Синтез и характеристика аспирином-фумарата пролекарственного соединения, которое угнетает NFκB активность и рак молочной железы стволовых клеток

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Воспаление является отличительным признаком рака, который лежит в основе заболеваемости раком и продвижение по службе, и в конце концов прогрессии к метастазированию. Таким образом, добавление противовоспалительное лекарственное средство в стандартных полках рака может улучшить исход пациента. Одним из таких лекарств, аспирин (ацетилсалициловая кислота, АСК), была изучена для химиопрофилактики рака и противоопухолевой активностью. Кроме ингибирования циклооксигеназы 2-простагландина ось, деятельность противораковые ASA, также были отнесены к ĸB ингибирования ядерного фактора (NFĸB). Поскольку длительное применение АСК может вызвать желудочно-кишечной токсичности, стратегия пролекарством была успешно реализована. В этом пролекарством дизайн карбоновую кислоту ASA маскируется и дополнительные фармакофоров включены.

Этот протокол описывает, как мы синтезировал аспирин-фумарат пролекарство, GTCpFE, и характеризуется его ингибирование пути NFĸB в клетках рака молочной железы и ослабление рака стебля, как собственносвязи, важным NFĸB-зависимый фенотип. GTCpFE эффективно ингибирует путь NFĸB в линии клеток рака молочной железы, тогда как АСА отсутствует какой-либо ингибирующей активностью, что указывает, что добавление фумарат в структуре ASA в значительной степени способствует его активности. Кроме того, GTCpFE показывает значительную активность стволовых клеток противораковое, блокируя образование mammosphere и ослабляя раковых стволовых клеток , связанный CD44 + CD24 - иммунофенотип. Эти результаты создать жизнеспособную стратегию разработки усовершенствованных противовоспалительных препаратов для химиопрофилактики и терапии рака.

Introduction

Воспаление является отличительной чертой , которая лежит в основе множества аспектов онкогенеза, таких как падения и продвижения по службе, и в конечном счете к прогрессии метастаза 1. При раке молочной железы, это подтверждается также эпидемиологических наблюдений, показывающих, что регулярное использование классического нестероидные противовоспалительные аспирин наркотиков (ацетилсалициловая кислота, АСК) связано со снижением как молочной заболеваемости раком, и риск развития метастазов и рецидивов 2,3. АСК действует главным образом путем ингибирования циклооксигеназы-2 активности, которая часто активируемых при раке молочной железы 4,5. Тем не менее, противораковые эффекты АСК также может быть опосредована путем подавления аберрантную ядерного фактора (NFκB кВ) сигнализации 6-8. Это важно , поскольку нерегулируемом NFκB путь способствует выживанию опухолевых клеток, пролиферацию, миграцию, инвазию, ангиогенез и устойчивость к терапии 9-11. NFκB активация пути также имеет важное значение для монтажаиммунный ответ. Поэтому для противораковой терапии, где требуется длительное ингибирование NFκB, необходимо учитывать вредные побочные эффекты, связанные с продолжительную подавление иммунитета. Следовательно, ASA может служить хорошей отправной точкой для терапевтической оптимизации.

Одним из ограничений для применения АСК в терапии рака является повышенные дозы , необходимые для циклооксигеназы 2 и ингибирование NFκB, которые связаны с желудочно - кишечной токсичности, такие как язвы и кровотечение желудка 12,13. Тем не менее, превращение АСК в качестве эфира пролекарством, может привести к снижению желудочно-кишечной токсичности Асы. Для дальнейшего повышения потенции и / или добавлять функциональные возможности, дополнительные конструктивные элементы или вспомогательные фармакофоров также могут быть включены в конструкции эфир пролекарства. Одним из таких Фармакофор добавлены для повышения потенции ASA против пути NFκB является фумарат, который мы ранее показали, что важно для NFκB затрагивающего пути торможения 14,15.

15, GTCpFE, и предположили , что такая гибридная молекула будет безопасным но мощным против пути NFκB. Мы протестировали его анти-NFκB активность в клетках рака молочной железы и его способность блокировать стволовые клетки рака молочной железы (ОКК) 15, которые полагаются на сигнализацию NFκB для выживания и роста 16-21. Мы находим , что потенция GTCpFE против пути NFκB значительно улучшилось по сравнению ASA 15. Кроме того, блоки GTCpFE mammosphere формирование и ослабляется CSC поверхностный маркер CD44 + CD24 - иммунофенотип, указывая , что GTCpFE способна искоренить CSCs 15. Эти результаты устанавливают аспирин-фумарат пролекарство в качестве эффективного противовоспалительного агента, который также может предназначаться груди CSCs. С точки зрения терапии рака молочной железы, GTCpFE может иметь потенциал для лечения агрессивного и смертельной болезнью.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Синтез Аспирин-фумарата пролекарства GTCpFE

  1. С помощью пластмассового плунжера шприца, измеряют 0,81 мл (20 ммоль) метанола и смешивают его в воде (10 мл) в круглодонной колбе. Охлаждают полученную смесь до 0 ° С, помещая колбу в водяную баню со льдом. Добавить 4-гидроксибензил спирт (2,48 мг, 20 ммоль) и реакционную смесь перемешивают до тех пор, пока раствор не станет ясно.
  2. Готовят раствор хлорида O -acetylsalicyloyl (3,77 мг, 19 ммоль) в безводном толуоле (10 мл) путем взвешивания желаемое количество хлорида O -acetylsalicyloyl и его растворения в растворителе в отдельной колбе. С помощью пластмассового плунжера шприца, добавьте этот раствор к смеси, полученной на стадии 1.1, и оставить реакцию перемешивания при 0 ° С.
  3. Мониторинг реакции с помощью тонкослойной хроматографии (ТСХ). Пластины для ТСХ должен иметь кремнезем в качестве неподвижной фазы.
    1. Готовят подвижную фазу, состоящую из 20:80 этилацетата (AcOEt / гексан). В камере ТСХ(Или небольшой контейнер) добавляют 5 мл подвижной фазы, чтобы покрыть дно камеры.
      Примечание: Количество подвижной фазы зависит от камеры, выбранной. Всегда добавляйте достаточно, чтобы покрыть дно, но после того, как TLC помещается внутрь, линия растворителя не должна превышать высоту, где соединения пятнистый.
    2. Возьмите образец реакции с помощью шприца (0,2 мл), поместите его в небольшой пузырек, и разбавить его этилацетатом (2-3 капли). С корректировщик TLC, тщательно взять пробу разбавленной реакционной смеси и определить его в ТСХ.
      ПРИМЕЧАНИЕ: Пятна должны быть 1-2 мм, и это должно быть сделано в нижней 1/4 дюйма пластины ТСХ.
    3. В тот же TLC, поместите пятно раствором хлорида О-ацетилсалицилоилхлорида (0,2 мг в 0,5 мл этилацетата) в качестве сравнения. После того, как пятна сухие, поместить его в камеру и дайте ему поработать до тех пор, пока фронт растворителя почти достиг вершины ТЛК.
    4. Возьмите TLC из, дайте ему высохнуть и визуализировать его под УФ-лампой. REACокончания процесса, когда O -acetylsalicyloyl пятно хлорида исчезает из реакционной смеси.
    5. Когда реакция завершена, удалить водяной бане со льдом, и оставляют реакционную смесь перемешивали при комнатной температуре в течение 20 часов.
  4. Фильтр осадка с использованием воронки Бюхнера с пористым диском средней пористости. Поместите твердое вещество в сцинтилляционный флакон, и оставить соединение в вакууме в течение ночи в эксикаторе при комнатной температуре. Используйте фосфорный ангидрид (P 2 O 5) в качестве осушителя.
  5. Сушат в круглодонную колбу, поместив его в печи при 80 ° С в течение по крайней мере двух дней, перед установкой этой реакции. В качестве альтернативы уплотнение колбу с пробкой и проткнуть его иглой, которая соединена с системой вакуумного насоса. Включите вакуумный насос и высушить колбу с помощью тепловой пушки. Дайте остыть, и повторить этот шаг еще 2 раза.
  6. Надуйте воздушный шар с использованием газообразного аргона, и подключить его к пластиковый шприц (которого толкатель ч, как были удалены) с иглой. Выключите вакуумный насос и удалите иглу, прикрепленную к нему, который был вставлен в уже высушенного колбу с круглым дном. Вставьте иглу, соединенную с баллоном аргона через перегородку уплотнительным круглодонную колбу.
    1. Добавить 4-hydroxymethylphenol эфир 2-acetyloxybenzoic кислоты (100 мг, 0,349 ммоль), 4-диметиламинопиридин (4 мг, 0,033 ммоль) и триэтиламин (53 мг, 0,523 ммоль) в отдельную колбу, а затем растворяют их в безводном тетрагидрофуране (5 мл). С помощью пластмассового шприца, присоединенного к игле, добавьте этот раствор в запечатанный колбу с круглым дном. Охлаждают смесь до 0 ° С, помещая колбу в баню с ледяной водой.
  7. К предыдущей смеси, добавляют раствор хлористого этила fumaroyl (68 мг, 0,419 ммоль) в безводном тетрагидрофуране (5 мл), по каплям в течение 10 мин. Перемешивают полученный раствор при температуре 0-5 ° С в течение 2-4 ч.
  8. Экстрагируют реакционную смесь этилацетатом (100 мл) и насыщенным раствором соли (50 мл). <бр /> Примечание: Рассол представляет собой насыщенный раствор хлорида натрия (NaCl). Чтобы его приготовить, поместите 200 мл воды в чистой стеклянной посуде затем начать добавлять NaCl (при перемешивании) до тех пор, пока не растворяется больше.
    1. После экстракции удалить водную фазу и повторить последний шаг еще два раза.
    2. Сушат смесь путем добавления сульфата натрия в органическую фазу, до тех пор, пока твердое вещество не не наносит удар, когда стеклянная посуда перемешивают. С помощью другого воронки Бюхнера с пористым диском, смесь фильтруют в круглодонную колбу для удаления сульфата натрия, а затем выпаривают досуха с помощью роторного испарителя с температурой, установленной при 40 ° C.
  9. С помощью TLC, определить надлежащую подвижной фазы для использования в хроматографической колонке.
    Примечание: Для этого эксперимента был использован градиент 20:80 AcOEt / гексан.
  10. Готовят колонку с силикагелем и соответствующей фазы растворителя. После того, как соединение было добавлено, добавить слой сульфата натрия (или песка) ргЗащищать колонна в качестве растворителя добавляют.
    1. Как работает колонка, следить за элюата с помощью ТСХ. Пятно любой другой пробиркой, как они собраны из колонки. Когда интересующий продукт элюируется, смешать все образцы, содержащие чистый продукт в большую колбу с круглым дном, и высушить их с помощью роторного испарителя при температуре бане при 40 ° С.
      Примечание: Продукт должен появиться в виде белого твердого вещества.
  11. Для подтверждения структуры GTCpFE, собирать протон и углерод (1 Н и 13 С, соответственно) ядерного магнитного резонанса (ЯМР) в соответствии с инструкциями изготовителя.
    Примечание: В этом исследовании 400 МГц FT ЯМР - спектрометр был использован для сбора 1 Н и 13 С спектров. Выполнить по крайней мере 25 сканирований при комнатной температуре, чтобы получить достаточное разрешение данных. Пики ЯМР наблюдаемые были следующие, 1 H ЯМР (CDCl 3): δ 1,29 (т, 3 H, 3J = 7,0 Гц, CH 3); 2,31 (с, 3 Н, СН 3); 4,26 (д, 2 Н, 3J = 7,0 Гц, СООСН 2); 5,25 (с, 2 Н, ОСН 2); 6,89 (с, 2 Н, НС = СН); 7,19 (м, 3Н, Аr); 7,42 (м, 3Н, Аr); 7,65 (м, 1H, Ar); 8,22 (дд, 1H, 3J = 7,8, 4J = 1,2 Гц, Ar). 13 C ЯМР (CDCl 3) & delta ; : 169.70, 164.86, 164.75, 162.89, 151.28, 150.69, 134.76, 134.32, 133.26, 133.16, 132.25, 129.81, 126.26, 124.11, 122.47, 122.04, 66.40, 61.43, 21.05, 14.15.
  12. Кроме того, собирать высокие масс-спектр разрешения с использованием жидкостной хроматографии масс-спектрометрии в сочетании с ионной ловушкой и времени технологии полета (LCMS-IT-TOF) для точных измерений массы в соответствии с инструкциями изготовителя.
    Примечание: В данном исследовании (M + NH 4 +) рассчитывается следующим образом : 430.1496; наблюдается: 430,1477.

2. GTCPFE Угнетает NFĸB активность в клетках рака молочной железы

  1. Клеточная культура Условия
    1. Поддержание линии клеток рака молочной железы человека, MCF-7 и MDA-MB-231 в соответствии со стандартом клеток кульметоды хозяйства и распространяются в увлажненном инкубаторе при температуре 37 ° С с 5% CO 2.
      1. Готовят клеточную среду MCF-7 из института Roswell Park Memorial (RPMI) 1640 с фенолового красного с добавлением 10% фетальной бычьей сыворотки (FBS), 1% заменимых аминокислот, 2 мМ L-глутамина, 1% антибиотики пенициллин-стрептомицина и 6 нг / мл инсулина. Готовят среду клеток MDA-MB-231 с улучшенной минимально необходимой среды (ИМЕМ) с добавлением 5% FBS, 1% заменимых аминокислот, 2 мМ L-глутамина и 1% антибиотиков пенициллина-стрептомицина.
  2. NFκB-RE люциферазы Анализ
    1. Trypsinize MCF-7 клеток рака молочной железы с использованием 0,25% трипсина в течение 5 мин при температуре 37 ° С, вручную рассчитывать с помощью гемоцитометра и семена в 24-луночные планшеты в количестве 90000 клеток на плотность скважин.
    2. Следующие клетки день, совместно трансфекции плазмидной ДНК элемента ответа NFκB (NFκB-RE) люциферазы конструкции, 1 мкг / лунку, дрОнг с Renilla люциферазы промотора конструкции, 0,2 мкг / лунку. Выполните трансфекций для каждой группы лечения в трех экземплярах.
      1. Промыть клетки дважды PBS, и инкубировать с помощью смесей плазмидной ДНК и 1 мкл на лунку трансфекции реагента (например , Липофектамин) в бессывороточной среды. Через 6 ч изменить среду к 1 мл регулярной среде (без антибиотиков пенициллина и стрептомицина).
    3. Через 16 ч, добавляют 1 мкл транспортного средства или различных фондовых решений GTCpFE или ASA препаратов в каждую лунку. Растворить препарат маточные растворы (100, 50, 20, 10 и 1 мМ) в диметилсульфоксиде при концентрации 1,000x. После добавления препаратов, инкубировать клетки в течение 2 ч при 37 ° С.
    4. Для активации NFκB пути, добавьте провоспалительного цитокина ФНО (10 мкг / мл стоковый раствор) в каждую лунку для конечной концентрации 10 нг / мл и инкубируют в течение 4 часов. Включите в одиночку контролировать ФНО. Аспирируйте среду и сохранить ячейкус при температуре -80 ° С.
    5. Измерение люциферазы с использованием люциферазы системы репортер анализа в соответствии с инструкциями производителя.
      Примечание: При использовании системы анализа люциферазы (например , тест - системы двойной люциферазы) в первый раз, готовят раствор реагента для анализа люциферазы путем повторного суспендирования в 10 мл буфера и хранить его при температуре -80 ° C в аликвотах по 1 мл.
      1. Приготовьте 1х буфера для лизиса путем разбавления 5x запаса буфера с водой. Клетки Lyse в каждую лунку с помощью 100 мкл буфера для лизиса 1x. Инкубируйте пластин на орбитальном шейкере в течение 15 мин, на средней скорости.
      2. Добавьте один 1,5 мл туба на образце. Оттепель люциферазы анализа реагента до комнатной температуры (потребуется 50 мкл каждого образца) и держать в фольгу. Приготовьте 1х реагента закалкой в ​​стеклянном флаконе, 1:49 разведение в буфере и вихря он (потребуется 50 мкл каждого образца).
      3. Добавьте 10 мкл лизата клеток с меченым микроцентрифужных трубки. Затем добавляют 50 мкл реагента для анализа люциферазы имягко вихрь. Сразу же после того, как положите трубку в держатель и измерьте свечение с помощью двойной программы люциферазы в фотометр. Выберите и нажмите следующее: Run Promega Протоколы → Dual Glo → OK.
      4. Добавьте 50 мкл реагента закалочной в пробирку и аккуратно вихре. Измерьте свечение. Повторите эти действия для каждого образца.
      5. Анализ данных с помощью электронных таблиц путем нормализации NFκB-RE для внутреннего контроля Renilla (NFκB-RE / Renilla). Сравнить ингибитор данные только ФНО контроля (TNF-alpha только устанавливается в размере 100%).
  3. NFκB-ген - мишень Транскрипция
    1. Семенной MCF-7 клеток в 6-луночные планшеты в количестве 250000 клеток на лунку в объеме 2 мл объема среды, полученных, как описано в разделе 2.1.
    2. На следующий день, добавьте 2 мкл различных GTCpFE 1,000x запасов (100, 50, 20, 10 и 1 мМ) в течение 2 ч перед добавлением TNF & alpha; 10 нг / мл в течение еще 2 часа. Выполнить все лечениев трех экземплярах. Включить транспортное средство и TNF-alpha в покое управления.
    3. Изолировать РНК с использованием способа экстракции гуанидин тиоцианат-фенол-хлороформ в соответствии с инструкциями изготовителя 22. Определить концентрацию РНК (в диэтилпирокарбонатом (DEPC) -обработанной вода) и чистоту РНК с использованием спектрофотометра. Хранить образцы РНК на льду или хранить при температуре -80 ° С. Используйте только РНКазы барьер советы при работе с РНК.
    4. Обратный транскрибировать 0,5 мкг тотальной РНК с использованием коммерчески доступного набора из вируса мышиного лейкоза Молони (M-MLV) обратной транскриптазы.
      Примечание: Комплект включает в себя 5x буфер и дитиотреитола (ДТТ), вместе с дНТФ смеси и случайные гексамеры смеси.
      1. Добавить 0,5 мкг РНК до 200 единиц M-MLV, 0,5 мМ дНТФ, 100 нг случайных гексамеров, 10 мМ DTT, 1x буфер и DEPC дистиллированной водой до конечного объема 10 мкл реакционной. Проводят реакции обратной транскриптазы с помощью заряднника ПЦР в течение 50 мин при 37 ° С, а затем 15 мин при 70 &# 176; С термическому инактивировать фермент.
    5. Развести полученный продукт кДНК до 100 мкл дважды дистиллированной воды и используют по 2 мкл для каждой последующей количественной полимеразной цепной реакции (ПЦР) реакции.
      1. Смешать прямого и обратного праймеров для представляющего интерес гена в 1,25 мкМ концентрации каждого. Подготовьте основной смеси с 2 мкл бидистиллированной воды, 1 мкл 1,25 мкМ смеси праймера и 5 мкл 2x красителя, чтобы включить обнаружение двухцепочечной ДНК. Загрузите 2 мкл кДНК и 8 мкл основной смеси в 96-луночных ПЦР планшет.
    6. Провести количественный ПЦР с использованием системы реального времени ПЦР (40 циклов, 95-60 ° C) в соответствии с инструкциями изготовителя и вручную анализировать данные.
      Примечание: Все ПЦР - праймеры , используемые были подтверждены и сообщалось ранее 23.
    7. Вычислить изменение кратную экспрессии генов с использованием электронной таблицы с помощью метода ΔΔCt, с рибосомального белка 36B4 мРНК , выступающей в качестве внутреннего контроля 23.

3. GTCpFE Угнетает Рак молочной железы стволовых клеток в пробирке

  1. Mammosphere Формирование Анализ
    1. Подготовка mammosphere (MS) среде, дополнив Дульбекко в модификации Дульбекко: питательную смесь F-12 (DMEM / F12) без фенолового красного среде с 1% метилцеллюлозы. Разрешить растворяться при осторожном встряхивании в течение ночи при температуре 4 ° С. Фильтр стерилизовать среды и дополнить В27 1x, 1% пенициллина и стрептомицина, 5 мкг / мл инсулина, 1 мкг / мл гидрокортизона, и 20 нг / рекомбинантного человеческого эпидермального фактора роста мл.
    2. Готовят одиночные клетки клеточной линии MDA-MB-231, с помощью трипсин-переваривание (трипсин 0,25% в течение 5 мин при 37 ° С) однослойных культур и фильтруют через сито с ситами. Вручную рассчитывать одиночный диссоциированных клеток и пластины в 96-луночных крепежных пластин сверхнизких при плотности 400 клеток / лунку. На следующий день, добавить различные концентрации GTCPFE (например, конечные концентрации GTCpFE: 1, 10, 20, 50 мкМ) до конечного объема 100 мкл. Провести все лечение в трех экземплярах.
    3. Через 7 дней культивирования в инкубаторе, получать изображения с помощью программного обеспечения визуализации с использованием инвертированного микроскопа. Вручную подсчитывать количество MS> 75 мкм в диаметре. Сравните медикаментозное лечение для управления транспортным средством.
      Примечание: Диаметр MS> 75 мкм определяется с помощью программного обеспечения визуализации.
  2. CD44 + CD24 - CSC Иммунофенотип
    1. Trypsinize клеток MDA-MB-231 с 0,25% трипсина в течение 5 мин при 37 ° С. Граф с помощью гемоцитометра и семян 10 см чашках в 3 миллиона клеток на чашку в 10 мл среды, как это описано в разделе 2.1. Добавить транспортное средство (10 мкл диметилсульфоксида) или GTCpFE (10 мкл 50 мМ исходного раствора) к клеткам в течение 72 ч.
    2. Для транспортных средств или лечения GTCpFE групп, Trypsinize клетки (как на этапе 3.2.1) и распространить 1 миллион клеток в 'Test & #39; или 5 мл полистирольные трубки «контроль», содержащие 2 мл 1x Hank сбалансированный солевой раствор (HBSS) буфера с добавлением 2% FBS.
    3. Для того, чтобы окрасить для CD44 поверхностных маркеров и CD24, спиновые клеток вниз и добавляют по 20 мкл каждого конъюгированного антитела и HBSS + 2% FBS в пробирки для общего объема 100 мкл финальные (разведение 1: 5). Добавьте 100 мкл HBSS + 2% FBS, чтобы контролировать трубы. Включите CD44-APC антитела, конъюгированного и CD24-PE антитела одиночные элементы управления окрашивать или элементы управления immunoisotype IgG.
    4. Инкубируйте клетки в темноте при температуре 4 ° С в течение 30 мин. Спин вниз клетки в течение 5 мин при 400 мкг и воссоздавать в 200 мкл HBSS буфера с 2% FBS. Держите клетки на льду в темноте.
    5. Выполните флуоресцентной активированный сортировки клеток (FACS) живых клеток с использованием анализатора прибора FACS в соответствии с инструкциями изготовителя. Соберите по крайней мере, 50000 событий для каждой трубки. Запуск процедуры в трех экземплярах.
      Примечание: Gating основан на элементах управления от полного отсутствия окрашивания (Coтрубка управляете), IgG immunoisotypes и CD44-APC и CD24-PE одиночные пятна.
    6. Анализ данных с помощью доступного программного обеспечения цитометрии потока.
      Примечание: Процент GTCpFE обработанной клетки с CD44 + CD24 - иммунофенотипом оценивается и по сравнению с контрольным носителем.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

На рисунке 1, химическая структура аспирин-фумарата пролекарством, GTCpFE и его ингибирующую активность на цитокин индуцированного NFĸB пути в клетках рака молочной железы указаны. GTCpFE ингибирует обе NFĸB конечных точек, NFĸB-RE активность люциферазы (рис 1b) и экспрессию генов - мишеней NFĸB, такие как межклеточной адгезии 1 (ICAM1), хемокинового CC Motif лигандом 2 (CCL2) и фактора некроза опухоли (TNF) (рис 1C) в MCF-7 клеток рака молочной железы. Рассчитано ингибирующей концентрации на 50% (50 СК) значение на обеих конечных точках составляет ~ 20 мкМ. 50 значение IC рассчитывается с использованием графическое программное обеспечение. Для сравнения ASA сама даже при 200 мкМ (10x IC 50 GTCpFE) не проявляет ингибирующую активность (рис 1B, синяя линия) в клетках рака молочной железы. Это свидетельствует о том, что стратегия пролекарством добавления фумарат фармакофор к ASA significantly улучшает его анти-NFĸB активностью.

Для измерения активности анти-CSC, мы использовали два анализов: The mammosphere (MS) анализ формирования и популяцию клеток , экспрессирующих CD44 + CD24 - иммунофенотип, добросовестный CSC поверхностный маркер при раке молочной железы 24. GTCpFE ингибирует образование MS в MDA-MB-231 клеток рака молочной железы в зависимом от дозы , показанной на фигуре 2А. Подобно NFĸB затрагивающего пути торможения в прилипших культурах, значение IC 50 для формирования mammosphere составляет ~ 20 мкМ. Эта согласованность , как ожидается, учитывая , что ОКК полагаются на сигнализацию NFĸB для выживания и распространения 16-21. Кроме того, GTCpFE предварительная обработка приводит к значительному обеднению CD44 + CD24 - популяции (Фигура 2В) в клетках MDA-MB-231. В совокупности эти результаты устанавливают способность GTCpFE эффективно предназначаться груди CSCs.

Рисунок 1
Рисунок 1: GTCpFE ингибирует путь NFĸB в клетках рака молочной железы. (А) Химический состав аспирина-фумарата пролекарством, GTCpFE. - С) MCF-7 клетки предварительно обрабатывали в течение 2 ч с различными концентрациями GTCpFE, ASA, или транспортное средство с последующей обработкой с TNF & alpha ; (10 нг / мл) в течение 2-4 ч. (Б) NFκB-RE активность измеряли с помощью двойного анализа люциферазы репортера. (С) Экспрессия генов - мишеней NFκB, ICAM1, CCL2 и TNF измеряли с помощью RT-QPCR. ингибирующая активность Drug на графике как% от TNF & alpha; в одиночку. Данные представлены в виде среднего значения ± SEM. Эта цифра была изменена со ссылкой 15. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этого FIGUчисло рейнольдса

фигура 2
Рисунок 2: GTCpFE ингибирует образование mammosphere и CD44 + CD24 - иммунофенотип в клетках рака молочной железы. Формирование (А) Mammosphere (МС) из клеток MDA-MB-231 была измерена после лечения с различными концентрациями GTCpFE. Количественное роста MS (слева) и представительных картин МС на 20X (справа) показаны. Эффект GTCpFE на графике как управление% транспортного средства. (Б) CD44 + CD24 - население определяли с помощью FACS - анализа клеток MDA-MB-231 , обработанных 50 мкМ GTCpFE в течение 72 ч. Количественное каждого процента населения (слева) и представительные разброс участков из FACS (справа) показаны. Данные представлены в виде среднего значения ± SEM и статистический анализ 2-однофакторного дисперсионного анализа Фолюпричитающиеся Тьюки посттестовых. *** P <0,001. Эта цифра была изменена со ссылкой 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics