Préparation de rAAV9 à surexpriment ou Knockdown gènes dans les coeurs de souris

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Contrôle de l'expression ou l'activité de gènes spécifiques grâce à la prestation myocardique du matériel génétique dans des modèles murins permet l'étude des fonctions des gènes. Leur potentiel thérapeutique dans le coeur peut également être déterminée. Il existe des approches limitées d'intervention moléculaire in vivo dans le coeur de la souris. Recombinant virus adéno-associé (rAAV) à base de l' ingénierie des génomes a été utilisé comme un outil essentiel pour la manipulation génétique cardiaque in vivo. Les avantages spécifiques de cette technologie incluent une grande efficacité, une spécificité élevée, le faible taux d'intégration génomique, minimal l'immunogénicité et le pouvoir pathogène minimal. Ici, une procédure détaillée pour construire, ensemble, et purifier les vecteurs rAAV9 est décrit. l'injection sous-cutanée de rAAV9 dans les petits nouveau-nés se traduit par une expression robuste ou knock-down efficace du gène (s) d'intérêt dans le cœur de souris, mais pas dans le foie et d'autres tissus. Utilisation de la spécifi cardiaquec promoteur TnnT2, une expression élevée du gène de la GFP dans le coeur a été obtenu. En outre, la cible de l'ARNm a été inhibée dans le coeur quand un rAAV9-U6-shRNA a été utilisé. la connaissance de la technologie rAAV9 travail peut être utile pour les enquêtes cardiovasculaires.

Introduction

Contrôle de l' expression ou l' activité de gènes spécifiques dans divers systèmes biologiques est devenue une stratégie intéressante pour l'étude de la fonction du gène 1. Un moyen direct d'atteindre cet objectif consiste à manipuler des séquences de nucléotides et de générer des alleles mutants. Bien que la fabrication précises, des changements ciblés dans le génome des cellules vivantes est encore un temps et la pratique de main-d'œuvre, le développement des outils Talen et CRISPR / cas9 puissants a ouvert une nouvelle ère de l' édition du génome 2-5. Une méthode de laboratoire plus de routine pour la manipulation génétique a mis l' accent sur l'introduction de matériaux génétiques (ADN et ARN contenant des séquences codantes ou siRNA / shRNA) dans les cellules pour exprimer ou knockdown gène (s) d'intérêt 1,6.

Dans de nombreux cas, le principal goulot d'étranglement pour la manipulation génétique est la délivrance d'ADN, d'ARN ou de protéine dans les cellules. En ce qui concerne les études in vitro, l' efficacité transfectisur les systèmes ont été mis en place dans de nombreuses lignées cellulaires cultivées. Cependant, dans le modèle de souris , en particulier, l' administration in vivo de gènes est plus difficile. Il existe une série de barrières extra- et intracellulaires qui doivent être court-circuité afin d'obtenir une absorption cellulaire efficace des réactifs exogènes. Obstacles supplémentaires comprennent le jeu rapide et la courte durée de la matériaux 7,8 livrés. Une stratégie pour contourner ces problèmes est d'utiliser des vecteurs viraux comme «porteurs» ou «véhicules» pour la livraison de gènes in vivo. Les propriétés de transduction naturellement évolué de virus permettent la prestation efficace d'un gène d'intérêt dans les cellules 7,9,10. De nombreux types de vecteurs viraux ont été développés et permettent flexible dans la manipulation génétique in vivo dans des types et des organes différents de cellules chez la souris.

Les systèmes viraux les plus couramment utilisés comprennent Rétrovirus, lentivirus, adénovirus et virus adéno-associé (AAV) 12-14. Cependant, de nombreux types de retrovirus seulement infectent les cellules en division, et leur efficacité dans les cellules non en division 15 est très faible. Cela limite leur utilité pour la délivrance de gènes. Lentivirus est un genre de la famille des Retroviridae. Différent des autres retrovirus, lentivirus peut infecter les cellules en division et ne se divisant pas et a été largement utilisé pour le transfert de gènes dans des post-mitotiques et des cellules hautement différenciées 16. Le cycle de vie de lentivirus implique également l'intégration de l'ADN du vecteur dans le génome hôte. Ainsi , la délivrance de gènes, médié par lentivirus permet une expression stable et de longue durée des éléments génétiques transduites 16-18. Toutefois, cette fonctionnalité peut représenter une double-eépée DGED dans l'utilisation de ces virus pour manipuler l'expression génique, comme l'intégration de l'ADN du vecteur peut conduire à la mutagenèse insertionnelle dans les cellules hôtes et peut provoquer des effets artefactuelles. Adénovirus est un autre système de délivrance de gènes largement utilisé. Contrairement à retrovirus et lentivirus, adénovirus sont non-intégrés et ne pas interférer avec l'intégrité génomique des cellules hôtes 8,10,11,19. En outre, les adenovirus peut transfecter l' ADN dans de nombreux types cellulaires, et l' infection ne dépend pas de la division cellulaire active 19. Une autre caractéristique importante de adenovirus est la facilité de purification des vecteurs, comme les vecteurs viraux sont capables de répliquer 19,20. Toutefois, la mise en garde importante de ce système est que l' infection par adenovirus peut déclencher de fortes réponses immunitaires dans des cellules et des organes cibles de 19, ce qui limite son utilisation dans de nombreuses recherches, notamment dans les études de thérapie génique.

Par rapport à ces différents typess des vecteurs viraux, le virus adéno-associé recombinant (rAAV) semble être le système de délivrance de gènes idéal 21,22. Il présente une immunogénicité minimale et 23,24 pathogénicité. En outre, le rAAV infecte une large gamme de types de cellules, y compris à la fois de division et des cellules non en division. Dans la plupart des cas, rAAV ne pas intégrer dans les génomes d'accueil; ainsi, le risque de changements génétiques ou génomiques indésirables dans les cellules cibles est faible 22.

Récemment, les systèmes de rAAV ont été utilisés avec succès pour la fourniture de protéines de l'ADN codant, miARN, shRNA et CRISPR-ARNg in vivo dans le muscle cardiaque souris 23,25-29. Cette méthodologie a permis recherches fondamentales et les études de thérapie génique dans le domaine de la recherche cardiovasculaire. Ici, la procédure détaillée pour générer des vecteurs rAAV9 qui surexpriment ou knockdown les gènes d'intérêt dans les cœurs de souris a été décrit de manière efficace. Le protocole fournit une méthode simple et efficace dela manipulation de l'expression du gène cardiaque dans des modèles expérimentaux murins.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les étapes décrites ont été réalisées dans les protocoles approuvés par le Comité de biosécurité et le soin et l'utilisation des animaux Commission institutionnelle de l'Hôpital pour enfants de Boston. Hôpital pour enfants de Boston possède des installations de souris exemptes d'agents pathogènes avec cycles lumière / obscurité réglementés et le contrôle du climat. cages de changement personnel vétérinaire et de soins des animaux et assurer la santé des souris. Les installations sont AAALAC certifié et avoir la certification du bien-être des animaux Assurance active (AAALAC accréditation accordée sur 24/02/1992 Animal Welfare Assurance numéro:. A3303-01). Les souris ont été euthanasiées par le CO 2 délivré par une source de gaz comprimé. Des échantillons de tissus ont été recueillis après avoir confirmé que la fréquence cardiaque, le mouvement et la respiration des animaux avait cessé. Rongeurs néonatales sont résistants au CO 2 et l' euthanasie ont été euthanasiés par décapitation à l' aide des ciseaux pointus. Ces méthodes sont en accord avec les recommandations du Groupe sur l'euthanasie du vétérinaire Medica américainel Association.

1. Génération de constructions rAAV9 par clonage d'un ADNc ou d'shRNA cassette d'expression dans le squelette plasmidique

NOTE: Le plasmide rAAV9 contenant les répétitions terminales inversées (ITR) de AAV2, utilisés pour la surexpression du gène a été modifié pour abriter le TNNT2 de poulet promoteur (rAAV9.cTNT), qui permet l' expression spécifique des cardiomyocytes de gènes transduits 25,26,29. Des sites uniques Kpnl et Nhel ont été introduits dans le plasmide, en aval du promoteur. Les fragments d'ADNc codant pour les gènes d'intérêt peuvent être clones dans le squelette rAAV9 l' utilisation de ces deux sites de restriction 25,26,29. Ici, à titre d'exemple, le vecteur rAAV9 pour la surexpression du gène de la GFP dans les cœurs de souris a été générée. Le plasmide résultant contient le cTNT de la cassette de la GFP , flanqué de deux ITR sites (figure 1). constructions rAAV9.U6 :: shRNA ont été utilisés pour le gène knockdown 25. Conception shRNA utilisantserveurs de conception shRNA ligne. rAAV9.U6 :: shRNA peuvent être générés soit par recuit et en ligaturant oligos contenant des séquences d'ADN shRNA dans l'enzyme de restriction digéré rAAV9 vecteurs hébergeant le promoteur U6, ou à long terme PCR et intra-moléculaire à base d'assemblage Gibson "transparente" construction 30. Le plasmide résultant doit contenir la cassette shARN U6 flanqué de deux ITR sites (figure 2). Ici, à titre d'exemple, le vecteur rAAV9.U6 :: shRNA a été construit pour knockdown PBRT ARNm (séquence PBRT shRNA: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). Une bousculade shRNA a été utilisé comme témoin négatif (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Clone la cassette d'expression de l'ADNc ou shRNA dans le squelette plasmidique rAAV9. Transformer l'ADN dans des cellules E. coli compétentes 25.
    REMARQUE: Utilisez stbl2 ou stbl3 cellules E. coli pour transformation rAAV9 ADN pour minimiser indésirable ITR recombinaison.
  2. Ramasse leclone positif à partir des cellules E. coli transformées. Amplifier la culture dans 500 ml de milieu Lilly-Barnett et extraire le plasmide rAAV9 à partir des cellules bactériennes 25-30.
    NOTE: Midi / Maxi prép le plasmide rAAV9 pour obtenir une grande quantité d'ADN (> 100 pg). Avant de générer le virus, toujours analyser l'intégrité de la séquence des plasmides AAV par digestion de restriction et électrophorèse sur gel d'agarose, comme précédemment décrit (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfection de cellules HEK293 avec rAAV9 Plasmides

  1. Préparer 1 ug / ul linéaire polyéthylènimine (PEI) solution. Dissoudre la poudre PEI dans dH sans endotoxine 2 O qui a été chauffé à 70-80 ° C. Après refroidissement jusqu'à la température ambiante, neutraliser la solution à pH 7,0 avec du HCl 1 M. Stériliser par filtration (0,22 um) la solution. Aliquoter le / ul PEI solution mère 1 pg (1,400 ul / tube) et stocker le solution à -20 ° C.
  2. La culture des cellules HEK293 dans le milieu de Eagle modifié par Dulbecco (DMEM) avec 10% de sérum bovin fœtal (FBS) et 1% de pénicilline / streptomycine. La culture des cellules dans un incubateur à 37 ° C avec 5 ± 0,5% de dioxyde de carbone (CO 2).
  3. Au jour 0, plaque cellules HEK293 en dix plats de 150 mm 18-20 h avant la transfection par fractionnement> 90% de cellules confluentes dans une dilution 1: 2.
    NOTE: Au jour 1, les cellules devraient atteindre 90% de confluence.
  4. Au jour 1, transfecter des cellules HEK293 avec le plasmide rAAV9 (par exemple, rAAV9.cTNT :: GFP ou rAAV6.U6 :: shRNA construit), Ad-Helper plasmide, et le plasmide AAV-Rep / Cap utilisant PEI 25,26,29.
    1. Pour 10 boîtes de cellules à 90% de confluence, mélanger 70 pg de AAV-Rep / Cap plasmide, 70 pg pf rAAV9 plasmidique, et 200 pg d'Ad-Helper plasmide dans un tube centrifuge de 50 ml.
    2. Si les cellules sont moins confluentes, ajuster la quantité d'ADN proportionnellement. Par exemple, si les cellules sont confluentes à 75%, de réduire laquantité d'ADN proportionnellement (75/90 du montant indiqué à l'étape 2.4.1): mélanger 70 x 75/90 = 58,3 pg de AAV-Rep / Cap plasmide, 70 x 75/90 = 58,3 pg de rAAV9 plasmidique, et 200 x 75/90 = 166,7 pg de Ad-Helper plasmide dans un tube centrifuge de 50 ml.
    3. Ajouter 49 ml de RT DMEM (sans FBS) pour le tube de 50 ml et bien mélanger.
    4. Ajouter 1360 pi de solution de PEI pour rendre le PEI: rapport de l'ADN (v / w) 4: 1. Bien mélanger. Incuber à température ambiante pendant 15 - 30 min.
    5. Ajouter 5 ml du mélange préparé dans l'étape 2.4.4 pour chaque plat de 150 mm (50 ml du mélange pendant dix plats de 150 mm).
  5. La culture des cellules dans un incubateur à 37 ° C avec 5 ± 0,5% de CO2 pendant 60-72 heures.

3. Récolte de transfectées HEK293 cellules et purification des vecteurs rAAV9

  1. Récolter les cellules 60-72 h après transfection. Et déloger les cellules en suspension dans les boîtes par pipetage vers le haut et vers le bas avec le milieu de culture. Transférer toutes les suspensions cellulaires stériles àdes tubes de 50 ml.
  2. Centrifuger les cellules à 500 xg pendant 5 min. Remettre en suspension le culot de cellules avec 5 ml de PBS dans chaque tube et mélanger tous les suspensions de cellules dans un tube de 50 ml.
  3. Centrifuger les cellules à 500 xg pendant 5 min. Jeter le surnageant. A ce stade, stocker le culot cellulaire à -80 ° C ou immédiatement purifier l'AAV à partir du culot, comme décrit dans les étapes 3.4-3.15.
  4. Préparer le tampon de lyse: NaCl 150 mM et du Tris-HCl 20 mM, pH 8,0. Stériliser par filtration (0,22 uM). Conservez le tampon à 4 ° C.
  5. Remettre en suspension la pastille avec 10 ml de tampon de lyse.
  6. Congeler le lysat à -80 ° C ou dans le bain de glace / éthanol sec, puis décongeler à 37 ° C. Au vortex pendant 1 min. Congeler et décongeler le lysat 3 fois.
  7. Ajouter une solution de MgCl 2 au lysat décongelé (marque la concentration finale de MgCl2 dans le lysat soit 1 mM). Ajouter la nuclease à une concentration finale de 250 U / ml. Incuber à 37 ° C pendant 15 minutes pour dissoudre l'ADN / protéine agrdéléga-.
    NOTE: Si l'agrégation ADN / protéine ne soit pas dissous après le traitement à la nucléase ou endonucléase, dounce homogénéiser les lysats 20 fois.
  8. Centrifuger l'échantillon à 4800 xg pendant 20 min à 4 ° C. Recueillir le surnageant.
  9. Pendant ce temps, préparer la solution gradient iodixanol:
    1. Préparer les 17% de la solution de gradient en mélangeant 5 ml de PBS, 10 x 0,05 ml de 1 M de MgCl2, 0,125 ml de KCl 1 M, 10 ml de NaCl 5 M et 12,5 ml ofdensity milieu dégradé. Ajuster le volume total à 50 ml à l' aide de H 2 O.
    2. Préparer la solution à 25% en mélangeant 5 ml de 10 x PBS, 0,05 ml de 1 M de MgCl2, 0,125 ml de KCl 1 M, 20 ml de milieu à gradient de densité, et 0,2 ml de 0,5% (p / v) de rouge de phénol. Ajuster le volume total à 50 ml à l' aide de H 2 O.
    3. Préparer la solution à 40% en mélangeant 5 ml de PBS, 10 x 0,05 ml de 1 M de MgCl2, 0,125 ml de 1 M de KCl et 33,3 ml de milieu de gradient de densité. Ajuster le volume total à 50 ml en utilisantH 2 O.
    4. Préparer la solution à 60% en mélangeant 0,05 ml de 1 M de MgCl2, 0,125 ml de KCl 1 M, 50 ml de milieu à gradient de densité et de 0,1 ml de 0,5% (p / v) de rouge de phénol.
  10. Avec une aiguille et une seringue, charger la solution à gradient iodixanol dans le tube en polypropylène de l'ordre de 5 ml de 17%, 5 ml de 25%, 5 ml de 40% et 5 ml de 60%, à partir du bas. Chargez tout le lysat obtenu à l'étape 3.8 (14-16 ml) sur le dessus du gradient. Le gradient, répertorié du bas vers le haut, est de 60%, 40%, 25%, 17%, et la couche de lysat. Remplir le tube avec un tampon de lyse et le couvrir avec le bouchon.
  11. Centrifugeuse à 185.000 xg pendant 90 min à 16 ° C.
  12. La récolte de la fraction virale (40% de la couche) avec une seringue. Insérer l'aiguille (21 gauge) dans l'intersection entre les 40% et 60% de fractions, seule l'aspiration de la couche de 40%.
    REMARQUE: Eviter l'aspiration TOUT de la couche de 25%.
  13. Mélanger la fraction virale avec stérilisé polyoxyéthylène- polyoxyproune solution de copolymère séquencé de propylène PBS (10% de polyoxyéthylène-polyoxypropylène un copolymère bloc stock 1: 10000 dilué dans du PBS) jusqu'à un volume total de 15 ml. Chargez le mélange dans le tube de filtre (MW = coupure 100 kD). Centrifuger à 2000 xg pendant 30 min à 4 ° C.
  14. Jeter la solution au fond. Remplir le tube de filtre avec une solution de PBS copolymère séquencé polyoxyéthylène-polyoxypropylène à un volume total de 15 ml. Centrifuger à 2000 xg pendant 20 min à 4 ° C. Répétez cette étape deux fois plus. Recueillir le virus rAAV9 purifié (la fraction au-dessus du filtre).
  15. Transférer le rAAV9 purifié dans le tube de filtre dans des tubes de 1,7 ml. Aliquoter le rAAV9 purifié (100-400 ul / tube selon le volume et le titre du VAA) et stocker le virus à -80 ° C.
    REMARQUE: Éviter le gel-dégel répétés.

4. Mesure du titre d'rAAV9

  1. Préparer des échantillons d'ADN standard.
    1. Conception PCR spécifique et efficaceamorces pour les vecteurs rAAV9 et optimiser la condition PCR.
      NOTE: Les amorces utilisées dans cette étude sont "Forward: TCGGGATAAAAGCAGTCTGG; inverse: TCGGACGGAGATACGTGAGT". La réaction PCR a été réalisée dans les conditions suivantes: dénaturation initiale à 95 ° C pendant 3 min; 35 cycles de 95 ° C pendant 20 s, 60 ° C pendant 15 s et 72 ° C pendant 10 secondes; et l'extension finale à 72 ° C pendant 10 min. Cependant, les amorces optimisées et des conditions de PCR sont spécifiques à un plasmide que la séquence d'encart dans le vecteur rAAV9 peut affecter la spécificité et l' efficacité de la PCR 31.
    2. Effectuer la réaction PCR avec les conditions indiquées à l'étape 4.1.1. On purifie le produit de PCR avec un kit d'extraction de gel.
    3. Mesurer la concentration de l'ADN purifié à l'aide d'un spectrophotomètre. Calculer la concentration en nombre moléculaire d'ADN sur la base du poids moléculaire / longueur du produit de PCR.
      1. Calculer la concentration moléculaire en utilisant l'équation suivante: mola concentration léculaire (molécules d'ADN ou des fragments / ml) = 6,23 x 10 x 23 -1 mol Con. x 10 -6 / MW. Note: (6,23 x 10 23 mol -1 est le nombre d'Avogadro, la concentration d' ADN .: Con en pg / ml; .: MW poids moléculaire en g / mol). Par exemple, si la concentration obtenue du produit de PCR est de 100 pg / ml et sa longueur est de 200 pb, dont la masse moléculaire de l'ADN double brin est de 2 x 200 x 310 = 124000 (le poids moléculaire moyen de chaque nucléotide dans la ADN simple brin est d'environ 310 g / mol). La concentration moléculaire (molécules d'ADN / ml) = 6,23 x 10 -1 mole 23 x 100 pg / ml x 10 -6 / 124000 g / mol = 5,18 x 10 14 molécules d' ADN / ml.
      2. Effectuer une série de dilutions du fragment d'ADN et de préparation des échantillons standards, avec des concentrations de 10 13 molécules / ml, 10 12 molécules / ml, 10 11 molécules / ml, 10 10 molécules / ml, 10 9 molécules / ml, 10 7 molécules / ml. Utilisez 1 pl de solution pour chaque échantillon standard pour la PCR quantitative (qPCR, à l'étape 4.6).
  2. Mélanger 5 pi de solution de rAAV9 purifiée avec 5 pi de 10 x tampon de DNAse 1 pi de DNAse (10 000 U / ml) et 39 pi de ddH 2 O. Le volume total doit être de 50 ul.
  3. Incuber le flacon à 37 ° C pendant 30 min pour éliminer l'ADN plasmidique résiduel non emballés.
  4. Inactiver la DNase à 95 ° C pendant 10 min. Refroidir la solution, ajouter 44 pi de H 2 O, 5 pi de 10x tampon de DNAse et 1 pl de Proteinase K stock (10 mg / ml).
  5. Incuber la solution à 50 ° C pendant 2 heures. Arrêter la réaction et inactiver la proteinase K à 95 ° C pendant 10 min.
  6. Utilisez 1 pl de l'échantillon pour l'essai de PCR quantitative (qPCR). Calculer le titre.
    1. Exécutez la PCR quantitative (qPCR) avec les amorces conçues à l'étape 4.1.1 en utilisant les échantillons from étape 4.1.4 (échantillons standards) et de l'étape 4.5 (échantillons à mesurer).
      1. Pour chaque réaction, mélanger 10 ul de 2x master mix vert (contenant la Taq polymérase, dNTP mix, tampon, MgCl 2, et le colorant vert), 0,5 pi de l' amorce sens (5 uM), 0,5 pi de l' amorce inverse (5 uM), 8 ul de H2O et 1 ul de l'échantillon à mesurer. Effectuer qPCR avec les conditions suivantes: maintenir les échantillons à 50 ° C pendant 2 min et 95 ° C pendant 10 min; effectuer 40 cycles à 95 ° C pendant 15 secondes et à 60 ° C pendant 1 min; pour la phase de fusion, incuber les échantillons à 95 ° C pendant 30 s et 60 ° C pendant 15 secondes. Générer la courbe standard basée sur les numéros des échantillons standards (figure 3) C T.
    2. Calculer la concentration moléculaire / titre de l'échantillon de l'AAV contre la courbe standard. Le rAAV9 a un génome d'ADN simple brin, de sorte que la concentration moléculaire sera 2 fois plus élevée que lavaleur calculée (2x puissance (10, y), figure 3B). En outre, le titre de la rAAV9 purifiée sera 20 fois supérieure à ce qui est obtenu à partir du calcul en raison de la dilution 1:20 du virus dans des réactions de DNAse et de la proteinase K (5 pl dans 100 pl total).

5. rAAV9 Injection chez les souris néonatales Assays Gene Expression dans le coeur

  1. Préparer des solutions de travail rAAV9 en solution PBS copolymère séquencé polyoxyéthylène-polyoxypropylène. Faites le stock de virus avec les titres de 1-7 x 10 12 particules / ml.
    NOTE: Livrer 50-70 pi de solution rAAV9 dans chaque postnatale jour 0,5-1,5 souris par injection sous-cutanée. Pour parvenir à une surexpression de gènes efficace ou knockdown, il est recommandé d'effectuer un test pilote pour chaque étude afin d'optimiser la quantité de AAV injectée. Utilisez la même quantité de rAAV9.cTNT :: Luc ou contrôle rAAV9.U6 :: scramble pour chaque étude afin de minimiser les biais.
    NOTE: Nous avons utilisé 1-1,5x 10 11 particules / chiot pour surexpression et de 2,5 à 5 x 10 11 particules / chiot pour effet de choc dans jour postnatal 0,5-1,5 mi CE).
  2. Traiter les souris néonatales avec rAAV9 à P0.5-P2.5 par injection sous - cutanée.
    1. Pré-remplir un 29G1 / 2, 0,33 x 12,7 mm seringue à insuline avec la solution rAAV9. Veillez à éliminer les bulles d'air.
    2. Tenir le chiot cryo-anesthésiés dans une main avec le pouce et l'index. Avant l'injection, faites glisser la peau du dos du chiot avec un bâton de tampon saturé avec 70% d'alcool isopropylique pour maintenir l'état stérile. Insérer l'aiguille de la seringue dans l'hypoderme antéro-postérieure de l'animal à un angle de 5 à 10 °. Injecter 50 à 70 ul de la solution rAAV9 en utilisant la seringue à insuline.
      NOTE: rAAV9 peut également être livré à la souris par injection intrapéritonéale ou intraveineuse 26,27. L'expression efficace des gènes délivrés dans le coeur peut être obtenu. Cependant, inject intrapéritonéaleion peut parfois se traduire par l'expression qui fuit dans le foie. Après l'injection, l'état des chiots a été surveillée tous les jours.
  3. Le niveau d'expression des gènes dans le coeur peut être contrôlé avec qPCR, immunofluorescence, ou western blot (résultats représentatifs sont présentés dans les figures 4 et 5) 25,26.
    REMARQUE: Les souris ont été euthanasiées par le CO 2 délivré par une source de gaz comprimé. Des échantillons de tissus ont été recueillis après avoir confirmé que la fréquence cardiaque, le mouvement et la respiration des animaux avaient cessé. Rongeurs néonatales sont résistants au CO 2 et l' euthanasie ont été euthanasiés par décapitation à l' aide des ciseaux pointus. La méthode est conforme aux recommandations du Groupe d'experts sur l'euthanasie de l'American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Les stratégies pour la construction rAAV9 de rAAV9.cTNT :: GFP ou plasmides rAAV9.U6 :: shRNA sont présentés dans les figures 1 et 2, respectivement. Comme les exemples, le vecteur a été généré rAAV9 pour surexprimer le gène de la GFP dans les cœurs de souris. Le plasmide résultant contient le cTNT de la cassette de la GFP , flanqué de deux ITR sites (figure 1). Le vecteur rAAV9.U6 :: shRNA a été construit pour knockdown TRBP ARNm (Figure 2)

La courbe standard pour rAAV9 titration a été généré avec les données qPCR par régression linéaire. La grandeur de réglage y représente la valeur Log 10 de la concentration moléculaire de l' ADN de chaque échantillon standard, et la variable x correspondant représente la valeur C T. Les 10 (concentration) des valeurs log (y) et les numéros C T (x) présentent une belle corrélation linéaire (R 2 = 0,9971) et adapter à l'équation y = -0.2832x + 14.616 (figure 3A). Les titres des échantillons rAAV9 ont été calculés sur la base de l'équation linéaire (figure 3B). Avec la méthode décrite dans le protocole (étape 4.6.2 et la figure 3B), un titre élevé de vecteurs rAAV9 (50-200 ul,> 6 x 10 13 particules / ml) ont été obtenus dans l'étude représentative.

Pour surveiller l'efficacité et la spécificité tissulaire des vecteurs rAAV9.cTNT, chiots P0.5 ont été traités avec la même quantité (1 x 10 11 particules / chiot) de rAAV9.cTNT :: luciférase (AAV-Luc) ou rAAV9.cTNT :: GFP (AAV-GFP) par injection sous-cutanée. Deux semaines après l'injection, le signal de la GFP a été contrôlé dans divers tissus des souris. Une expression robuste de la GFP a été détectée dans le cœur, mais pas dans d' autres organes (Figure 4, n> 3). Ainsi, l'expression génique efficace et spécifique à cœur a été atteint avec le vecteur rAAV9.cTNT.

jove_content "fo: keep-together.within-page =" 1 "> Pour contrôler l'efficacité knockdown et la spécificité tissulaire de vecteurs rAAV9.U6, les souris P0.5 ont été traités avec la même quantité (3 x 10 11 particules / chiot) de rAAV9 .U6 :: bousculade (AAV bousculade) ou rAAV9.U6 :: PBRT shRNA (AAV shTrbp) par injection sous - cutanée. Deux semaines après l' injection, l' expression de PBRT dans divers tissus a été contrôlée par PCR quantitative (figure 5, n = 3 règlement). le niveau d'ARNm de PBRT dans le coeur a été sensiblement réduite par rAAV9.U6 :: shTrbp (68% de la régulation négative, P = 0,0004452). en bas de PBRT a également été détectée dans le tissu hépatique de rAAV9.U6 :: shTrbp-traité chez la souris. Cependant, la variation est beaucoup plus faible.

Figure 1
Figure 1: Les stratégies de construire le rAAV9.cTNT :: GFP plasmide. (A) Le schéma de la cTNT de la cassette GFP. (B TNNT2 de poulet (rAAV9.cTNT) suivi des deux sites uniques de restriction (Nhel et Kpnl). Le cadre de lecture ouvert de la GFP a été cloné dans le vecteur rAAV9.cTNT par restriction médiée site ligature pour générer le plasmide rAAV9.cTNT :: GFP. (B) Le plasmide rAAV9.cTNT :: GFP peut être construit par assemblage Gibson. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2: Les stratégies de construire le rAAV9.U6 :: shRNA Plasmid. (A) Le régime de l'U6 :: Cassette shRNA est affichée. L'expression de shRNA est entraînée par le promoteur U6 (bleu). (B) des cassettes rAAV9-U6-shRNA peuvent être générés par recuit et ligature des oligonucleotides d'ADN contiennentséquences dans l'enzyme de restriction digéré rAAV9 vecteurs hébergeant le promoteur U6 ing shRNA. (C) rAAV9.U6 :: cassettes shRNA peuvent être générés par une longue gamme PCR et intra-moléculaire Gibson basée assemblage "seamless" construction. Le bras 5 ', en boucle, et 3' bras de shRNA sont indiquées en vert, orange et rouge, respectivement. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3: Calcul de la rAAV9 Titer. (A) La courbe standard pour rAAV9 titration a été générée par l' agression linéaire en utilisant les données qPCR. La grandeur de réglage y représente la valeur Log 10 de la concentration moléculaire de l' ADN de chaque échantillon standard, et la variable x correspondantreprésente la valeur C T. (B) Les titres des échantillons rAAV9 sont calculés sur la base de l'équation linéaire de la courbe standard. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4: Expression Motif de rAAV9.cTNT :: GFP dans les tissus de souris. Chiots P0.5 ont été traités avec la même quantité (1 x 10 11 particules / chiot) de rAAV9.cTNT :: luciférase (AAV-Luc, le contrôle négatif) ou rAAV9.cTNT :: GFP (AAV-GFP) par injection sous - cutanée. Deux semaines après l'injection, les échantillons de tissus ont été récoltés. Expression de la GFP a été contrôlée sous un champ de dissection fluorescent. Les deux images de champ et de fluorescence lumineux sont présentés. Les expériences ont été répétées plus de 3 fois (n> 3).Barre d'échelle = 2,0 mm. SKM, le muscle squelettique. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 5
Figure 5: Knockdown Expression génique avec AAV-shRNA. Souris P0.5 ont été traités avec la même quantité (3 x 10 11 particules / chiot) de rAAV9.U6 :: Scramble (AAV-Scramble) ou rAAV9.U6 :: TRBP shRNA (AAV-shTrbp) par injection sous - cutanée. Deux semaines après l'injection, les taux d'ARNm de PBRT dans divers tissus ont été suivis par qPCR (n = 3). Les données sont présentées comme la moyenne ± SEM. La valeur de coupure P est de 0,05. NS, P> 0,05, non significatif. **, P <0,01. SKM, le muscle squelettique. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il est important de réduire au minimum la recombinaison indésirable ITR lors de la construction du plasmide. Avant de générer le virus, il faut toujours surveiller l'intégrité ITR des plasmides AAV en utilisant une digestion de restriction et électrophorèse sur gel d'agarose. Il est impossible d'obtenir 100% des plasmides intacts, mais le taux de recombinaison doit être minimisée autant que possible. Moins de 20% est acceptable pour le succès de l'emballage rAAV9. À noter, la culture des bactéries à plus basse température (30 ° C) avec une vitesse d'agitation inférieure (180-200 rpm) peut réduire le risque de recombinaison ITR.

Il est essentiel de veiller à ce que les cellules HEK293 sont en bonne santé pour la transfection réussie et l'emballage rAAV9. cellules "saines" sont généralement très proliférante et se développent rapidement. Cependant, la prolifération rapide et la croissance des cellules HEK293 ne garantit pas nécessairement la grande efficacité de l'emballage rAAV9. Par conséquent, il est important de commencer les expériences avec des cellules fraîches. IlIl est recommandé d'utiliser à faible passage des cellules HEK293 (<10 passages, les cellules sont repiquées tous les 2-3 jours) pour l'emballage rAAV9. Il convient de noter, peut - être besoin d'être purifiée en utilisant des procédures différentes 32 autres sérotypes de rAAV.

L'investigateur est accordée la flexibilité dans la génération de plasmides rAAV9. Soit ligature site de restriction à médiation ou d' assemblage Gibson peuvent être utilisés 30. Pour la construction rAAV9.U6 :: shRNA, la stratégie intra-moléculaire à base de l' assemblage-Gibson est une méthode efficace (figures 1 et 2). Plusieurs plasmides AAV-shRNA ou mis en commun AAV-shRNA peuvent être construits rapidement. Surexprimer les gènes à l'aide rAAV9, il existe une limitation de taille pour les séquences d'ADNc insérés. En général, le fragment de taille entre les ITR doit être inférieure à 5 kb 33. Intéine catalysée par épissage de protéine peut être utilisée pour contourner la limite de taille d'emballage de vecteurs rAAV9 34.

Autre système virals, y compris les retrovirus, lentivirus et adénovirus, ont également été mis au point et permettent la manipulation génétique flexible. Par rapport à ces différents types de vecteurs viraux, rAAV présente des avantages spécifiques: une grande efficacité, une spécificité élevée, le faible taux d'intégration génomique, minimal l'immunogénicité et le pouvoir pathogène minimal. Ainsi, l' ingénierie des génomes à base de rAAV est en train de devenir un outil idéal pour la manipulation in vivo de gènes.

Des études antérieures ont montré que le système rAAV9 permet l'expression efficace des gènes délivrés in vivo. Avec le promoteur cTNT (TnnT2 de poulet), l' expression de gènes spécifiques à coeur a été obtenu (Figure 4) 25,26. Bien que le promoteur U6 est ubiquitaire actif dans les tissus de souris, une inhibition la plus frappante de l' ARNm cible (PBRT) par rAAV9.U6 :: shRNA a été observé dans le cœur, mais pas dans d' autres organes (figure 5). Le foie est l'organe le plus commun transduction par différents sérotypes derAAV 35,36. Cependant, l'efficacité de knock-down (réduction du taux d'ARNm 36%) dans le foie est beaucoup plus faible que celle dans le coeur (réduction du taux d'ARNm de 68%). Ceci est en accord avec l'étude précédente qui montre que, en dépit de la présence ultérieure du génome viral dans le foie, l' administration systémique de shRNA par rAAV9 fournit gène plus efficace knockdown au cœur 35. Il est possible que les hépatocytes sont plus proliférante que les cardiomyocytes et subissent plus activement la division cellulaire après l'administration rAAV9 à l'âge néonatale, ce qui se traduit par une dilution importante du génome vecteur dans le tissu hépatique. Cependant, cela suggère également que le sérotype rAAV9 peut plus efficacement transduire des cardiomyocytes par rapport aux autres types de cellules. Comme l'a démontré Lovric et al., Dans les myocytes différenciés, la réponse aux dommages de l' ADN des protéines complexes sont réprimées MRN. des protéines complexes se lient les génomes MRN AAV et inhibent la transduction d'AAV par silençage transcriptionnel. Ainsi, parmissivity AAV transduction peut être induite par la différenciation terminale des cardiomyocytes 36, ce qui rend le système de rAAV9, la comparaison à d' autres vecteurs viraux, très approprié pour la manipulation génétique dans le coeur. Pour réduire davantage les effets knockdown indésirables dans d' autres organes (par exemple, le foie), on peut également utiliser cardiaque spécifique shmiR basée à miR-30a cTNT promoteur-driven pour réprimer les gènes d'intérêt dans le cœur 29. Ce manuscrit fournit au lecteur les techniques spécifiques pour capitaliser sur la technologie rAAV9 dans les enquêtes cardiovasculaires.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics