संश्लेषण और एक एस्पिरिन-fumarate प्रोड्रग की विशेषता है कि NFκB गतिविधि और स्तन कैंसर स्टेम कोशिकाओं को रोकता है

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

सूजन एक कैंसर बानगी है कि मेटास्टेसिस को कैंसर के बढ़ते मामलों और बढ़ावा देने के लिए, और अंततः प्रगति के पीछे भी है। इसलिए, मानक कैंसर रेजिमेंटों के लिए एक विरोधी भड़काऊ दवा जोड़ने रोगी परिणाम में सुधार कर सकते हैं। ऐसा ही एक दवा एस्पिरिन (एस्प्रीन, एएसए), कैंसर chemoprevention और विरोधी ट्यूमर गतिविधि के लिए लगाया गया है। साइक्लोआक्सीजनेज़ 2-प्रोस्टाग्लैंडीन अक्ष बाधा इसके अलावा, एएसए के कैंसर रोधी गतिविधियों में भी परमाणु कारक ĸB (NFĸB) निषेध करने के लिए जिम्मेदार ठहराया गया है। क्योंकि लंबे समय तक एएसए उपयोग जठरांत्र विषाक्तता का कारण हो सकता है, एक प्रोड्रग रणनीति को सफलतापूर्वक लागू किया गया है। इस प्रोड्रग में डिजाइन एएसए की कार्बोक्जिलिक एसिड छिपा हुआ है और अतिरिक्त pharmacophores शामिल कर रहे हैं।

इस प्रोटोकॉल का वर्णन कैसे हम एक एस्पिरिन-fumarate प्रोड्रग, GTCpFE संश्लेषित, और स्तन कैंसर की कोशिकाओं में NFĸB मार्ग की अपनी विशेषता निषेध और कैंसर के क्षीणन स्टेम तरह उचितसंबंधों, एक महत्वपूर्ण NFĸB निर्भर फेनोटाइप। GTCpFE प्रभावी रूप से स्तन कैंसर कोशिका लाइनों में NFĸB मार्ग को रोकता है, जबकि एएसए किसी भी निरोधात्मक गतिविधि का अभाव है, यह दर्शाता है कि एएसए संरचना को जोड़ने fumarate काफी अपने गतिविधि के लिए योगदान देता है। Immunophenotype - इसके अलावा, GTCpFE mammosphere गठन अवरुद्ध और कैंसर स्टेम सेल जुड़े CD44 + CD24 attenuating द्वारा महत्वपूर्ण विरोधी कैंसर स्टेम सेल गतिविधि से पता चलता है। इन परिणामों के एक व्यवहार्य रणनीति chemoprevention और कैंसर के उपचार के लिए बेहतर विरोधी भड़काऊ दवाओं को विकसित करने की स्थापना।

Introduction

सूजन एक बानगी है कि ऐसी घटनाओं को और बढ़ावा देने, और मेटास्टेसिस 1 करने के लिए अंत में प्रगति के रूप में tumorigenesis के कई पहलुओं, underlies है। स्तन कैंसर में, यह आगे शास्त्रीय गैर स्टेरायडल विरोधी भड़काऊ दवा एस्पिरिन की है कि नियमित रूप से उपयोग (चिरायता एसिड, एएसए एसिटाइल) दिखा महामारी विज्ञान टिप्पणियों दोनों स्तन कैंसर की घटनाओं में कमी, और मेटास्टेसिस और पुनरावृत्ति के जोखिम के साथ जुड़ा हुआ है के द्वारा समर्थित है 2,3। एएसए मुख्य रूप से बाधा साइक्लोआक्सीजनेज़ -2 गतिविधि है, जो अक्सर स्तन कैंसर 4,5 में upregulated है के द्वारा कार्य करता है। हालांकि, एएसए के विरोधी कैंसर प्रभाव भी न्यायपालिका परमाणु कारक κB (NFκB) संकेत 6-8 दबा द्वारा मध्यस्थता जा सकता है। यह महत्वपूर्ण है क्योंकि एक अविनियमित NFκB मार्ग चिकित्सा 9-11 ट्यूमर सेल अस्तित्व, प्रसार, प्रवास, आक्रमण, angiogenesis, और प्रतिरोध को बढ़ावा देता है। NFκB मार्ग सक्रियण भी बढ़ते के लिए महत्वपूर्ण हैएक प्रतिरक्षा प्रतिक्रिया। इसलिए, विरोधी कैंसर चिकित्सा जहां लंबे समय तक NFκB निषेध की आवश्यकता है के लिए, एक लंबे समय तक चलने प्रतिरक्षा दमन से जुड़े हानिकारक साइड इफेक्ट पर विचार करना चाहिए। इसलिए, एएसए चिकित्सीय अनुकूलन के लिए एक अच्छा प्रारंभिक बिंदु के रूप में सेवा कर सकते हैं।

कैंसर के उपचार में एएसए आवेदन के लिए एक सीमा ऊंचा साइक्लोआक्सीजनेज़ 2 और NFκB निषेध के लिए आवश्यक खुराक है, जो इस तरह के अल्सर और पेट से खून बह रहा 12,13 के रूप में जठरांत्र विषाक्तता के साथ जुड़े रहे हैं। हालांकि, के रूप में एस्टर प्रोड्रग में एएसए परिवर्तित करने, एएसए के जठरांत्र विषाक्तता को कम कर सकता है। आगे शक्ति बढ़ाने और / या कार्यक्षमता जोड़ने के लिए, अतिरिक्त संरचनात्मक तत्वों या सहायक pharmacophores भी एस्टर प्रोड्रग डिजाइन में शामिल किया जा सकता है। ऐसा ही एक Pharmacophore एएसए शक्ति को बढ़ाने के लिए के खिलाफ NFκB मार्ग fumarate है, जो हम पहले से NFκB मार्ग अवरोध 14,15 के लिए महत्वपूर्ण हो चला है जोड़ा।

15, GTCpFE, और धारणा है कि इस तरह के संकर अणु सुरक्षित अभी तक NFκB मार्ग के खिलाफ प्रबल होगा। हम स्तन कैंसर की कोशिकाओं में अपने विरोधी NFκB गतिविधि और स्तन कैंसर स्टेम सेल (सीएससी) 15 है, जो NFκB अस्तित्व और विकास के लिए 16-21 संकेत पर भरोसा ब्लॉक करने के लिए अपनी क्षमता का परीक्षण किया। हम जानते हैं कि NFκB मार्ग के खिलाफ GTCpFE की शक्ति काफी एएसए 15 से अधिक सुधार हुआ है पाते हैं। इसके अलावा, GTCpFE ब्लॉकों mammosphere गठन और सीएससी सतह मार्कर CD44 + CD24 attenuates - immunophenotype, यह दर्शाता है कि GTCpFE सीएससी 15 उन्मूलन के लिए सक्षम है। इन परिणामों के एक प्रभावी विरोधी भड़काऊ एजेंट भी है कि स्तन सीएससी लक्षित कर सकते हैं के रूप में एस्पिरिन-fumarate प्रोड्रग की स्थापना। स्तन कैंसर के उपचार के संदर्भ में, GTCpFE संभावित आक्रामक और घातक बीमारी का इलाज हो सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. एस्पिरिन-fumarate प्रोड्रग GTCpFE के संश्लेषण

  1. एक प्लास्टिक सवार सिरिंज का प्रयोग, मेथनॉल के 0.81 मिलीग्राम (20 mmol) को मापने और (10 मिलीलीटर) पानी में यह मिश्रण एक दौर नीचे फ्लास्क में। एक बर्फ नहाने के पानी में कुप्पी रखकर 0 डिग्री सेल्सियस के परिणामस्वरूप मिश्रण ठंडा। 4-hydroxybenzyl शराब (2.48 मिलीग्राम, 20 mmol) जोड़ें और प्रतिक्रिया मिश्रण हलचल जब तक समाधान स्पष्ट है।
  2. हे -acetylsalicyloyl क्लोराइड के वांछित राशि वजन और एक अलग फ्लास्क में विलायक में भंग द्वारा यह निर्जल टोल्यूनि (10 एमएल) में हे -acetylsalicyloyl क्लोराइड का एक समाधान (3.77 मिलीग्राम, 19 mmol) तैयार करें। एक प्लास्टिक सवार सिरिंज का प्रयोग, 1.1 चरण में तैयार मिश्रण को यह समाधान जोड़ने, और प्रतिक्रिया छोड़ 0 डिग्री सेल्सियस पर क्रियाशीलता।
  3. प्रतिक्रिया पतली परत क्रोमैटोग्राफी (टीएलसी) का उपयोग कर मॉनिटर। टीएलसी प्लेटें एक स्थिर चरण के रूप में सिलिका होनी चाहिए।
    1. 20:80 एथिल एसीटेट (AcOEt) / हेक्सेन से बना एक मोबाइल चरण की तैयारी। एक कक्ष में टीएलसी(या छोटे कंटेनर) कक्ष के नीचे कवर करने के लिए मोबाइल चरण के 5 मिलीलीटर जोड़ें।
      नोट: मोबाइल चरण की राशि चयनित कक्ष पर निर्भर करता है। हमेशा नीचे कवर करने के लिए पर्याप्त जोड़ने के लिए, लेकिन एक बार टीएलसी के अंदर रखा गया है, विलायक लाइन ऊंचाई जहां यौगिकों देखा जाता है को पार नहीं करना चाहिए।
    2. , एक सिरिंज (0.2 एमएल) के साथ प्रतिक्रिया का एक नमूना लेने के लिए एक छोटी शीशी में जगह है, और एथिल एसीटेट (2-3 बूँदें) के साथ पतला। एक टीएलसी निशानदेही के साथ, ध्यान से पतला प्रतिक्रिया मिश्रण का एक नमूना लेने के लिए और टीएलसी में यह हाजिर।
      नोट: स्पॉट 1-2 मिमी होना चाहिए और इस टीएलसी थाली के निचले 1/4 इंच में किया जाना चाहिए।
    3. एक ही टीएलसी पर, एक तुलना के रूप हे acetylsalicyloyl क्लोराइड का एक समाधान के एक स्थान (इथाइल एसीटेट के 0.5 मिलीलीटर में 0.2 मिलीग्राम) जगह है। एक बार स्पॉट सूख रहे हैं, चैम्बर में डाल दिया है और इसे चलाने के लिए जब तक विलायक सामने टीएलसी के शीर्ष पर पहुंच गया है लगभग दो।
    4. टीएलसी बाहर ले लो, इसे सूखा और एक यूवी दीपक के तहत यह कल्पना। reaction पूरा जब हे -acetylsalicyloyl क्लोराइड मौके प्रतिक्रिया मिश्रण से गायब हो जाता है।
    5. जब प्रतिक्रिया पूरा हो गया है, बर्फ के पानी से स्नान को हटाने, और प्रतिक्रिया 20 घंटे के लिए कमरे के तापमान पर हलचल करने के लिए अनुमति देते हैं।
  4. वेग मध्यम porosity के एक fritted डिस्क के साथ एक Buchner कीप का उपयोग कर फ़िल्टर। एक जगमगाहट शीशी में रखें ठोस, और रात भर कमरे के तापमान पर एक desiccator में vacuo में यौगिक छोड़ दें। शोषक के रूप में फास्फोरस pentoxide (पी 25) का प्रयोग करें।
  5. यह इस प्रतिक्रिया स्थापित करने से पहले कम से कम दो दिनों के लिए 80 डिग्री सेल्सियस पर एक ओवन में रखकर एक दौर नीचे कुप्पी सूखी। वैकल्पिक रूप से, एक पट साथ कुप्पी सील और एक सुई कि एक वैक्यूम पंप प्रणाली से जुड़ा है के साथ यह घुसाना। पर वैक्यूम पंप मुड़ें और एक गर्मी बंदूक का उपयोग कर कुप्पी सूखी। शांत करने के लिए अनुमति दें, और इस चरण 2 बार दोहराएँ।
  6. आर्गन गैस का उपयोग कर एक गुब्बारा फुलाना, और यह एक प्लास्टिक सिरिंज (जिसका सवार ज से कनेक्टहटा दिया गया) के रूप में एक सुई के साथ। वैक्यूम पंप बंद करें और सुई से जुड़ी यह है कि अब सूखे दौर नीचे फ्लास्क में डाला गया था हटा दें। सुई पट दौर नीचे कुप्पी सील के माध्यम से आर्गन गुब्बारे से जुड़ा डालें।
    1. एक अलग कुप्पी के लिए 2-acetyloxybenzoic एसिड (100 मिलीग्राम, 0.349 mmol), 4-dimethylaminopyridine (4 मिलीग्राम, 0.033 mmol) और triethylamine (53 एमजी, 0.523 mmol) के 4-hydroxymethylphenol एस्टर जोड़ें, तो उन्हें निर्जल tetrahydrofuran में भंग (5 एमएल)। एक प्लास्टिक की एक सुई से जुड़ी सिरिंज के साथ, सील दौर नीचे कुप्पी को यह समाधान जोड़ें। एक बर्फ के पानी के स्नान में कुप्पी रखकर 0 डिग्री सेल्सियस के नीचे मिश्रण ठंडा।
  7. पिछले मिश्रण करने के लिए, निर्जल tetrahydrofuran (5 एमएल) में एथिल fumaroyl क्लोराइड का एक समाधान (68 मिलीग्राम, 0.419 mmol) जोड़ने के लिए, बूंद के लिहाज से 10 मिनट की अवधि में। 2-4 घंटे के लिए 0-5 डिग्री सेल्सियस पर परिणामस्वरूप समाधान हिलाओ।
  8. एथिल एसीटेट (100 मिलीलीटर) और नमकीन (50 एमएल) के साथ प्रतिक्रिया मिश्रण निकालें। <br /> नोट: नमकीन सोडियम क्लोराइड (NaCl) के एक संतृप्त समाधान है। इसे तैयार करने के लिए, एक साफ ग्लास कंटेनर में पानी की 200 मिलीलीटर जगह तो सोडियम क्लोराइड (जबकि सरगर्मी) जोड़ने जब तक यह अब भंग नहीं करता शुरू करते हैं।
    1. निष्कर्षण के बाद, जलीय चरण को हटाने और बाद के कदम दो बार दोहराएँ।
    2. , जैविक चरण के लिए सोडियम सल्फेट जोड़कर मिश्रण सूखा जब तक ठोस पेड़ों का झुरमुट नहीं है जब कांच के बने पदार्थ हड़कंप मच गया है। एक fritted डिस्क के साथ एक और Buchner कीप का प्रयोग, सोडियम सल्फेट को दूर करने के लिए, तो तापमान 40 डिग्री सेल्सियस पर सेट के साथ एक रोटरी बाष्पीकरण का उपयोग कर सूखापन के लिए लुप्त हो जाना एक दौर नीचे फ्लास्क मिश्रण फिल्टर।
  9. एक टीएलसी का उपयोग करना, कॉलम क्रोमैटोग्राफी में उपयोग करने के लिए एक उचित मोबाइल चरण का निर्धारण।
    नोट: इस प्रयोग के लिए 20:80 AcOEt / हेक्सेन की एक ढाल इस्तेमाल किया गया था।
  10. सिलिका जेल और उचित विलायक चरण के साथ एक स्तंभ तैयार करें। एक बार जब यौगिक जोड़ दिया गया है, पीआर करने के लिए सोडियम सल्फेट (या रेत) की एक परत जोड़नेotect विलायक के रूप में कॉलम जोड़ा जाता है।
    1. स्तंभ चलाता है के रूप में, टीएलसी द्वारा eluate की निगरानी। हर दूसरे टेस्ट ट्यूब स्थल के रूप में वे स्तंभ से एकत्र कर रहे हैं। जब ब्याज की उत्पाद elutes, एक बड़े दौर नीचे कुप्पी में शुद्ध उत्पाद युक्त सभी नमूनों मिश्रण है, और स्नान का तापमान 40 डिग्री सेल्सियस पर सेट के साथ एक रोटरी बाष्पीकरण का उपयोग कर उन्हें सूखी।
      नोट: उत्पाद एक सफेद ठोस रूप में प्रकट करना चाहिए।
  11. GTCpFE की संरचना इस बात की पुष्टि करने के लिए, प्रोटॉन और कार्बन (1 एच और 13 सी, क्रमशः) इकट्ठा निर्माता के निर्देशों के अनुसार परमाणु चुंबकीय अनुनाद (एनएमआर) स्पेक्ट्रा।
    नोट: इस अध्ययन में एक 400 मेगाहर्ट्ज एफटी एनएमआर स्पेक्ट्रोमीटर 1 एच और 13 सी स्पेक्ट्रा एकत्र करने के लिए इस्तेमाल किया गया था। पर्याप्त डेटा संकल्प प्राप्त करने के लिए कमरे के तापमान पर कम से कम 25 से स्कैन करें। एनएमआर चोटियों मनाया निम्नलिखित, 1 एच एनएमआर (CDCl 3) थे: δ 1.29 (टी, 3 एच, 3J = 7.0 हर्ट्ज, सीएच 3); 2.31 (एस, 3 एच, सीएच 3); 4.26 (क्यू2 एच, 3J = 7.0 हर्ट्ज, कूच 2); 5.25 (एस, 2 एच, OCH 2); 6.89 (एस, 2 एच, कोर्ट = स्विस); 7.19 (मीटर, 3 एच, Ar); 7.42 (मीटर, 3 एच, Ar); 7.65 (मी, 1 एच, Ar); 8.22 (डीडी, 1 एच, 3J = 7.8, 4J = 1.2 हर्ट्ज, Ar)। 13 सी एनएमआर (CDCl 3) δ: 169.70, 164.86, 164.75, 162.89, 151.28, 150.69, 134.76, 134.32, 133.26, 133.16, 132.25, 129.81, 126.26, 124.11, 122.47, 122.04, 66.40, 61.43, 21.05, 14.15।
  12. इसके अलावा, आयन जाल और निर्माता के निर्देशों के अनुसार सटीक जन मापन के लिए समय-की उड़ान प्रौद्योगिकी (एलसीएमएस-आईटी-TOF) के साथ संयोजन में तरल क्रोमैटोग्राफी मास स्पेक्ट्रोमेट्री का उपयोग एक उच्च संकल्प जन स्पेक्ट्रम इकट्ठा।
    नोट: इस अध्ययन में (M + एनएच 4 +) की गणना: 430.1496; मनाया: 430.1477।

2. GTCPFE स्तन कैंसर की कोशिकाओं में NFĸB गतिविधि को रोकता है

  1. सेल संस्कृति शर्तों
    1. , मानव स्तन कैंसर कोशिका लाइनों को बनाए रखने MCF 7 और एमडीए MB-231 मानक सेल संस्कृति के अनुसारसंरचना तकनीक और 5% सीओ 2 के साथ 37 डिग्री सेल्सियस पर एक humidified इनक्यूबेटर में प्रचार।
      1. रोसवेल पार्क मेमोरियल संस्थान (RPMI) फिनोल लाल 10% भ्रूण गोजातीय सीरम (FBS) के साथ पूरक, 1% गैर आवश्यक अमीनो एसिड, 2 मिमी एल glutamine, 1% एंटीबायोटिक दवाओं पेनिसिलिन स्ट्रेप्टोमाइसिन के साथ 1,640 मध्यम से MCF 7 सेल के माध्यम से तैयार , और 6 एनजी / एमएल इंसुलिन। बेहतर न्यूनतम आवश्यक मध्यम (IMEM) से एमडीए MB-231 सेल के माध्यम 5% FBS, 1% गैर आवश्यक अमीनो एसिड, 2 मिमी एल glutamine, और 1% एंटीबायोटिक दवाओं पेनिसिलिन स्ट्रेप्टोमाइसिन के साथ पूरक तैयार करें।
  2. NFκB-RE luciferase संवाददाता परख
    1. Trypsinize स्तन कैंसर MCF 7 37 डिग्री सेल्सियस पर 5 मिनट के लिए 0.25% trypsin का उपयोग कोशिकाओं, मैन्युअल अच्छी तरह घनत्व प्रति 90,000 कोशिकाओं में 24 अच्छी तरह प्लेटें में एक hemocytometer और बीज का उपयोग गिनती।
    2. निम्नलिखित एक NFκB प्रतिक्रिया तत्व (NFκB-RE) luciferase निर्माण, 1 ग्राम का प्लास्मिड डीएनए के साथ दिन, सह transfect कोशिकाओं / खैर, अलpromoterless Renilla luciferase निर्माण, 0.2 माइक्रोग्राम साथ ओंग / अच्छी तरह से। तीन प्रतियों में प्रत्येक उपचार के समूह के लिए transfections प्रदर्शन करना।
      1. कोशिकाओं पीबीएस के साथ दो बार धोएं, और प्लास्मिड डीएनए के मिश्रण और सीरम मुक्त मीडिया में अभिकर्मक अभिकर्मक (जैसे lipofectamine) की अच्छी तरह से प्रति 1 μl के साथ सेते हैं। 6 घंटे के बाद, नियमित रूप से मध्यम के 1 मिलीलीटर (बिना एंटीबायोटिक दवाओं पेनिसिलिन और स्ट्रेप्टोमाइसिन) मध्यम बदल जाते हैं।
    3. 16 घंटे के बाद, एक अच्छी तरह से वाहन या GTCpFE के विभिन्न स्टॉक समाधान या एएसए दवाओं की 1 μl जोड़ें। 1,000x एकाग्रता में डाइमिथाइल sulfoxide में नशीली दवाओं के स्टॉक समाधान (100, 50, 20, 10 और 1 मिमी) भंग। दवाओं जोड़ने के बाद, 37 डिग्री सेल्सियस पर 2 घंटे के लिए कोशिकाओं को सेते हैं।
    4. NFκB मार्ग सक्रिय करने के लिए, 10 एनजी / एमएल के एक अंतिम एकाग्रता के लिए प्रत्येक कुएं में समर्थक भड़काऊ साइटोकाइन TNFα (10 माइक्रोग्राम / एमएल शेयर समाधान) जोड़ने और 4 घंटे के लिए सेते हैं। एक TNFα अकेले नियंत्रण शामिल हैं। मध्यम Aspirate और सेल को स्टोर-80 डिग्री सेल्सियस पर एस।
    5. luciferase उपाय निर्माता के निर्देशों के अनुसार एक luciferase संवाददाता परख प्रणाली का उपयोग कर।
      नोट: जब पहली बार के लिए luciferase परख प्रणाली (जैसे दोहरी luciferase परख प्रणाली) का उपयोग करते हैं, यह बफर के 10 मिलीलीटर में फिर से निलंबित और 1 मिलीलीटर aliquots में -80 डिग्री सेल्सियस पर यह भंडारण के द्वारा luciferase परख अभिकर्मक की एक समाधान तैयार है।
      1. पानी के साथ 5x शेयर बफर गिराए द्वारा 1x lysis बफर तैयार करें। प्रत्येक अच्छी तरह से उपयोग करते हुए 100 μl 1x lysis बफर में कोशिकाओं lyse। 15 मिनट के लिए एक कक्षीय प्रकार के बरतन पर प्लेटें सेते मध्यम गति से।
      2. नमूना प्रति एक 1.5 मिलीलीटर ट्यूब लेबल। कमरे के तापमान (नमूना प्रति 50 μl की जरूरत होगी) और पन्नी में रखने के लिए पिघलना luciferase परख अभिकर्मक। एक कांच की शीशी में 1x शमन अभिकर्मक तैयार करें, बफर और भंवर में 1:49 कमजोर पड़ने यह (नमूना प्रति 50 μl की जरूरत होगी)।
      3. एक लेबल microcentrifuge ट्यूब सेल lysate के 10 μl जोड़ें। तब luciferase परख अभिकर्मक के 50 μl जोड़ें औरधीरे भंवर। इसके तत्काल बाद, एक धारक में ट्यूब जगह और luminometer में दोहरी luciferase कार्यक्रम के माध्यम से luminescence उपाय। का चयन करें और निम्नलिखित प्रेस: ​​भागो Promega प्रोटोकॉल → दोहरी Glo → ठीक है।
      4. टेस्ट ट्यूब और धीरे भंवर शमन अभिकर्मक के 50 μl जोड़ें। luminescence उपाय। प्रत्येक नमूना के लिए इन चरणों को दोहराएँ।
      5. Renilla आंतरिक नियंत्रण (NFκB-रे / Renilla) को NFκB-RE सामान्य से स्प्रेडशीट का उपयोग कर डेटा का विश्लेषण। TNFα केवल नियंत्रित करने के लिए अवरोध डेटा (TNFα केवल 100% पर सेट किया जाता है) की तुलना करें।
  3. NFκB-लक्ष्य जीन प्रतिलेखन
    1. बीज MCF 7 धारा 2.1 में वर्णित के रूप में तैयार 2 मिलीलीटर मध्यम मात्रा में अच्छी तरह से प्रति 250,000 कोशिकाओं में 6 अच्छी तरह प्लेटों में कोशिकाओं।
    2. अगले दिन, एक और 2 घंटे के लिए TNFα 10ng / एमएल जोड़ने से पहले 2 घंटे के लिए अलग GTCpFE 1,000x स्टॉक्स (100, 50, 20, 10 और 1 मिमी) के 2 μl जोड़ें। हर उपचार भागोतीन प्रतियों में। वाहन और TNFα अकेले नियंत्रण शामिल हैं।
    3. निर्माता 22 के निर्देशों के अनुसार guanidinium thiocyanate फिनोल के क्लोरोफॉर्म निष्कर्षण विधि का उपयोग शाही सेना को अलग। आरएनए एकाग्रता (diethylpyrocarbonate में (DEPC) -treated पानी) और आरएनए पवित्रता एक स्पेक्ट्रोफोटोमीटर का उपयोग निर्धारित करते हैं। -80 डिग्री सेल्सियस पर बर्फ या दुकान पर शाही सेना के नमूने रखें। केवल RNase मुक्त बाधा युक्तियों का उपयोग करें जब शाही सेना से निपटने।
    4. टाइप 0.5 माइक्रोग्राम कुल शाही सेना Moloney murine ल्यूकेमिया वायरस (एम-MLV) रिवर्स ट्रांसक्रिपटेस के एक व्यावसायिक रूप से उपलब्ध किट का उपयोग कर उल्टा।
      नोट: किट 5x बफर और dithiothreitol (डीटीटी), एक साथ dNTP मिश्रण है, और बिना सोचे समझे hexamers मिश्रण के साथ शामिल है।
      1. शाही सेना के 0.5 माइक्रोग्राम एम MLV की 200 इकाइयों, 0.5 मिमी dNTPs, एक अंतिम 10 μl प्रतिक्रिया मात्रा करने के लिए यादृच्छिक hexamers के 100 एनजी, 10 मिमी डीटीटी, 1x बफर और DEPC पानी में जोड़े। 37 डिग्री सेल्सियस पर 50 मिनट के लिए एक पीसीआर साइक्लर का उपयोग कर रिवर्स ट्रांसक्रिपटेस प्रतिक्रिया के लिए बाहर ले, और 70 और फिर 15 मिनट# 176; सेल्सियस गर्मी-निष्क्रिय एंजाइम करने के लिए।
    5. डबल आसुत जल के साथ 100 μl के परिणामस्वरूप सीडीएनए उत्पाद पतला और प्रत्येक बाद मात्रात्मक पोलीमरेज़ चेन रिएक्शन (पीसीआर) की प्रतिक्रिया के लिए 2 μl का उपयोग करें।
      1. आगे मिक्स और 1.25 सुक्ष्ममापी एकाग्रता प्रत्येक पर ब्याज की जीन के लिए प्राइमरों रिवर्स। एक मास्टर मिश्रण 2 μl दोहरा आसुत जल के साथ, 1.25 सुक्ष्ममापी प्राइमर मिश्रण का 1 μl और डाई की 2x के 5 μl डबल असहाय डीएनए का पता लगाने के लिए सक्षम करने के लिए तैयार करें। 96 अच्छी तरह से पीसीआर प्लेटों में सीडीएनए के 2 μl और मास्टर मिश्रण के 8 μl लोड।
    6. एक वास्तविक समय पीसीआर प्रणाली (40 चक्र, 95-60 डिग्री सेल्सियस) निर्माता के निर्देशों के और डेटा का विश्लेषण मैन्युअल के अनुसार का उपयोग कर मात्रात्मक पीसीआर बाहर ले।
      नोट: इस्तेमाल किया मान्य किया गया है और पहले 23 सूचना सभी पीसीआर प्राइमरों।
    7. ΔΔCt विधि के माध्यम से स्प्रेडशीट का उपयोग जीन अभिव्यक्ति गुना परिवर्तन की गणना, ribosomal प्रोटीन 36 के साथबी 4 mRNA आंतरिक नियंत्रण 23 के रूप में सेवारत।

3. GTCpFE को रोकता है स्तन कैंसर स्टेम सेल इन विट्रो में

  1. Mammosphere गठन परख
    1. Dulbecco संशोधित ईगल मध्यम सप्लीमेंट द्वारा mammosphere (एमएस) के माध्यम से तैयार: 1% मिथाइल सेलुलोज के साथ पोषक तत्व मिश्रण एफ 12 (DMEM / F12) फिनोल लाल मुक्त मध्यम। कोमल 4 डिग्री सेल्सियस पर रात भर झटकों से भंग करने की अनुमति दें। फिल्टर माध्यम बाँझ और B27 1x, 1% पेनिसिलिन और स्ट्रेप्टोमाइसिन, 5 माइक्रोग्राम / एमएल इंसुलिन, 1 माइक्रोग्राम / एमएल hydrocortisone, और 20 एनजी / एमएल पुनः संयोजक मानव epidermal वृद्धि कारक के साथ पूरक।
    2. monolayer संस्कृतियों के (37 डिग्री सेल्सियस पर 5 मिनट के लिए trypsin 0.25%) trypsin पाचन द्वारा एमडीए MB-231 सेल लाइन के एकल कक्षों को तैयार है और जाल चलनी के माध्यम से फिल्टर। मैन्युअल / अच्छी तरह से 400 कोशिकाओं के घनत्व में 96 अच्छी तरह से अल्ट्रा कम लगाव प्लेटों में एक अलग कोशिकाओं और प्लेट गिनती। अगले दिन, GTCp के विभिन्न सांद्रता जोड़नेएफई (जैसे, अंतिम GTCpFE सांद्रता: 1, 10, 20, 50 माइक्रोन) के अंतिम मात्रा को 100 μl है। तीन प्रतियों में हर उपचार आचरण।
    3. इनक्यूबेटर में संस्कृति के 7 दिनों के बाद, एक औंधा माइक्रोस्कोप का उपयोग कर एक इमेजिंग सॉफ्टवेयर के माध्यम से छवियों को प्राप्त। मैन्युअल नंबर एमएस> 75 माइक्रोन व्यास में गिनते हैं। वाहन पर नियंत्रण करने के लिए नशीली दवाओं के उपचार की तुलना करें।
      नोट: एमएस> 75 माइक्रोन का व्यास इमेजिंग सॉफ्टवेयर का उपयोग निर्धारित किया जाता है।
  2. CD44 + CD24 - सीएससी Immunophenotype
    1. 37 डिग्री सेल्सियस पर 5 मिनट के लिए 0.25% trypsin के साथ एमडीए MB-231 कोशिकाओं Trypsinize। धारा 2.1 में वर्णित के रूप में 10 मिलीलीटर मध्यम में पकवान प्रति 3 लाख कोशिकाओं पर एक hemocytometer और 10 सेमी बर्तन में बीज का उपयोग गिनती। 72 घंटे के लिए कोशिकाओं के लिए वाहन (10 μl डाइमिथाइल sulfoxide) या GTCpFE (50 मिमी शेयर के 10 μl) जोड़ें।
    2. वाहन या GTCpFE उपचार समूहों के लिए, (कदम 3.2.1 के रूप में) Trypsinize कोशिकाओं और 'टेस्ट & # में 1 लाख कोशिकाओं को वितरित39; या 'नियंत्रण' 5 मिलीलीटर polystyrene 1x हांक बैलेंस्ड नमक समाधान (HbSS) के 2 मिलीलीटर युक्त ट्यूबों 2% FBS के साथ पूरक बफर।
    3. सतह मार्कर CD44 और CD24, नीचे स्पिन कोशिकाओं के लिए दाग और एक अंतिम 100 μl कुल मात्रा के लिए ट्यूबों का परीक्षण करने के लिए HBSS + 2% FBS प्रत्येक संयुग्मित एंटीबॉडी के 20 μl और जोड़ने के लिए (1: 5 कमजोर पड़ने)। नलियों नियंत्रित करने के लिए HBSS + 2% FBS के 100 μl जोड़ें। CD44 एपीसी संयुग्मित एंटीबॉडी और CD24 पीई एंटीबॉडी एकल दाग नियंत्रण या आईजीजी immunoisotype नियंत्रण शामिल हैं।
    4. 30 मिनट के लिए 4 डिग्री सेल्सियस पर अंधेरे में कोशिकाओं को सेते हैं। 400 XG पर 5 मिनट के लिए कोशिकाओं नीचे स्पिन और 2% FBS के साथ 200 μl HBSS बफर में पुनर्गठित। अंधेरे में बर्फ पर कोशिकाओं रखें।
    5. निर्माता के निर्देशों के अनुसार एक FACS विश्लेषक साधन का उपयोग कर जीवित कोशिकाओं के प्रतिदीप्ति सक्रिय सेल छँटाई (FACS) का प्रदर्शन। प्रत्येक ट्यूब के लिए कम से कम 50,000 घटनाओं लीजिए। तीन प्रतियों में चलाने के लिए उपचार।
      नोट: गेटिंग सह कोई धुंधला से नियंत्रण पर आधारित है (ntrol ट्यूब), आईजीजी immunoisotypes, और CD44 एपीसी और CD24 पीई एकल दाग।
    6. एक उपलब्ध फ्लो का सॉफ्टवेयर का उपयोग कर डेटा का विश्लेषण।
      नोट: CD44 + CD24 के साथ GTCpFE इलाज सेल का प्रतिशत - immunophenotype अनुमान है और वाहन पर नियंत्रण की तुलना में है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

चित्रा 1 में, साइटोकाइन पर एस्पिरिन-fumarate प्रोड्रग, GTCpFE, और इसके निरोधात्मक गतिविधि की रासायनिक संरचना प्रेरित स्तन कैंसर की कोशिकाओं में NFĸB मार्ग संकेत कर रहे हैं। GTCpFE ऐसे कहनेवाला आसंजन अणु 1 (ICAM1), उत्पाद जानकारी सीसी आकृति Ligand 2 (CCL2), और ट्यूमर परिगलन फैक्टर (TNF) (चित्रा के रूप में दोनों NFĸB समापन, NFĸB-RE luciferase गतिविधि (चित्रा 1 बी) और अभिव्यक्ति NFĸB लक्ष्य जीन की, रोकता 1 सी) MCF 7 स्तन कैंसर की कोशिकाओं में। 50% पर निरोधात्मक एकाग्रता की गणना (आईसी 50) दोनों समापन पर मूल्य ~ 20 माइक्रोन है। आईसी 50 मूल्य एक रेखांकन सॉफ्टवेयर का उपयोग कर की गणना की जाती है। तुलना एएसए खुद भी पर 200 सुक्ष्ममापी (10x GTCpFE के आईसी 50) स्तन कैंसर की कोशिकाओं में कोई निरोधात्मक गतिविधि (चित्रा 1 बी, नीली रेखा) से पता चलता करके। यह इंगित करता है एएसए significa को fumarate Pharmacophore जोड़ने की है कि प्रोड्रग रणनीतिntly अपने विरोधी NFĸB गतिविधि में सुधार।

विरोधी सीएससी गतिविधि को मापने के लिए, हम दो assays का इस्तेमाल किया: mammosphere (एमएस) के गठन परख और CD44 + CD24 व्यक्त कोशिकाओं की जनसंख्या - immunophenotype, स्तन कैंसर के 24 में एक सदाशयी सीएससी सतह मार्कर। GTCpFE एक खुराक निर्भर चित्रा 2A में दिखाया ढंग से एमडीए MB-231 स्तन कैंसर की कोशिकाओं के एमएस गठन रोकता। पक्षपाती संस्कृतियों में NFĸB मार्ग निषेध करने के लिए भी इसी तरह, mammosphere गठन के लिए आईसी 50 मूल्य ~ 20 माइक्रोन है। यह स्थिरता की उम्मीद है, यह देखते हुए कि सीएससी NFĸB अस्तित्व और प्रचार 16-21 के लिए संकेत पर भरोसा है। एमडीए MB-231 कोशिकाओं में आबादी (चित्रा 2 बी) - इसके अलावा, GTCpFE पूर्व उपचार CD44 + CD24 की एक महत्वपूर्ण कमी के परिणामस्वरूप। साथ में, इन परिणामों GTCpFE के प्रभावी रूप से स्तन सीएससी लक्षित करने की क्षमता की स्थापना।

आकृति 1
चित्रा 1: GTCpFE स्तन कैंसर की कोशिकाओं में NFĸB मार्ग को रोकता है। (ए) एस्पिरिन-fumarate प्रोड्रग, GTCpFE की रासायनिक संरचना। (बी - सी) MCF 7 कोशिकाओं पूर्व इलाज विभिन्न TNFα के साथ उपचार के बाद 2-4 घंटे के लिए GTCpFE, आसा की सांद्रता, या वाहन (10 एनजी / एमएल) के साथ 2 घंटे के लिए थे। (बी) NFκB-RE गतिविधि दोहरी luciferase संवाददाता परख द्वारा मापा गया था। (सी) NFκB लक्ष्य जीन, ICAM1, CCL2 और TNF की अभिव्यक्ति RT-qPCR द्वारा मापा गया था। ड्रग निरोधात्मक गतिविधि अकेले TNFα के% के रूप में साजिश रची है। डेटा ± SEM के मतलब के रूप में प्रस्तुत कर रहे हैं। यह आंकड़ा संदर्भ में 15 से संशोधित किया गया है। इस figu का एक बड़ा संस्करण देखने के लिए यहां क्लिक करेंफिर से।

चित्र 2
चित्रा 2: - स्तन कैंसर की कोशिकाओं में immunophenotype GTCpFE mammosphere गठन और CD44 + CD24 रोकता। (ए) Mammosphere (एमएस) एमडीए MB-231 कोशिकाओं के निर्माण GTCpFE की सांद्रता के साथ अलग उपचार के बाद मापा गया था। एमएस विकास (बाएं) और 20X में एमएस के प्रतिनिधि चित्रों के quantitation (दाएं) दिखाए जाते हैं। GTCpFE के प्रभाव% वाहन पर नियंत्रण के रूप में साजिश रची है। (बी) CD44 + CD24 - जनसंख्या एमडीए MB-231 कोशिकाओं 72 घंटे के लिए 50 माइक्रोन के GTCpFE के साथ इलाज के FACS विश्लेषण द्वारा निर्धारित किया गया था। प्रत्येक जनसंख्या प्रतिशत (बाएं) और FACS (दाएं) से प्रतिनिधि तितर बितर भूखंडों के quantitation दिखाए जाते हैं। डेटा SEM और 2 तरह से एनोवा foll के सांख्यिकीय विश्लेषण ± मतलब के रूप में प्रस्तुत कर रहे हैंTukey posttest द्वारा होता था। *** पी <0.001। यह आंकड़ा संदर्भ में 15 से संशोधित किया गया है।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics