,20. Tuttavia, l'avvertimento importante di questo sistema è che l'infezione da adenovirus può innescare forti risposte immunitarie cellule bersaglio e organi 19, limitando il suo utilizzo in molte indagini, in particolare studi di terapia genica.

Rispetto a queste tipo diversos di vettori virali, virus ricombinante adeno-associato (rAAV) sembra essere il sistema di erogazione del gene ideale 21,22. Esibisce immunogenicità minimale e patogenicità 23,24. Inoltre, rAAV infetta una vasta gamma di tipi di cellule, inclusi sia demarcazione e cellule non-dividendo. Nella maggior parte dei casi, rAAV non si integra nel genoma di accoglienza; in tal modo, il rischio di cambiamenti genetici o genomiche indesiderate nelle cellule bersaglio è bassa 22.

Recentemente, i sistemi rAAV sono stati utilizzati con successo per la consegna in vivo di proteine di codifica del DNA, miRNA, shRNAs, e CRISPR-gRNAs in un mouse muscolo cardiaco 23,25-29. Questa metodologia è facilitato ricerche fondamentali e studi di terapia genica nel campo della ricerca cardiovascolare. Qui, la procedura dettagliata per generare vettori rAAV9 che iperesprimono efficiente o Knockdown i geni di interesse nei cuori del mouse è stato descritto. Il protocollo fornisce un metodo semplice ed efficacemanipolazione genica cardiaca in modelli sperimentali murini.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutti i passaggi descritti sono stati eseguiti secondo protocolli approvati dal Comitato Biosicurezza e del Comitato Istituzionale cura e l'uso degli animali dell'ospedale dei bambini Boston. All'ospedale dei bambini Boston dispone di strutture di topo esenti da organismi patogeni con cicli giorno / notte regolamentati e climatizzazione. Veterinari e la cura degli animali dello staff di cambiamento gabbie e garantire la salute dei topi. Le strutture sono certificati AAALAC e hanno la certificazione attiva Animal Welfare Assurance (AAALAC accreditamento concesso sulla 1992/02/24 benessere degli animali Assurance numero:. A3303-01). I topi sono stati sacrificati da CO 2 erogata da una sorgente di gas compresso. I campioni di tessuto sono stati raccolti dopo aver verificato che la frequenza cardiaca, il movimento, e la respirazione degli animali era cessato. Roditori neonatali sono resistenti a CO 2 l'eutanasia e sono stati sacrificati per decapitazione usando forbici affilate. Questi metodi sono coerenti con le raccomandazioni del gruppo di eutanasia della American Veterinary Medical associazione.

1. Generazione di rAAV9 costrutti dalla clonazione di un cDNA o shRNA cassetta di espressione nella spina dorsale plasmidi

NOTA: Il plasmide rAAV9, contenente le ripetizioni terminali invertite (ITR) di AAV2, utilizzati per il gene sovraespressione è stato modificato per ospitare il TNNT2 pollo promotore (rAAV9.cTNT), che permette l'espressione specifica per cardiomiociti di geni trasdotte 25,26,29. siti unici NheI e KpnI sono stati introdotti nel plasmide, a valle del promotore. I frammenti di cDNA che codificano i geni di interesse possono essere clonati nella spina dorsale rAAV9 utilizzando questi due siti di restrizione 25,26,29. Qui, per esempio, il vettore rAAV9 per la sovraespressione del gene GFP nei cuori di topo è stato generato. Il plasmide risultante contiene la cTnT :: cassetta GFP affiancato da due ITR siti (Figura 1). costrutti rAAV9.U6 :: shRNA sono stati utilizzati per il silenziamento genico 25. Progettazione shRNAs usandoon-line i server di progettazione shRNA. rAAV9.U6 :: shRNA può essere generata sia da ricottura e legando oligonucleotidi contenenti sequenze di DNA shRNA nelle enzima di restrizione-digerito vettori rAAV9 ospitano il promotore U6, o lungo raggio PCR e intra-molecolare Gibson montaggio a base di "senza soluzione di continuità" costruzione di 30. Il plasmide risultante dovrebbe contenere la cassetta U6-shRNA fiancheggiato da due ITR siti (Figura 2). Qui, ad esempio, il vettore rAAV9.U6 :: shRNA è stato costruito per atterramento Trbp mRNA (sequenza Trbp shRNA: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). Una corsa shRNA è stato utilizzato come controllo negativo (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Clonare la cassetta di espressione cDNA o shRNA nel plasmide spina dorsale rAAV9. Trasformare il DNA in cellule di E. coli competenti 25.
    NOTA: utilizzare le cellule di E. coli stbl2 o stbl3 per la trasformazione rAAV9 DNA per ridurre al minimo indesiderato ricombinazione ITR.
  2. Raccogli ilclone positiva da parte delle cellule di E. coli trasformate. Amplificare la cultura in 500 ml di terreno Lilly-Barnett ed estrarre il plasmide rAAV9 dalle cellule batteriche 25-30.
    NOTA: Midi / Maxi prep plasmide rAAV9 per ottenere una elevata quantità di DNA (> 100 mg). Prima di generare il virus, analizzare sempre l'integrità sequenza dei plasmidi AAV per restrizione digestione e elettroforesi su gel di agarosio, come precedentemente descritto (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Trasfezione delle cellule HEK293 con rAAV9 Plasmidi

  1. Preparare 1 mg / mL di soluzione di polietilenimmina lineare (PEI). Sciogliere PEI in polvere in DH privo di endotossine 2 O che è stato riscaldato a 70-80 ° C. Aftercooling fino a RT, neutralizzare la soluzione a pH 7,0 con 1 M HCl. Filtro sterilizzare (0,22 micron) la soluzione. Aliquota della soluzione di riserva / ml PEI 1 mg (1,400 ml / tubo) e conservare il solutione a -20 ° C.
  2. HEK293 cellule cultura in Modified Eagle Medium di Dulbecco (DMEM) con il 10% siero fetale bovino (FBS) e 1% di penicillina / streptomicina. Cultura le cellule in un incubatore a 37 ° con 5 ± 0,5% di anidride carbonica (CO 2).
  3. Al giorno 0, piastra cellule HEK293 in dieci piatti da 150 mm 18-20 ore prima della trasfezione, dividendo il> 90% delle cellule confluenti in una diluizione 1: 2.
    NOTA: Al giorno 1, le cellule devono raggiungere il 90% di confluenza.
  4. Al giorno 1, trasfezione cellule HEK293 con il plasmide rAAV9 (ad esempio, rAAV9.cTNT :: GFP o rAAV6.U6 :: shRNA costruisce), Ad-Helper plasmide, e plasmide AAV-Rep / Cap con PEI 25,26,29.
    1. Per 10 piatti a base di cellule al 90% di confluenza, mescolare 70 mg di AAV-Rep / Cap plasmide, 70 mcg pf rAAV9 plasmide, e 200 mg di Ad-Helper plasmide in una provetta da centrifuga da 50 ml.
    2. Se le cellule sono meno confluenti, regolare la quantità di DNA proporzionalmente. Per esempio, se le cellule sono al 75% confluenti, ridurre laimporto DNA proporzionalmente (75/90 dell'importo indicato al punto 2.4.1): mescolare 70 x 75/90 = 58,3 mg di AAV-Rep / Cap plasmide, 70 x 75/90 = 58,3 mg di rAAV9 plasmide, e 200 x 75/90 = 166,7 mg di Ad-Helper plasmide in una provetta da centrifuga da 50 ml.
    3. Aggiungere 49 ml di RT DMEM (senza FBS) per il tubo da 50 ml e mescolare bene.
    4. Aggiungere 1.360 ml di soluzione di PEI per rendere il PEI: rapporto di DNA (v / w) sia 4: 1. Mescolare bene. Incubare a temperatura ambiente per 15 - 30 min.
    5. Aggiungere 5 ml della miscela preparata al punto 2.4.4 per ogni piatto da 150 mm (50 ml della miscela per dieci piatti di 150 mm).
  5. Cultura le cellule in un incubatore a 37 ° con 5 ± 0,5% di CO 2 per 60-72 ore.

3. Raccolta di transfettati HEK293 cellule e la purificazione di rAAV9 vettori

  1. Raccogliere le cellule 60-72 ore dopo la trasfezione. Dislodge e sospendere le cellule in piatti pipettando su e giù con il mezzo di coltura. Trasferire tutte le sospensioni cellulari di sterileprovette da 50 ml.
  2. Centrifugare le cellule a 500 xg per 5 min. Risospendere il pellet di cellule con 5 ml di PBS in ogni provetta e combinare tutte le sospensioni di cellule in una provetta da 50 ml.
  3. Centrifugare le cellule a 500 xg per 5 min. Eliminare il surnatante. A questo punto, memorizzare il pellet cellulare a -80 ° C o immediatamente purificare l'AAV dal pellet, come descritto ai punti 3.4-3.15.
  4. Preparare il tampone di lisi: 150 mm NaCl e 20 mM Tris-HCl, pH 8,0. Filtro sterilizzare (0,22 micron). Conservare il tampone a 4 ° C.
  5. Risospendere il pellet con 10 ml di tampone di lisi.
  6. Congelare il lisato a -80 ° C o in bagno di ghiaccio secco / etanolo, poi scongelare a 37 ° C. Vortex per 1 min. Congelare e scongelare il lisato 3 volte.
  7. Aggiungere la soluzione MgCl 2 al lisato scongelato (rendere la concentrazione finale di MgCl 2 nel lisato essere 1 mM). Aggiungere la nucleasi ad una concentrazione finale di 250 U / ml. Incubare a 37 ° C per 15 minuti per sciogliere il / aggr proteine ​​DNAegation.
    NOTA: Se l'aggregazione del DNA / proteine ​​non viene sciolta dopo nucleasi o endonucleasi trattamento, Dounce omogeneizzare il lisati 20 volte.
  8. Centrifugare il campione a 4.800 xg per 20 min a 4 ° C. Raccogliere il surnatante.
  9. Nel frattempo, preparare la soluzione gradiente Iodixanolo:
    1. Preparare il 17% della soluzione gradiente miscelando 5 ml di PBS 10x, 0,05 ml di 1 M MgCl 2, 0,125 ml di 1 M KCl, 10 ml di 5 M NaCl, e 12,5 ml ofdensity dislivello medio. Regolare il volume totale di 50 ml utilizzando H 2 O.
    2. Preparare la soluzione al 25% miscelando 5 ml di PBS 10x, 0,05 ml di 1 M MgCl 2, 0,125 ml di 1 M KCl, 20 ml di media densità gradiente, e 0,2 ml di 0,5% (w / v) di rosso fenolo. Regolare il volume totale di 50 ml utilizzando H 2 O.
    3. Preparare la soluzione al 40% mescolando 5 ml di 10x PBS, 0,05 ml di 1 M MgCl 2, 0,125 ml di 1 M KCl, e 33,3 ml di mezzo gradiente di densità. Regolare il volume totale di 50 ml utilizzandoH 2 O.
    4. Preparare la soluzione al 60% miscelando 0,05 ml di 1 M MgCl 2, 0,125 ml di 1 M KCl, 50 ml di media densità gradiente, e 0,1 ml di 0,5% (w / v) rosso fenolo.
  10. Con un ago e la siringa, caricare la soluzione gradiente Iodixanolo nel tubo di polipropilene dell'ordine di 5 ml di 17%, 5 ml di 25%, 5 ml di 40% e 5 ml di 60%, partendo dal basso. Caricare tutto il lisato ottenuto nella fase 3.8 (14-16 ml) sulla parte superiore del gradiente. Il gradiente, indicato dal basso verso l'alto, è del 60%, 40%, 25%, 17%, e lo strato lisato. Riempire il tubo con tampone di lisi e coprire con il sughero.
  11. Centrifugare a 185.000 xg per 90 min a 16 ° C.
  12. Raccogliere la frazione virale (40% layer) con una siringa. Inserire l'ago (21 gauge) nell'intersezione tra le frazioni 40% e 60%, solo aspirando lo strato 40%.
    NOTA: Evitare di aspirazione QUALSIASI dello strato di 25%.
  13. Mescolare la frazione virale con sterilizzato poliossietilene-polyoxyprosoluzione blocchi propilene copolimero PBS (10% poliossietilene-poliossipropilene copolimero a blocchi magazzino 1: 10.000 diluito in PBS) fino a un volume totale di 15 ml. Caricare il composto nella provetta filtro (cut-off MW = 100 kD). Centrifugare a 2.000 xg per 30 min a 4 ° C.
  14. Scartare la soluzione in basso. Riempire il tubo filtro con blocchi poliossietilene-poliossipropilene copolimero soluzione PBS fino ad un volume totale di 15 ml. Centrifugare a 2.000 xg per 20 min a 4 ° C. Ripetere questa operazione altre due volte. Raccogliere il virus rAAV9 purificato (la frazione di sopra del filtro).
  15. Trasferire il rAAV9 purificato nel tubo filtro per tubi 1.7 mL. Aliquotare il rAAV9 purificato (100 - 400 microlitri / tubo, a seconda del volume e titolo del AAV) e conservare il virus a -80 ° C.
    NOTA: Evitare ripetuti di congelamento-disgelo.

4. Misura della il titolo di rAAV9

  1. Preparare campioni di DNA standard.
    1. Progettare PCR specifica ed efficienteprimer per vettori rAAV9 e ottimizzare la condizione di PCR.
      NOTA: I primer utilizzati in questo studio sono "Forward: TCGGGATAAAAGCAGTCTGG; Reverse: TCGGACGGAGATACGTGAGT". La reazione PCR è stata eseguita con le seguenti condizioni: denaturazione iniziale a 95 ° C per 3 min; 35 cicli di 95 ° C per 20 sec, 60 ° C per 15 sec e 72 ° C per 10 sec; e l'estensione finale a 72 ° C per 10 min. Tuttavia, i primer ottimizzati e condizioni di PCR sono specifici plasmide, come la sequenza inserto nel vettore rAAV9 può influenzare la specificità e l'efficienza della PCR 31.
    2. Eseguire la reazione di PCR con le condizioni indicate al punto 4.1.1. Purificare il prodotto di PCR con un kit di estrazione gel.
    3. Misurare la concentrazione di DNA purificato utilizzando uno spettrofotometro. Calcolare la concentrazione in numero molecolari di DNA in base al peso molecolare / lunghezza del prodotto PCR.
      1. Calcolare la concentrazione molecolare utilizzando la seguente equazione: moconcentrazione lecular (molecole di DNA o di frammenti / ml) = 6,23 x 10 23 mol -1 x Con. x 10 -6 / MW. Nota: (6,23 x 10 23 mol -1 è il numero di Avagadro; concentrazione Con .: DNA in mg / ml; MW .: peso molecolare in g / mol). Per esempio, se la concentrazione ottenuta del prodotto della PCR è di 100 ug / ml e la sua lunghezza è di 200 bp, il peso molecolare del DNA a doppio filamento è 2 x 200 x 310 = 124.000 (il peso molecolare medio di ciascun nucleotide nel DNA a singolo filamento è di circa 310 g / mol). La concentrazione molecolare (molecole DNA / ml) = 6,23 X 10 23 mol -1 x 100 ug / ml x 10 -6 / 124.000 g / mol = 5,18 x 10 14 DNA molecole / ml.
      2. Effettuare una serie di diluizioni del frammento di DNA e preparare i campioni standard, con concentrazioni di 10 13 molecole / ml, 10 12 molecole / ml, 10 11 molecole / ml, 10 10 molecole / ml, 10 9 molecole / ml, 10 7 molecole / ml. Usare 1 ml di soluzione per ogni campione standard per la PCR quantitativa (qPCR, al punto 4.6).
  2. Mescolare 5 ml di soluzione rAAV9 purificata con 5 ml di tampone 10x DNAsi, 1 ml di DNAsi (10.000 U / ml), e 39 ml di DDH 2 O. Il volume totale dovrebbe essere 50 microlitri.
  3. Incubare il flacone a 37 ° C per 30 minuti per rimuovere residui di DNA plasmide imballati.
  4. Inattivare i DNAsi a 95 ° C per 10 min. Raffreddare la soluzione, aggiungere 44 ml di H 2 O, 5 ml di 10x tampone DNAsi, e 1 ml di proteinasi K magazzino (10 mg / ml).
  5. Incubare la soluzione a 50 ° C per 2 ore. Arrestare la reazione e inattivare il Proteinasi K a 95 ° C per 10 min.
  6. Usare 1 ml di campione per il saggio PCR quantitativa (qPCR). Calcolare il titolo.
    1. Eseguire la PCR quantitativa (qPCR) con i primer disegnati nella fase 4.1.1 utilizzando i campioni frpasso om 4.1.4 (campioni standard) e dal punto 4.5 (campioni da misurare).
      1. Per ogni reazione, mescolare 10 ml di 2x master mix verde (che contengono Taq polimerasi, mix di dNTP, tampone, MgCl 2, e colorante verde), 0,5 ml di primer forward (5 micron), 0,5 ml di primer reverse (5 micron), 8 ml di H 2 O, e 1 ml di campione da misurare. Eseguire qPCR con le seguenti condizioni: tenere i campioni a 50 ° C per 2 minuti e 95 ° C per 10 min; eseguire 40 cicli a 95 ° C per 15 sec ea 60 ° C per 1 min; per la fase di fusione, incubare i campioni a 95 ° C per 30 sec e 60 ° C per 15 sec. Generare la curva standard basato sul numero C T dei campioni di riferimento (figura 3).
    2. Calcolare la concentrazione molecolare / titolo del campione AAV contro la curva standard. Il rAAV9 ha un genoma a singolo filamento di DNA, quindi la concentrazione molecolare sarà di 2 volte superiore rispetto alvalore calcolato (potenza 2x (10, y), Figura 3B). Inoltre, il titolo del rAAV9 purificato sarà 20 volte superiore rispetto a quanto ottenuto dal calcolo a causa della diluizione 1:20 del virus nelle reazioni DNAsi e proteinasi K (5 ml in 100 l totale).

5. rAAV9 iniezione in topi neonati e saggi di espressione genica nel Cuore

  1. Preparare le soluzioni di lavoro rAAV9 in poliossietilene-poliossipropilene copolimero a blocchi soluzione PBS. Rendere lo stock di virus con i titoli di 1-7 x 10 12 particelle / ml.
    NOTA: Deliver 50-70 ml di soluzione di rAAV9 in ogni postnatale giorno 0,5-1,5 topo mediante iniezione sottocutanea. Per raggiungere efficiente sovraespressione del gene o atterramento, si raccomanda di eseguire un test pilota per ogni studio per ottimizzare la quantità di AAV iniettato. Utilizzare la stessa quantità di rAAV9.cTNT :: Luc o controlli rAAV9.U6 :: scramble per ogni studio per ridurre al minimo la distorsione.
    NOTA: Abbiamo usato 1-1,5x 10 11 particelle / cucciolo per la sovraespressione e 2,5-5 x 10 11 particelle / cucciolo per atterramento in giorno postnatale 0,5-1,5 mi ce).
  2. Trattare topi neonati con rAAV9 a P0.5-P2.5 per iniezione sottocutanea.
    1. Pre-riempire un 29G1 / 2, 0,33 x 12,7 mm siringa da insulina con la soluzione rAAV9. Fate attenzione a rimuovere le bolle d'aria.
    2. Tenere il cucciolo crio-anestetizzati in una mano con il pollice e l'indice. Prima dell'iniezione, strisciare la pelle posteriore del cucciolo con un bastone tampone saturato con il 70% di alcool isopropilico per mantenere la condizione sterile. Inserire l'ago della siringa nel sottocute antero-dorsale dell'animale con un angolo di 5 a 10 °. Iniettare 50-70 microlitri della soluzione rAAV9 utilizzando la siringa da insulina.
      NOTA: rAAV9 può anche essere consegnata al mouse tramite iniezione intraperitoneale o endovenosa 26,27. espressione efficace dei geni consegnati nel cuore può essere ottenuto. Tuttavia, iniettare intraperitonealeion volte può causare espressione perde nel fegato. Dopo l'iniezione, la condizione dei cuccioli è stata monitorata ogni giorno.
  3. Il livello di espressione genica nel cuore può essere controllata mediante qPCR, immunofluorescenza, o western blot (risultati rappresentativi sono mostrati nelle figure 4 e 5) 25,26.
    NOTA: I topi sono stati sacrificati da CO 2 erogata da una sorgente di gas compresso. I campioni di tessuto sono stati raccolti dopo aver verificato che la frequenza cardiaca, il movimento, e la respirazione degli animali erano cessate. Roditori neonatali sono resistenti a CO 2 l'eutanasia e sono stati sacrificati per decapitazione usando forbici affilate. Il metodo è coerente con le raccomandazioni del gruppo sull'eutanasia della American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Le strategie per la costruzione di rAAV9 rAAV9.cTNT :: plasmidi rAAV9.U6 :: shRNA GFP o sono riportati nelle figure rispettivamente 1 e 2,. Come dimostrano gli esempi, il vettore rAAV9 è stato generato per iperespressione del gene GFP nei cuori del mouse. Il plasmide risultante contiene la cTnT :: cassetta GFP affiancato da due ITR siti (Figura 1). Il vettore rAAV9.U6 :: shRNA è stato costruito per atterramento Trbp mRNA (Figura 2)

La curva standard per rAAV9 titolazione è stata generato con i dati qPCR dalla regressione lineare. Il y variabile manipolata rappresenta il valore log 10 del DNA concentrazione molecolare di ogni campione standard, e la corrispondente variabile x rappresenta il valore C T. I 10 valori di registro (concentrazione) (Y) e numeri C T (X) mostrano una bella correlazione lineare (R 2 = 0,9971) e in forma con l'equazione y = -0.2832x + 14,616 (Figura 3A). I titoli di campioni rAAV9 sono stati calcolati sulla base della equazione lineare (Figura 3B). Con il metodo descritto nel protocollo (passo 4.6.2 e Figura 3B), un alto titolo di vettori rAAV9 (50-200 microlitri,> 6 x 10 13 particelle / ml) è stato ottenuto nello studio rappresentativo.

Per monitorare l'efficienza e il tessuto specificità dei vettori rAAV9.cTNT, cuccioli P0.5 sono stati trattati con lo stesso importo (1 x 10 11 particelle / pup) di rAAV9.cTNT :: luciferasi (AAV-Luc) o rAAV9.cTNT :: GFP (AAV-GFP) mediante iniezione sottocutanea. Due settimane dopo l'iniezione, il segnale GFP è stata monitorata in vari tessuti di topi. Espressione robusta di GFP è stata rilevata nel cuore, ma non in altri organi (Figura 4, n> 3). Così, l'espressione genica efficace e specifica per il cuore è stato raggiunto con il vettore rAAV9.cTNT.

jove_content "fo: keep-together.within-page =" 1 "> Per monitorare l'efficienza atterramento e la specificità del tessuto di vettori rAAV9.U6, topi P0.5 sono stati trattati con lo stesso importo (3 x 10 11 particelle / pup) di rAAV9 .U6 :: Scramble (AAV-Scramble) o rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) mediante iniezione sottocutanea. Due settimane dopo l'iniezione, espressione di Trbp in vari tessuti di stato monitorato da qPCR (Figura 5, n = 3 ). il livello di mRNA del Trbp nel cuore è stato notevolmente ridotto di rAAV9.U6 :: shTrbp (68% down-regulation, P = 0,0004,452 mila). Giù regolazione di Trbp è stato rilevato anche nel tessuto epatico da rAAV9.U6 :: shTrbp trattati topi. Tuttavia, il cambiamento è molto più basso.

Figura 1
Figura 1: Le strategie per costruire il rAAV9.cTNT :: GFP plasmide. (A) il regime della cTnT :: cassetto GFP. (B TNNT2 (rAAV9.cTNT) seguito dai due siti di restrizione unici (NheI e KpnI). La GFP open reading frame è stato clonato nel vettore rAAV9.cTNT per restrizione legatura sito-mediata per generare il plasmide rAAV9.cTNT :: GFP. (B) Il plasmide rAAV9.cTNT :: GFP può essere costruito da Gibson assemblaggio. Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2: Le strategie per costruire il rAAV9.U6 :: sHRNA plasmidi. (A) il regime del U6 :: è mostrato shRNA cassetta. L'espressione di shRNA è guidata dal promotore U6 (blu). (B) cassette rAAV9-U6-shRNA possono essere generati da ricottura e legando oligonucleotidi DNA contengonosequenze ING shRNA nelle enzima di restrizione-digerito vettori rAAV9 ospitano il promotore U6. (C) rAAV9.U6 :: cassette shRNA possono essere generati da lungo raggio PCR e intra-molecolare Gibson costruzione "senza soluzione di continuità" assemblea-based. Il 5 'del braccio, loop, e 3' braccio di shRNA sono mostrati in verde, arancione e rosso, rispettivamente. Clicca qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3: Calcolo del rAAV9 del titolo. (A) La curva standard per rAAV9 la titolazione è stato generato da un'aggressione lineare utilizzando i dati qPCR. La variabile y manipolata rappresenta il valore log 10 del DNA concentrazione molecolare di ogni campione standard, e la corrispondente variabile xrappresenta il valore C T. (B) I titoli di campioni rAAV9 sono calcolati in base alla equazione lineare della curva standard. Clicca qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4: Espressione del modello di rAAV9.cTNT :: GFP nei tessuti topi. Cuccioli P0.5 sono stati trattati con lo stesso importo (1 x 10 11 particelle / pup) di rAAV9.cTNT :: luciferasi (AAV-Luc, controllo negativo) o rAAV9.cTNT :: GFP (AAV-GFP) mediante iniezione sottocutanea. Due settimane dopo l'iniezione, i campioni di tessuto sono stati raccolti. L'espressione di GFP è stato monitorato in un ambito dissezione fluorescente. Sia sul campo e di fluorescenza immagini luminose sono presentati. Gli esperimenti sono stati ripetuti più di 3 volte (n> 3).Barra di scala = 2,0 mm. SKM, muscolo scheletrico. Clicca qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5: Espressione silenziamento genico con AAV-shRNA. Topi P0.5 sono stati trattati con la stessa quantità (3 x 10 11 particelle / pup) di rAAV9.U6 :: Scramble (AAV-Scramble) o rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) mediante iniezione sottocutanea. Due settimane dopo l'iniezione, i livelli di mRNA di Trbp in vari tessuti sono stati monitorati qPCR (n = 3). I dati sono presentati come media ± SEM. Il valore di cut-off P è 0.05. NS, P> 0,05, non significativo. ** P <0,01. SKM, muscolo scheletrico. Clicca qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

È importante minimizzare indesiderato ricombinazione ITR durante la costruzione del plasmide. Prima di generare il virus, si deve sempre monitorare l'integrità ITR dei plasmidi AAV utilizzando restrizione digestione e elettroforesi su gel di agarosio. È impossibile ottenere 100% plasmidi intatte, ma il rapporto ricombinazione dovrebbe essere minimizzata il più possibile. Meno del 20% è accettabile per l'imballaggio rAAV9 successo. Da segnalare, la coltura dei batteri, a temperatura più bassa (30 ° C), con una velocità inferiore agitazione (180-200 giri al minuto) può ridurre la possibilità di ITR ricombinazione.

È essenziale garantire che le cellule HEK293 sono sani per la trasfezione di successo e confezionamento rAAV9. cellule "sane" di solito sono altamente proliferative e crescono rapidamente. Tuttavia, rapida proliferazione e la crescita delle cellule HEK293 non garantisce necessariamente l'alta efficienza di confezionamento rAAV9. Pertanto, è importante iniziare gli esperimenti con cellule fresche. essosi consiglia di utilizzare a basso passaggio HEK293 cellule (<10 passaggi, le cellule sono diversi passaggi ogni 2-3 giorni) per l'imballaggio rAAV9. Di nota, possono avere bisogno di essere purificati mediante procedure diverse altre 32 sierotipi di rAAV.

L'investigatore è concessa flessibilità nella generazione di plasmidi rAAV9. In entrambi i casi la legatura di restrizione sito-mediata o montaggio Gibson può essere utilizzato 30. Per la costruzione rAAV9.U6 :: shRNA, la strategia di assemblaggio basato intra-molecolare Gibson è un metodo efficace (figure 1 e 2). Più plasmidi AAV-shRNA o pool AAV-shRNAs possono essere rapidamente costruiti. Per iperespressione di geni utilizzando rAAV9, esiste un limite di dimensione per le sequenze di cDNA inseriti. Generalmente, il frammento dimensioni tra ITR deve essere inferiore a 5 kb 33. Splicing proteina inteina-catalizzata può essere usato per aggirare il limite di dimensione confezionamento di rAAV9 vettori 34.

Altro sistema virales, tra cui retrovirus, lentivirus e adenovirus, sono stati sviluppati e consentire la manipolazione genetica flessibile. Rispetto a questi diversi tipi di vettori virali, rAAV ha vantaggi specifici: ad alta efficienza, alta specificità, basso tasso di integrazione genomica, minimali immunogenicità e patogenicità minima. Così, l'ingegneria del genoma rAAV-based sta emergendo come uno strumento ideale per in vivo manipolazione genetica.

Studi precedenti hanno dimostrato che il sistema rAAV9 consente l'efficiente espressione di geni consegnati in vivo. Con il promotore cTnT (pollo TnnT2), genica specifica del cuore è stato ottenuto (Figura 4) 25,26. Sebbene il promotore U6 è ubiquitariamente attivo nei tessuti di topo, un'inibizione più evidente di mRNA (Trbp) da rAAV9.U6 :: shRNA stata osservata nel cuore, ma non in altri organi (Figura 5). Il fegato è l'organo più comune trasdotto da diversi sierotipi dirAAV 35,36. Tuttavia, l'efficienza knockdown (riduzione del 36% del livello di mRNA) nel fegato è molto inferiore a quella nel cuore (riduzione del 68% del livello di mRNA). Questo è coerente con il precedente studio dimostra che, nonostante la crescita presenza genoma virale nel fegato, consegna sistemica di shRNA da rAAV9 fornisce gene più efficiente atterramento nel cuore 35. È possibile che gli epatociti sono più proliferative di cardiomiociti e sono più attivamente in fase di divisione cellulare dopo somministrazione rAAV9 all'età neonatale, che si traduce in una sostanziale diluizione delle genoma vettoriale nel tessuto epatico. Tuttavia, questo suggerisce anche che il sierotipo di rAAV9 può più efficiente trasdurre cardiomiociti in confronto ad altri tipi di cellule. Come dimostrato da Lovric et al., Nei miociti differenziati, la risposta danni al DNA MRN proteine complesse sono repressi. MRN proteine ​​complesse legano genomi AAV e inibiscono AAV trasduzione attraverso silenziamento trascrizionale. Così, permissivity di AAV trasduzione può essere indotta dalla differenziazione terminale dei cardiomiociti 36, rendendo il sistema rAAV9, rispetto ad altri vettori virali, molto adatti per la manipolazione genica nel cuore. Per ridurre ulteriormente gli effetti indesiderati atterramento in altri organi (ad esempio, il fegato), si può anche usare cardio-specifica shmiR a base di miR-30a cTnT promotore-driven per reprimere i geni di interesse nel cuore 29. Questo manoscritto fornisce al lettore le tecniche specifiche per capitalizzare sulla tecnologia rAAV9 nelle indagini cardiovascolari.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics