توليف وتوصيف للدواء مساعد الأسبرين-فومرت أن يمنع آخر عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة والثدي خلايا السرطان الجذعية

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

التهاب هو السمة المميزة السرطان الذي يكمن وراء الإصابة بالسرطان والترويج، وتقدم في نهاية المطاف إلى ورم خبيث. لذلك، مضيفا عقار مضاد للالتهابات لأفواج السرطان القياسية قد تحسين نتائج المرضى. وقد تم اكتشاف واحدة من هذه المخدرات، والأسبرين (حمض الصفصاف، ASA)، على الوقاية الكيماوية السرطان والنشاط المضادة للورم. وبالاضافة الى تثبيط انزيمات الأكسدة الحلقية محور 2-البروستاجلاندين، وأيضا نسبت الأنشطة المضادة للسرطان ASA على العامل النووي ĸB (NFĸB) تثبيط. بسبب استخدام ASA لفترات طويلة قد يسبب سمية الجهاز الهضمي، وقد تم تنفيذ استراتيجية دواء مساعد بنجاح. في هذا دواء مساعد تصميم ملثمين حمض الكربوكسيلية من ASA وتدرج فارماكوفور إضافي.

يصف هذا البروتوكول كيفية تصنيعه ودواء مساعد الأسبرين فومرت، GTCpFE، وتتميز تثبيطه لمسار NFĸB في خلايا سرطان الثدي وتخفيف من السرطان الجذعية التي تشبه السليمالعلاقات، والنمط الظاهري NFĸB التي تعتمد على المهم. GTCpFE يمنع بشكل فعال مسار NFĸB في خطوط خلايا سرطان الثدي بينما ASA يفتقر إلى أي نشاط كابح، مشيرا إلى أن إضافة فومرت إلى هيكل ASA يساهم إلى حد كبير في نشاطها. وبالإضافة إلى ذلك، GTCpFE يظهر المضادة للسرطان نشاط كبير الخلايا الجذعية عن طريق عرقلة تشكيل mammosphere والتخفيف من الخلايا الجذعية السرطانية المرتبطة CD44 + CD24 - نمط ظاهري مناعي. هذه النتائج تضع استراتيجية قابلة للتطبيق لتطوير وتحسين العقاقير المضادة للالتهابات لالوقاية الكيماوية وعلاج السرطان.

Introduction

التهاب هو السمة المميزة التي ترتكز عليها جوانب متعددة من تكون الأورام، مثل حدوث والترويج، وتقدم في نهاية المطاف إلى ورم خبيث 1. في سرطان الثدي، ويدعم هذا مزيدا من الملاحظات الوبائية تبين أن الاستخدام المنتظم للأسبرين المخدرات الكلاسيكية غير الستيرويدية المضادة للالتهابات (الاسيتيل حمض الصفصاف، ASA) ويرتبط مع انخفاض في كل من حدوث سرطان الثدي، وخطر ورم خبيث وتكرارها 2،3. ASA يعمل في المقام الأول عن طريق تثبيط انزيمات الأكسدة الحلقية 2-النشاط، والتي غالبا ما upregulated في سرطان الثدي 4،5. ومع ذلك، يمكن أيضا بوساطة تأثيرات مضادة للسرطان ASA عن طريق قمع الشاذة العامل النووي كيلوبايت (عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة ) يشير 6-8. هذا أمر مهم لأن مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة حررت يعزز الورم بقاء الخلية، والانتشار، والهجرة، والغزو، الأوعية الدموية، ومقاومة للعلاج 11/09. عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة تفعيل مسار أمر بالغ الأهمية أيضا لتركيب استجابة مناعية. لذلك، لعلاج مضاد للسرطان التي تتطلب فترات طويلة تثبيط عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة، لا بد من النظر في الآثار الجانبية الضارة التي تنطوي طويلة الأمد قمع المناعي. وبالتالي، قد ASA بمثابة نقطة انطلاق جيدة لتعظيم الاستفادة العلاجية.

واحد الحد لتطبيق ASA في علاج السرطان هو جرعات مرتفعة المطلوبة للانزيمات الأكسدة الحلقية 2 وعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة تثبيط، والتي ترتبط مع سمية الجهاز الهضمي، مثل قرحة المعدة ونزيف 12،13. ومع ذلك، وتحويل ASA إلى دواء مساعد كما استر، قد يقلل من سمية الجهاز الهضمي ASA ل. لتعزيز قوة و / أو إضافة وظائف، ويمكن أيضا أن تدمج العناصر الهيكلية إضافية أو فارماكوفور التبعية في تصميم استر دواء مساعد. وأضاف أحد هؤلاء حامل الخاصة الدوائية لتعزيز ASA قوة ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة هو فومرت، الذي أظهرنا سابقا أن من المهم للعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة طريق تثبيط 14،15.

"jove_content"> نحن توليفها ودواء مساعد الأسبرين فومرت 15، GTCpFE، وافترض أن هذا الجزيء الهجين سوف يكون آمنا بعد قويا ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة . نحن اختبار النشاط المضادة للعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة في خلايا سرطان الثدي وقدرته على منع خلايا سرطان الثدي الجذعية (الخلايا الجذعية السرطانية) 15، والتي تعتمد على عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة إشارات من أجل البقاء والنمو 16-21. نجد أن قوة من GTCpFE ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة وتحسنت بشكل ملحوظ خلال ASA 15. وبالإضافة إلى ذلك، وكتل GTCpFE تشكيل mammosphere وخفف من ديوان الخدمة المدنية علامة سطح CD44 + CD24 - نمط ظاهري مناعي، مشيرا إلى أن GTCpFE قادر على القضاء على الخلايا الجذعية السرطانية 15. هذه النتائج هي من يضع دواء مساعد الأسبرين فومرت كعامل فعال مضاد للالتهابات التي يمكن أيضا استهداف الخلايا الجذعية السرطانية الثدي. من حيث العلاج سرطان الثدي، قد يكون GTCpFE القدرة على علاج مرض عدوانية وفتكا.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. توليف من الأسبرين-فومرت دواء مساعد GTCpFE

  1. باستخدام حقنة الغطاس البلاستيكية، وقياس 0.81 مل (20 ملمول) من الميثانول ومزجها في الماء (10 مل) في قارورة أسفل مستديرة. تبريد الخليط الناتج إلى 0 درجة مئوية عن طريق وضع القارورة في حمام الماء المثلج. إضافة الكحول 4 hydroxybenzyl (2.48 ملغ، 20 ملمول) ويحرك الخليط رد فعل حتى حل واضح.
  2. إعداد محلول كلوريد يا -acetylsalicyloyl (3.77 ملغ، 19 ملمول) في التولوين اللامائية (10 مل) من وزنها المبلغ المطلوب من كلوريد يا -acetylsalicyloyl وحلها في مذيب في قارورة منفصلة. باستخدام حقنة الغطاس البلاستيكية، إضافة هذا الحل إلى خليط أعدت في الخطوة 1.1، وترك ردود فعل اثارة في 0 درجة مئوية.
  3. مراقبة رد فعل باستخدام رقيقة اللوني طبقة (TLC). يجب أن يكون لوحات TLC السيليكا كمرحلة ثابتة.
    1. إعداد الطور المتحرك تتكون من 20:80 خلات الإيثيل (AcOEt) / الهكسان. في غرفة TLC(أو وعاء صغير) إضافة 5 مل من المرحلة المتنقلة لتغطية الجزء السفلي من الغرفة.
      ملاحظة: مقدار الطور المتحرك يعتمد على غرفة المحدد. إضافة دائما ما يكفي لتغطية الجزء السفلي، ولكن مرة واحدة يتم وضع TLC الداخل، ينبغي أن خط المذيبات لا يتجاوز الارتفاع حيث رصدت مركبات.
    2. أخذ عينة من ردود الفعل مع حقنة (0.2 مل)، ووضعه في قارورة صغيرة، وتمييع مع خلات الإيثيل (2-3 قطرات). مع نصاب TLC، واتخاذ بعناية عينة من خليط التفاعل المخفف واكتشافه في TLC.
      ملاحظة: يجب أن تكون البقع 1-2 ملم ويجب أن يتم ذلك في أقل 1/4 بوصة من لوحة TLC.
    3. وفي نفس TLC، ضع نقطة من محلول كلوريد O-acetylsalicyloyl (0.2 ملغ في 0.5 مل من خلات الإيثيل) وعلى سبيل المقارنة. مرة واحدة بقع جافة، وضعه في غرفة والسماح لها البعيد حتى الجبهة المذيبات وصلت تقريبا الجزء العلوي من TLC.
    4. خذ TLC خارج، والسماح لها الجافة وتصور ذلك تحت مصباح الأشعة فوق البنفسجية. وREACنشوئها اكتمال عندما يختفي بقعة كلوريد يا -acetylsalicyloyl من خليط التفاعل.
    5. عندما يتم الانتهاء من رد الفعل، وإزالة حمام الماء الجليد، والسماح للرد فعل لإثارة في درجة حرارة الغرفة لمدة 20 ساعة.
  4. مرشح راسب باستخدام القمع بوخنر مع قرص fritted من مسامية متوسطة. ضع الصلبة في قارورة التلألؤ، وترك المجمع في الخلاء بين عشية وضحاها في مجفف في درجة حرارة الغرفة. استخدام خامس أكسيد الفوسفور (P 2 O 5) كما المجففة.
  5. تجف قارورة أسفل مستديرة عن طريق وضعها في الفرن على 80 درجة مئوية لمدة يومين على الأقل قبل إعداد هذا التفاعل. بدلا من ذلك، وختم قارورة مع الحاجز وبيرس مع إبرة متصلة إلى نظام مضخة فراغ. تشغيل المضخة فراغ في وتجفيف قارورة باستخدام بندقية الحرارة. السماح لتبرد، وكرر هذه الخطوة 2 مرات أكثر.
  6. تضخيم بالون باستخدام غاز الأرجون، وتوصيله إلى حقنة بلاستيكية (الذي ح الغطاسكما تم إزالة) مع إبرة. إيقاف مضخة الفراغ وإزالة الإبرة المرتبطة به التي تم إدراجها في دورق كروي المجففة الآن. ادخال الإبرة المتصلة بالون الأرجون من خلال الحاجز ختم دورق كروي.
    1. إضافة 4-hydroxymethylphenol استر 2-acetyloxybenzoic حمض (100 ملغ، 0.349 ملمول)، 4-dimethylaminopyridine (4 ملغ، 0.033 ملمول) وثلاثي الإيثيلامين (53 ملغ، 0.523 ملمول) إلى قارورة منفصلة، ​​ثم حل لهم في رباعي هيدرو الفوران اللامائية (5 مل). مع حقنة بلاستيكية تعلق على الإبرة، إضافة هذا الحل إلى دورق كروي مختومة. تبريد الخليط وصولا إلى 0 درجة مئوية عن طريق وضع القارورة في حمام ماء مثلج.
  7. إلى الخليط السابق، إضافة محلول كلوريد الإيثيل fumaroyl (68 ملغ، 0.419 ملمول) في رباعي هيدرو الفوران اللامائية (5 مل)، وانخفاض الحكيم على مدى 10 دقيقة. تحريك المحلول الناتج في 0-5 درجة مئوية لمدة 2-4 ساعة.
  8. استخراج خليط التفاعل مع خلات الإيثيل (100 مل)، ومحلول ملحي (50 مل). <ر /> ملاحظة: الماء المالح هو محلول مشبع من كلوريد الصوديوم (كلوريد الصوديوم). لإعداده، ووضع 200 مل من الماء في وعاء زجاجي نظيف ثم البدء في إضافة كلوريد الصوديوم (مع التحريك) حتى لا تذوب بعد الآن.
    1. بعد استخراج، وإزالة المرحلة المائية وكرر الخطوة الأخيرة مرتين أخريين.
    2. يجف الخليط بإضافة كبريتات الصوديوم إلى مرحلة العضوية، حتى الصلبة لا تتجمع حتى عندما يحرك الأواني الزجاجية. باستخدام قمع بوخنر آخر مع قرص fritted، تصفية الخليط إلى قارورة أسفل جولة لإزالة كبريتات الصوديوم، ثم تتبخر إلى جفاف باستخدام المبخر الدوار مع درجة الحرارة التي وضعت في 40 درجة مئوية.
  9. باستخدام TLC، وتحديد مرحلة الجوالة المناسبة للاستخدام في العمود اللوني.
    ملاحظة: للحصول على هذه التجربة تم استخدام التدرج من 20:80 AcOEt / الهكسان.
  10. إعداد عمود مع هلام السيليكا والمرحلة المذيبات المناسبة. مرة واحدة تم إضافة المجمع، إضافة طبقة من كبريتات الصوديوم (أو الرمل) إلى protect يتم إضافة عمود مثل المذيبات.
    1. كما يعمل العمود، ومراقبة شطافة من TLC. اكتشاف كل أنبوب اختبار الآخرين كما يتم جمعها من العمود. عندما elutes المنتج من الفائدة، وخلط جميع العينات التي تحتوي على منتج نقي في جولة كبيرة قارورة القاع، وتجفيفها باستخدام المبخر الدوار مع درجة حرارة الحمام وضعت في 40 درجة مئوية.
      ملاحظة: يجب أن تظهر المنتج كمادة صلبة بيضاء.
  11. لتأكيد هيكل GTCpFE، وجمع بروتون والكربون (1 H و 13 مئوية، على التوالي) بالرنين المغناطيسي (NMR) الأطياف النووي وفقا لتعليمات الشركة الصانعة.
    ملاحظة: في هذه الدراسة تم استخدام 400 ميغاهيرتز FT NMR مطياف لجمع 1 H و 13 C الأطياف. تشغيل لا يقل عن 25 بالاشعة في درجة حرارة الغرفة للحصول على قرار بيانات كافية. وكانت القمم NMR لوحظ ما يلي، 1 H NMR (CDCl 3): δ 1.29 (ر، 3 H، 3J = 7.0 هرتز، CH 3)؛ 2.31 (ق، 3 H، CH 3)؛ 4.26 (ف(2)، H، 3J = 7.0 هرتز، كوتش 2)؛ 5.25 (ق، 2 H، اوتش 2)؛ 6.89 (ق، 2 H، HC = CH)؛ 7.19 (م، 3 ه، ع). 7.42 (م، 3 ه، ع). 7.65 (م، 1 ه، ع). 8.22 (اليوم، 1 ه، 3J = 7.8، 4J = 1.2 هرتز، AR). 13 C NMR (CDCl 3) δ: 169.70، 164.86، 164.75، 162.89، 151.28، 150.69، 134.76، 134.32، 133.26، 133.16، 132.25، 129.81، 126.26، 124.11، 122.47، 122.04، 66.40، 61.43، 21.05، 14.15.
  12. وبالإضافة إلى ذلك، وجمع عالية الدقة الطيف الكتلي باستخدام السائل اللوني الطيفي في تركيبة مع فخ ايون ووقت الرحلة التكنولوجيا (LCMS-IT-TOF) لقياس كتلة دقيقة وفقا لتعليمات الشركة الصانعة.
    ملاحظة: في هذه الدراسة (M + NH 4 +) محسوب: 430.1496. لاحظ: 430.1477.

2. GTCPFE يحول دون آخر NFĸB في خلايا سرطان الثدي

  1. الخلية شروط الثقافة
    1. الحفاظ على خطوط خلايا سرطان الثدي البشرية، قدم مكعبة-7 و MDA-MB-231 كما في طريق مسدود الخلية القياسيةتقنيات تلح ونشر في حاضنة ترطيب عند 37 درجة مئوية مع 5٪ CO 2.
      1. إعداد MCF-7 المتوسطة خلية من معهد روزويل بارك التذكاري (RPMI) 1640 المتوسطة مع أحمر الفينول تستكمل مع 10٪ مصل بقري جنيني (FBS)، 1٪ الأحماض الأمينية غير الأساسية، 2 مم L-الجلوتامين، 1٪ المضادات الحيوية البنسلين ستربتومايسين ، و 6 نانوغرام / مل الانسولين. إعداد MDA-MB-231 متوسطة خلية من تحسين الحد الأدنى الضروري المتوسطة (IMEM) تستكمل مع 5٪ FBS، 1٪ الأحماض الأمينية غير الأساسية، 2 مم L-الجلوتامين، و 1٪ المضادات الحيوية البنسلين ستربتومايسين.
  2. عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة -RE luciferase المراسل مراسل الفحص
    1. يعرض للتريبسين سرطان الثدي MCF-7 الخلايا باستخدام 0.25٪ التربسين لمدة 5 دقائق عند 37 درجة مئوية، العد يدويا باستخدام عدادة الكريات والبذور في 24 لوحات جيدة في 90،000 الخلايا في كثافة جيدا.
    2. وفيما يلي خلايا اليوم، وشارك في transfect مع البلازميد عنصر استجابة عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة (عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة-RE) بناء وسيفيراز، 1 ميكروغرام / جيد، آلأونج مع promoterless Renilla بناء وسيفيراز، 0.2 ميكروغرام / أيضا. أداء تعداء لكل مجموعة العلاج في ثلاث نسخ.
      1. غسل الخلايا مرتين مع برنامج تلفزيوني، واحتضان مع خليط من البلازميد و 1 ميكرولتر لكل بئر من كاشف ترنسفكأيشن (على سبيل المثال lipofectamine) في وسائل الإعلام الحرة في الدم. بعد 6 ساعات، وتغيير المتوسطة إلى 1 مل من المتوسط ​​العادي (بدون البنسلين والمضادات الحيوية والستربتومايسين).
    3. بعد 16 ساعة، إضافة 1 ميكرولتر من السيارة أو حلول الاسهم مختلفة من GTCpFE أو المخدرات ASA إلى كل بئر. حل حلول الأسهم المخدرات (100، 50، 20، 10 و 1 ملم) في سلفوكسيد ثنائي ميثيل في 1،000x التركيز. بعد إضافة الأدوية، واحتضان الخلايا لمدة 2 ساعة على 37 درجة مئوية.
    4. لتفعيل مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة، إضافة خلوى المؤيدة للالتهابات TNFα (10 ميكروغرام / مل حل الأسهم) في كل بئر لتركيز النهائي من 10 نانوغرام / مل واحتضان لمدة 4 ساعات. تشمل مراقبة TNFα وحدها. نضح المتوسطة وتخزين الخلاياالصورة في -80 درجة مئوية.
    5. قياس وسيفيراز باستخدام نظام مراسل فحص وسيفيراز وفقا لتعليمات الشركة الصانعة.
      ملاحظة: عند استخدام نظام luciferase الفحص (على سبيل المثال المزدوج luciferase المراسل نظام الفحص) للمرة الأولى، وإعداد حل luciferase الفحص الكاشف عن طريق إعادة تعليق لتقنية المعلومات في 10 مل من العازلة وتخزينها في -80 درجة مئوية في 1 مل قسامات.
      1. إعداد العازلة تحلل 1X عن طريق تمييع عازلة الأسهم 5X بالماء. خلايا ليز في كل 100 ميكرولتر العازلة 1X تحلل جيدا باستخدام. احتضان لوحات على شاكر المداري لمدة 15 دقيقة، على سرعة متوسطة.
      2. تسمية واحدة أنبوب 1.5 مل لكل عينة. ذوبان الفحص الكاشف وسيفيراز إلى درجة حرارة الغرفة (لن تكون هناك حاجة إلى 50 ميكرولتر لكل عينة) ونضع في احباط. إعداد 1X كاشف التبريد في قارورة زجاجية، 01:49 التخفيف في المخزن ودوامة أنه (لن تكون هناك حاجة إلى 50 ميكرولتر لكل عينة).
      3. إضافة 10 ميكرولتر من المحللة الخلية إلى أنبوب microcentrifuge المسمى. ثم إضافة 50 ميكرولتر من كاشف luciferase الفحص وبلطف دوامة. فورا بعد، وضع أنبوب في حامل وقياس التلألؤ من خلال برنامج وسيفيراز المزدوج في luminometer. حدد واضغط على التالي: تشغيل Promega بروتوكولات → المزدوج بالشبكة → موافق.
      4. إضافة 50 ميكرولتر من كاشف التبريد إلى أنبوب اختبار وبلطف دوامة. قياس التألق. كرر هذه الخطوات لكل عينة.
      5. تحليل البيانات باستخدام جداول البيانات عن طريق تطبيع عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة-RE إلى الرقابة الداخلية Renilla (عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة-RE / Renilla). مقارنة البيانات المانع للسيطرة TNFα فقط (TNFα فقط هي التي حددت في 100٪).
  3. جين عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة -الهدف النسخ
    1. البذور MCF-7 الخلايا في 6 لوحات جيدا في 250،000 الخلايا لكل بئر في 2 مل حجم متوسط ​​أعد كما هو موضح في القسم 2.1.
    2. في اليوم التالي، إضافة 2 ميكرولتر من مختلف GTCpFE 1،000x أسهم (100، 50، 20، 10 و 1 ملم) لمدة 2 ساعة قبل إضافة TNFα 10ng / مل لمدة 2 ساعة أخرى. تشغيل كل معاملةفي ثلاث نسخ. وتشمل المركبات والضوابط وحدها TNFα.
    3. عزل الحمض النووي الريبي باستخدام طريقة استخراج guanidinium ثيوسيانات الفينول كلوروفورم، وفقا لتعليمات الشركة المصنعة 22. تحديد تركيز الحمض النووي الريبي (في diethylpyrocarbonate (DEPC) المياه المعالجة بالإثير) و RNA النقاء باستخدام مقياس الطيف الضوئي. حافظ على عينات الحمض النووي الريبي على الجليد أو مخزن في -80 درجة مئوية. استخدام الوحيدة نصائح حاجز خالية من ريبونوكلياز عند التعامل مع الحمض النووي الريبي.
    4. عكس نسخ 0.5 ميكروغرام الحمض النووي الريبي مجموع باستخدام مجموعة المتاحة تجاريا من مولوني الفئران فيروس اللوكيميا (M-MLV) الناسخ العكسي.
      ملاحظة: تشمل هذه المجموعة 5X العازلة وdithiothreitol (DTT)، جنبا إلى جنب مع خليط dNTP، وعشوائية hexamers الخليط.
      1. إضافة 0.5 ميكروغرام من الحمض النووي الريبي إلى 200 وحدة من M-MLV، 0.5 ملي dNTPs، 100 نانوغرام من hexamers عشوائي، 10 ملي DTT، 1X العازلة والمياه DEPC إلى حجم رد الفعل 10 ميكرولتر النهائي. تنفيذ الناسخ رد الفعل العكسي باستخدام cycler على PCR لمدة 50 دقيقة عند 37 درجة مئوية، ثم 15 دقيقة في 70 و# 176؛ ج لتسخين-تعطيل الإنزيم.
    5. تمييع المنتج [كدنا مما أدى إلى 100 ميكرولتر مع الماء المقطر المزدوج واستخدام 2 ميكرولتر لكل رد فعل لاحق الكمي تفاعل البلمرة المتسلسل (PCR).
      1. مزيج إلى الأمام وعكس الاشعال لهذا الجين من الفائدة عند 1.25 تركيز ميكرومتر لكل منهما. إعداد مزيج الرئيسي مع 2 ميكرولتر الماء المقطر المزدوج، 1 ميكرولتر من 1.25 ميكرومتر مزيج التمهيدي و 5 ميكرولتر من 2X من الصبغة لتمكين الكشف عن الحمض النووي المزدوج تقطعت بهم السبل. تحميل 2 ميكرولتر من [كدنا و 8 ميكرولتر من مزيج الرئيسي في 96-جيدا لوحات PCR.
    6. تنفيذ PCR الكمي باستخدام الوقت الحقيقي نظام PCR (40 دورات، 95-60 ° C) وفقا لتعليمات الشركة الصانعة وتحليل البيانات يدويا.
      ملاحظة: جميع الاشعال PCR تستخدم تم التحقق من صحتها وذكرت سابقا 23.
    7. حساب التعبير الجيني تغيير أضعاف باستخدام جداول البيانات عبر طريقة ΔΔCt، مع البروتين الريباسي 36مرنا B4 العامل بوصفه الرقابة الداخلية 23.

3. GTCpFE يمنع خلايا سرطان الثدي الجذعية في المختبر

  1. Mammosphere تشكيل الفحص
    1. إعداد mammosphere (MS) المتوسطة من خلال استكمال Dulbecco لتعديل النسر متوسطة: خليط المغذيات F-12 (DMEM / F12) الفينول الحمراء الخالية المتوسطة مع 1٪ السليلوز الميثيل. تسمح بحل التي كتبها طيف تهتز بين عشية وضحاها في 4 درجات مئوية. فلتر تعقيم المتوسطة وتكمل مع B27 1X، 1٪ البنسلين والستربتومايسين، 5 ميكروغرام / مل الانسولين، 1 ميكروغرام / مل الهيدروكورتيزون، و 20 نانوغرام / مل المؤتلف عامل نمو البشرة البشري.
    2. إعداد الخلايا واحد من خط الخلية MDA-MB-231 من التربسين الهضم (التربسين 0.25٪ لمدة 5 دقائق عند 37 درجة مئوية) من الثقافات أحادي الطبقة وتصفية من خلال مناخل شبكة. يدويا عد خلايا فصل واحد ولوحة في لوحات مرفق 96-جيدا منخفضة للغاية في مناطق ذات كثافة من 400 خلية / جيدا. في اليوم التالي، إضافة تركيزات مختلفة من GTCpFE (على سبيل المثال، النهائية تركيزات GTCpFE: 1، 10، 20، 50 ميكرومتر) إلى الحجم النهائي هو 100 ميكرولتر. إجراء كل معاملة في ثلاث نسخ.
    3. بعد 7 أيام من الثقافة في الحاضنة، والحصول على الصور عن طريق برامج التصوير باستخدام مجهر مقلوب. حساب عدد MS> 75 ميكرون في القطر يدويا. مقارنة العلاج من تعاطي المخدرات إلى السيطرة على السيارة.
      ملاحظة: يتم تحديد قطرها MS> 75 ميكرون باستخدام برامج التصوير.
  2. CD44 + CD24 - CSC نمط ظاهري مناعي
    1. يعرض للتريبسين MDA-MB-231 الخلايا مع 0.25٪ التربسين لمدة 5 دقائق عند 37 درجة مئوية. العد باستخدام عدادة الكريات والبذور في 10 سم أطباق ب 3 ملايين الخلايا في طبق في 10 مل المتوسطة كما هو موضح في القسم 2.1. إضافة السيارة (10 ميكرولتر ثنائي ميثيل سلفوكسيد) أو GTCpFE (10 ميكرولتر من 50 ملي الأسهم) إلى الخلايا لمدة 72 ساعة.
    2. للمركبة أو العلاج GTCpFE مجموعات، ويعرض للتريبسين الخلايا (كما في الخطوة 3.2.1) وتوزيع 1000000 الخلايا في 'اختبار & #39؛ أو "السيطرة" 5 مل أنابيب البوليسترين تحتوي على 2 مل من 1X هانك في محلول الملح المتوازن (HBSS) المخزن المؤقت تستكمل مع 2٪ FBS.
    3. وصمة عار للCD44 علامات سطح وCD24، خلايا تدور أسفل وإضافة 20 ميكرولتر من كل الأجسام المضادة مترافق وHBSS + 2٪ FBS لاختبار أنابيب لالنهائية 100 ميكرولتر الحجم الكلي (1: 5 تمييع). إضافة 100 ميكرولتر من HBSS + 2٪ FBS لمراقبة الأنابيب. تشمل CD44-APC الأجسام المضادة مترافق وCD24-PE الأجسام المضادة الضوابط وصمة عار واحدة أو الضوابط immunoisotype مفتش.
    4. احتضان خلايا في الظلام في 4 درجة مئوية لمدة 30 دقيقة. تدور باستمرار خلايا لمدة 5 دقائق في 400 x ج وإعادة في المخزن HBSS 200 ميكرولتر مع FBS 2٪. تبقي الخلايا على الجليد في الظلام.
    5. أداء تنشيط الإسفار الفرز الخلية (نظام مراقبة الأصول الميدانية) من الخلايا الحية باستخدام محلل أداة نظام مراقبة الأصول الميدانية وفقا لتعليمات الشركة الصانعة. اجمع على الأقل 50،000 الأحداث لكل أنبوب. العلاجات تعمل في ثلاث نسخ.
      ويستند المحاصرة على التحكم من أي تلطيخ (المشارك: ملاحظةأنبوب ntrol)، immunoisotypes مفتش، وCD44-APC والبقع CD24-PE واحدة.
    6. تحليل البيانات باستخدام برنامج متاح التدفق الخلوي.
      ملاحظة: في المئة من الخلايا المعالجة GTCpFE-مع CD44 + CD24 - نمط ظاهري مناعي ويقدر وبالمقارنة مع السيطرة على السيارة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

في الشكل 1، والتركيب الكيميائي للدواء مساعد الأسبرين فومرت، GTCpFE، ونشاطه كابح بشكل خاص على خلوى يسببها مسار NFĸB في خلايا سرطان الثدي المشار إليها. GTCpFE يمنع كلا النهاية NFĸB، NFĸB-RE luciferase النشاط (الشكل 1B) والتعبير عن الجينات المستهدفة NFĸB، مثل بين الخلايا التصاق جزيء 1 (ICAM1)، Chemokine CC الحافز يجند 2 (CCL2)، وعامل نخر الورم (TNF) (الشكل 1C) في قدم مكعبة-7 خلايا سرطان الثدي. حساب تركيز مثبط بنسبة 50٪ (IC 50) القيمة على حد سواء النهاية هي ~ 20 ميكرومتر. يتم احتساب IC 50 القيمة باستخدام برنامج الرسوم البيانية. وعلى سبيل المقارنة ASA نفسها حتى في 200 ميكرومتر (10X IC 50 من GTCpFE) يظهر أي نشاط المثبطة (1B الشكل، الخط الأزرق) في خلايا سرطان الثدي. هذا يدل على أن استراتيجية دواء مساعد إضافة فومرت حامل الخاصة الدوائية إلى ASA الهامة فيntly يحسن نشاط مضاد للNFĸB لها.

لقياس النشاط المضاد للديوان الخدمة المدنية، وكنا تحليلين: وmammosphere (MS) تشكيل فحص والسكان الخلايا معربا عن CD44 + CD24 - نمط ظاهري مناعي، والحسنة CSC علامة السطح النية في سرطان الثدي 24. GTCpFE يمنع تشكيل MS من MDA-MB-231 خلايا سرطان الثدي في جرعة وبطريقة تعتمد هو مبين في الشكل 2A. على غرار NFĸB تثبيط مسار في الثقافات ملتصقة، قيمة IC 50 لتشكيل mammosphere هي ~ 20 ميكرومتر. ومن المتوقع هذا التناسق، نظرا إلى أن الخلايا الجذعية السرطانية تعتمد على NFĸB يشير أجل البقاء والتكاثر 16-21. وبالإضافة إلى ذلك، أسفرت GTCpFE ما قبل المعالجة في استنزاف كبير من CD44 + CD24 - السكان (الشكل 2B) في MDA-MB-231 الخلايا. معا، فإن هذه النتائج تضع القدرة GTCpFE على استهداف الخلايا الجذعية السرطانية بشكل فعال الثدي.

شكل 1
الشكل 1: GTCpFE يحول مسار NFĸB في خلايا سرطان الثدي. (أ) التركيب الكيميائي للدواء مساعد الأسبرين فومرت، GTCpFE. (B - C) وكانت MCF-7 الخلايا لمدة 2 ساعة مع تركيزات مختلفة من GTCpFE، ASA، أو مركبة تليها العلاج مع TNFα (10 نانوغرام / مل) لمدة 2-4 ساعة المعالجة مسبقا. وقد تم قياس النشاط (ب) عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة -RE بواسطة المزدوج فحص مراسل وسيفيراز. وقد تم قياس (C) التعبير عن الجينات المستهدفة عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة ، ICAM1، CCL2 وTNF بواسطة RT-QPCR. يتم رسم المخدرات النشاط المثبطة كنسبة مئوية من TNFα وحدها. وتعرض البيانات كما يعني ± SEM. تم تعديل هذا الرقم من إشارة 15. الرجاء انقر هنا لعرض نسخة أكبر من هذا فيقوإعادة.

الشكل 2
الشكل 2: GTCpFE يحول دون تشكيل mammosphere وCD44 + CD24 - نمط ظاهري مناعي في خلايا سرطان الثدي. وقد تم قياس (A) Mammosphere (MS) تشكيل MDA-MB-231 الخلايا بعد العلاج مع تركيزات مختلفة من GTCpFE. الكميات من النمو MS (يسار) وصور تمثيلية من مرض التصلب العصبي المتعدد في 20X (يمين) وترد. يتم رسم تأثير GTCpFE عن السيطرة٪ مركبة. تم تحديد عدد السكان عن طريق تحليل نظام مراقبة الأصول الميدانية من MDA-MB-231 الخلايا المعالجة مع 50 ميكرومتر GTCpFE لمدة 72 ساعة - (ب) CD44 + CD24. ويبين الكميات من كل نسبة السكان (يسار) والمؤامرات مبعثر تمثيلية من نظام مراقبة الأصول الميدانية (يمين). وتعرض البيانات كما يعني ± ووزارة شؤون المرأة والتحليل الإحصائي لل2-طريقة أنوفا الفلبذمة توكي البعدي. *** P <0.001. تم تعديل هذا الرقم من إشارة 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics